FORMALIZACIÓN DE CAMBIOS

In the present work, DNA methylation status of three repetitive elements (LINE1, Satα, and Alu1) was analyzed by MethyLight, TaqMan-based real-time PCR assay. DNA isolated from cells was bisulfite converted, and then the amplification of LINE1, Satα, and Alu1 was performed by real time PCR as described previously [214], using the methylated Alu1 sequence for normalization and the set of primers and probes from Table 11.

Table 11. Sequences of the primers for Methylight assay according to Weisenberger et al. [214].

Reaction

ID Sequence forward (5' to 3') Sequence reverse (5' to 3') (5' to 3'Probe a₎ Amplico_{n (bp)}

Gene bank Locus

MATERIALS AND METHODS 53 TCGGG CCGTT TCGAATATTGCGTTT TCGGATCGGTTT- BHQ1 BHQ1 = Black Hole Quencher 1 Alu1 GGTTAGGTATAGTGGTTTATATTTGTAATTTTA

GTA ATTAACTAAACTAAT CTTAAACTCCTAACC TCA VIC- CCTACCTTAACCTCC C-MGB MGB = Minor Groove Binding 97 Consensus seq. [214] Satα-M1 TGATGGAGTATTTTTAAAATATACGTTTTGTA

GT

AATTCTAAAAATATT CCCTTCAATTACGTA

A

SybrGreen I chemistry 121 M38468

2.6.1 DNA isolation from cells

PeqGOLD Tissue DNA Mini Kit (PEQLAB GmbH), QIAamp DNA FFPE Tissue Kit (Qiagen GmbH), and QIAamp DNA Blood Mini Kit (Qiagen GmbH,) were used to extract the genomic DNA from cells, from FFPE tissue, and from serum, respectively. These kits take advantage of the reversible binding properties of a silica-based material, combined with the speed of mini-column spin technology. The buffers provided with the columns allow genomic DNA to bind to the matrix. Samples were first homogenized, lysed under denaturing conditions, and then applied to the DNA Columns, where the DNA is effectively bound to the silica membrane. Cellular debris, proteins, and other contaminants were washed away by specific buffers. The high quality DNA was finally eluted in Elution Buffer.

Procedure: DNA from cultured cells was isolated with PeqGOLD Tissue DNA Mini Kit. The cells were lysed with 400 µl lysis buffer and scraped from the 10 cm2 _{dishes. The lysate} was placed in 1.5 ml reaction tubes and the procedure was followed according to manufacturer’s instructions. The final concentration of the isolated genomic DNA was measured with a Nanodrop 2000c spectrophotometer (PEQLAB GmbH) and the DNA solution was stored at -20ºC until bisulfite conversion was performed.

2.6.2 DNA isolation from FFPE tissue and serum

DNA was isolated with the QIAamp DNA FFPE Tissue Kit. First, 4 slices of 10 µm thickness were cut from the carotid tissue samples and placed in a 1.5 ml tubes. The protocol was followed as described in the manufacturer’s instructions. DNA concentration was measured with the spectrophotometer and stored at -20ºC until bisulfite conversion was performed.

Fresh blood was collected, centrifuged and serum was stored at -80ºC until DNA was further used. DNA was isolated with the QIAamp DNA Blood Mini Kit, according to manufacturer’s instructions using 200 µl of serum for each extraction procedure.

MATERIALS AND METHODS 54

2.6.3 Bisulfite conversion

Incubation of the target DNA with sodium bisulfite results in conversion of

unmethylated cytosine residues into uracil, leaving the methylated cytosines unchanged. Therefore, bisulfite treatment leads to changes in DNA sequence for methylated in contrast to unmethylated DNA as shown in Table 12.

Table 12. Example of the effect of bisulfite conversion on unmethylated cytosines.

Original sequence After bisulfite treatment

Unmethylated DNA T-CG-T-CG-A-CG-T T-UG-T-UG-A-UG-T

Methylated DNA T-CG-T-CG-A-CG-T T-CG-T-CG-A-CG-T

The critical step for correct determination of a methylation pattern is the complete conversion of unmethylated cytosines. For this purpose, commercially available kits were used. Sodium bisulfite conversion of DNA from cells, FFPE material, or serum was in all cases performed by using EpiTect Bisulfite Kit (48) (Qiagen GmbH).

The EpiTect Bisulfite procedure comprises of the following steps: bisulfite mediated conversion of unmethylated cytosines; binding of the converted single-stranded DNA to the membrane of an EpiTect spin column; desulfonation of membrane-bound DNA; removal of desulfonation agent; elution of the converted DNA from the spin column. The eluted DNA was used for the analysis of DNA methylation by MethyLight assay, a Taqman based real time PCR.

Procedure: DNA was diluted to 500 ng DNA in 20 µl of elution buffer for each bisulfite conversion reaction. According to the manufacturer, bisulfite mix was added to the DNA solution. To this mixture, DNA protect buffer was added, well mixed, and placed in the thermal cycler with a program shown in Table 13.

Table 13. Thermal cycler conditions for bisulfite conversion reaction.

Step Temperature Time

Denaturation 95°C 5 min

Incubation 60°C 25 min

MATERIALS AND METHODS 55

Incubation 60°C 85 min (1 h 25 min)

Denaturation 95°C 5 min

Incubation 60°C 175 min (2 h 55 min)

Hold 20°C Indefinite

After bisulfite conversion was completed, the tubes were briefly centrifuged, and the content transferred into a new 1.5 ml reaction tube. The next steps were performed according to instructions provided with the kit. Finally, bisulfite converted DNA was diluted to 10 ng/µl and aliquots were stored at -80ºC until the Methylight assay was performed. For each PCR reaction 20 ng bisulfite converted DNA was used.

2.6.4 TaqMan-based real time PCR

TaqMan procedure specifically detects the target gene sequence, so nonspecific products do not affect the accuracy of quantification this being the main advantage over DNA binding dyes. TaqMan assays employ a sequence-specific, fluorescently labeled oligonucleotide probe called the TaqMan probe, in addition to the sequence-specific primers. The probe contains a fluorescent reporter at the 5' end and a quencher at the 3' end. When intact, the fluorescence of the reporter is quenched due to its proximity to the quencher. During the combined annealing/extension step of the amplification reaction, the probe hybridizes to the target and the dsDNA-specific 5'3' exonuclease activity of nuclease (thermostable polymerases) cleaves off the reporter. As a result, the reporter is separated from the quencher, and the resulting fluorescence signal is proportional to the amount of amplified product in the sample.

Procedure: For the determination of global DNA methylation a TaqMan-based methylation specific real-time PCR (Methylight) system was used. Methylation of LINE1 (Metabion International AG, Germany) and Satα (MWG Operon Eurofins) was determined using the TaqMan Universal PCR Master Mix, No Amp Erase UNG (Roche). As reference for input of bisulfite converted DNA a methylation independent ALU1 (Metabion International AG, Martinsried, Germany) TaqMan system was used. For each real time PCR amplification the template was equivalent to 10 ng of bisulfite converted DNA and measurements were performed in triplicates. Fully methylated bisulfite converted DNA from the EpiTect PCR Control DNA Set (Qiagen GmbH) was used as 100% methylated control. Primers were optimized for StepOnePlus thermocycler. Quantification was normalized to the ALU1 gene within the log-linear phase of the amplification curve obtained for each probe/primer set using the ΔCT method using a reference gene.