Here, we propose a unified platform for microbial tracking and bacterial strain iden- tification through the use inert synthetic DNA barcodes. The system works on the gathering of a strain experimental data together with in silico resources, and the stor- age of this information as short DNA links within barcoded strains. We discussed in this chapter the considerations involved in barcode design to efficiently tag two model microorganisms, and how to retrieve strain documentation by a simple sequencing re- action. Then, we demonstrated the efficiency of our barcode DNA cloning method. For the development of our barcoding platform, we adapted the experimental pro- tocols that were used to manipulate barcoded cells to a barcoding kit, presented in Appendix C. Finally, we showed the stability of DNA barcodes in vivo over a large number of bacterial generations with the use of continuous flow and high-throughput culture equipment. Altogether, we set the foreground for the development of DNA barcoding technologies. To open towards barcodes scalability, we discuss in the next
3.6. Summary 85 chapter combinatorial genetic libraries that were characterised to populate our plat- form with bacterial signaling example resources, and discuss further aspects of this work in Chapter 6.
87
Chapter 4
Genetic circuits engineering
In Chapter 3, we introduced the Bac2code platform with the creation and character- isation of DNA barcode sequences. These sequences are used as identifiers to docu- ment the information about specific bacterial strains. After setting up the barcoding framework, we moved on to building a biorepository of genetic circuits to populate our platform with documented examples of barcoded strains. This chapter provides an overview of the construction and characterisation of genetic circuits that could be found on the Bac2code server.
4.1
Bacterial communication via quorum sensing
Cell-to-cell signaling requires the intervention of specific metabolites that act as acti- vators/repressors over genetic subunits[40, 140]. Widely spread amongst the bacte- rial kingdom, quorum sensing is a universal way for bacteria to synchronise differen- tial growth behaviour. Quorum compounds are signaling molecules that accumulate within a bacterial population and trigger a coordinated response over a certain thresh- old, dependent on cell density. Initially discovered in Vibrio fischeri by the emission of bioluminescence in the dark[120], quorum sensing has now been characterised in many Gram-negative and Gram-positive organisms as a mean of bacterial communi- cation[155, 75, 206, 232]. For instance, Vibrio fischeri swims freely in seawater at con- centrations of 10 cells for liter and does not produce any light in these conditions. However, bacteria can stick and develop with a variety of sea organisms in a symbi- otic relationship. In such environments, bacteria can grow to concentrations of 1010
cells per liter and coordinate cellular responses, coupled to a process of luminescence emission[198, 197]. As an example, the Hawaiian squid Euprymna scolopes uses Vibrio fischeri as a light organ, where fluctuating bacterial cell densities allow it to be prac- tically invisible, or to hunt in deep sea water whilst using bacteria as a light source.
In this chapter, we deconvoluted a quorum sensing system into sender and receiver components in order to characterise signal transduction in bacteria.
4.1.1
Quorum signaling molecules: the lux model
Over the years, bacterial behaviour changes based on the detection of specific cell densities has been referred to as quorum sensing[71, 31]. Quorum compounds are very specific signaling molecules mediating intercellular communication via autoin- duction[99, 94, 143, 78]. In simple terms, a chemical species is produced by a pro- tein that positively regulates its own expression. This mechanism, called a positive feedback loop, allows the amplification of signals as cellular density increases. There are two known types of quorum molecules in bacteria: Gram-negative species use N- acetylated homoserine lactones while Gram-positives use processed oligo-peptides[148,
254,74]. We focussed on the engineering of E. coli species and thus specialised in a spe- cific type of homoserine lactone (AHL).
We based this work on the use of Vibrio fischeri lux system. In this organism, the quorum sensing machinery is controlled by the bipartite LuxR/LuxI operon[217]. As shown in Figure 2.7, the left part of the operon drives the expression of the LuxR pro- tein regulator, while the right part produces the LuxICDABEG transcript. The latter encodes the AHL autoinducer (LuxI) and a cassette containing bioluminescence genes (LuxCDABEG). In combination with AHL, LuxR activates transcription of LuxI and more of the quorum molecule is produced. In the absence of the autoinducer, LuxR represses the production of quorum sensing molecules.
4.1.1.1 LuxR regulator
Low constitutive expression of LuxR via the promoter PL−luxproduces dimer proteins
that bind to the -35 unit of PR−lux. The PR−luxpromoter uses a lux box as its -35 element.
This box is a 20bp inverted palindromic repeat (’ACCTGTAGGATCGTACAGGT’) and allows dimerisation of active LuxR proteins[84]. However, in the absence of AHL (quorum compound), LuxR is inactive and does not allow the RNAp to initiate tran- scription at this site. Binding of AHL to the N-terminal domain of LuxR allows its C-terminal DNA binding domain to become active. Therefore, the RNAp holoenzyme can only initiate its activity in the presence of AHL, which facilitates LuxR dimerisation on the PR−lux -35 to act as an activator of the RNAp open-complex formation. There
is a nonlinear relationship between concentration and response behaviour in quorum sensing processes[124,242]. The response exhibited by LuxR on the PR−luxpromoter is
4.1. Bacterial communication via quorum sensing 89 typical of DNA binding proteins, and is essential for signal recording in in vivo expres- sion studies.
4.1.1.2 LuxI autoinducer
In Vibrio fischeri, the AHL autoinducer (3-oxo-C6 HSL) is the product of the LuxI pro- tein catalytic activity[52, 70, 82]. Precursors that are found within the cytosol (acyl- ACP and S-adenosylmethionine or SAM) are converted by LuxI into AHL and become available to ease LuxR binding to PR−lux. This, in turn, activates transcription of more
LuxI protein resulting in higher autoinducer levels[219]. As we described ealier, LuxI is followed by the LuxCDABEG proteins in its native host and these are responsible for the emission of luminescence. Nevertheless, for the sake of this study, we replaced this large operon by a single fluorescent protein, offering better capabilities for in vivo characterisation. This positive feedback loop is very important for hysteresis of trans- fer curves in modelling studies. Here, hysteresis is shown as a lag in fluorescence emission created by a change in inducer concentration. This phenomenon is further described in the next sections.
4.1.2
Inducible quorum devices
As we detailed above, quorum sensing systems are found in a range of bacteria, and the V. fischeri Lux operon was cloned in E. coli and shown to display similar functions as in its native host[57]. In this Chapter, we describe the deconvolution of the lux operon into sender and receiver genetic circuits in E. coli[152]. Figure 4.1 describes the rationale behind building these circuits. Using generic methods for bioengineering described in Chapter 2 and the next section, we constructed a series of bacterial devices (plasmids) and characterised their behaviour in vivo. We replaced the lux emission of the lumines- cence system by the emission of fluorescence, and followed signalling molecules over a range of conditions using characterisation techniques providing single-cell to popu- lation scale resolution. The following sections describe the genetic assemblies built in this study to re-orchestrate quorum behaviour in E. coli. Bacterial systems were cre- ated, characterised, modelled and re-evaluated in order to provide the most efficient parameters for signal emission, detection and amplification in genetic circuits.
FIGURE 4.1: Assembly of genetic circuits in synthetic biology. (A) de- scribes the different genetic parts that were combined to build genetic circuits. (B) shows a standard visual representation of these parts. (C) displays an example of genetic circuit functional assembly producing a
protein of interest along a fluorescent reporter.