In this study, multiple waterborne pathogens were detected in different water sources for
a period of seven-months, demonstrating that MFQPCR is a useful technique for long-term
biological water quality monitoring, even in resource limited settings. However, there were
limitations to the study. A number of MFQPCR assays used for the detection of viruses and
bacteria were not used due to poor efficiencies during the MFQPCR plate run. Although all
assays achieved approximately 90% efficiency when run with conventional qPCR, some assays
did not perform as expected in the final MFQPCR plate. To overcome these limitations,
MFQPCR assays should be run with standards only to validate assays prior to sample
enumeration. Future studies should also aim to increase sample volume to achieve lower
quantification limits. While quantification limits reported were comparable to similar studies,
sample processing, reverse transcription, and optional sample clean-up methods all contribute to
increasing the lower limit of detection in the original sample. Despite these limitations, the
results of this study contributed to the understanding of seasonal effects on microbial water
REFERENCES
1. Johansson EW, Carvajal L, Newby H, Young M, Wardlaw T. 2012. Pneumonia and diarrhoea: Tackling the deadliest diseases for the world's poorest children. Unicef, 2. Black RE, Morris SS, Bryce J. 2003. Where and why are 10 million children dying
every year? The Lancet 361:2226-2234.
3. Anonymous. 2015. Key Facts from JMP 2015 Report. World Health Organization, 4. Field C, Barros V, Mach K, Mastrandrea M. 2014. Climate Change 2014: Impacts,
Adaptation, and Vulnerability; Technical Summary. Intergovernmental Panel on Climate Change.
5. Gray NF. 2014. The Implications of Global Warming and Climate Change on Waterborne Diseases, p 653-666, Microbiology of Waterborne Diseases doi:10.1016/b978-0-12-415846-7.00036-6.
6. Curriero FC, Patz JA, Rose JB, Lele S. 2001. The Association Between Extreme Precipitation and Waterborne Disease Outbreaks in the United States, 1948-1994. American Journal of Public Health 91:1194-1199.
7. K.H. Cook EKV. 2012. Impact of climate change on mid-twenty-first century growing seasons in Africa. Climate Dynamics 39:2937-2955.
8. Armstrong B, Hajat S, Kovats S, Lloyd S, Scovronick N, Wilkinson P. 2012. Climate change: how can epidemiology best inform policy? Epidemiology 23:780-784.
9. Hosking J, Campbell-Lendrum D. 2012. How well does climate change and human health research match the demands of policymakers? A scoping review. Environ Health Perspect 120:1076-1082.
10. Kolstad EW, Johansson KA. 2011. Uncertainties associated with quantifying climate change impacts on human health: a case study for diarrhea. Environ Health Perspect 119:299-305.
11. Akanda AS, Jutla AS, Colwell RR. 2014. Global diarrhoea action plan needs integrated climate-based surveillance. The Lancet Global Health 2:69-70.
12. Mellor JE, Levy K, Zimmerman J, Elliott M, Bartram J, Carlton E, Clasen T, Dillingham R, Eisenberg J, Guerrant R, Lantagne D, Mihelcic J, Nelson K. 2016. Planning for climate change: The need for mechanistic systems-based approaches to study climate change impacts on diarrheal diseases. Sci Total Environ 548-549:82-90. 13. Olmstead SM. 2014. Climate change adaptation and water resource management: A
review of the literature. Energy Economics 46:500-509.
14. Anonymous. 2014. National Population and Housing Census 2014. Statistics UBo, Kampala, Uganda.
15. Vermeiren K, Van Rompaey A, Loopmans M, Serwajja E, Mukwaya P. 2012. Urban growth of Kampala, Uganda: Pattern analysis and scenario development. Landscape and Urban Planning 106:199-206.
16. Dobson S, Nyamweru H, Dodman D. 2015. Local and participatory approaches to building resilience in informal settlements in Uganda. Environment and Urbanization 27:605-620.
17. Dimanin P. 2012. Exploring Livelihoods of the Urban Poor in Kampala,Uganda. ACF International.
18. Rugadya MA, Kamusiime H, Nsamba-Gayiiya E, Koojo C. 2008. National Slum Upgrading Strategy and Action Plan. Ministry of Lands HaUD,
19. Anonymous. 2012. Uganda National Urban Profile. United Nations Human Settlements Programme,
20. Anonymous. 2014. Draft Report: The Informal Settlements of Namuwongo. Sustainable Urban Development Association.
21. Bwire G, Malimbo M, Maskery B, Kim YE, Mogasale V, Levin A. 2013. The burden of cholera in Uganda. PLoS Neglected Tropical Diseases 7:e2545.
22. Nakawesi JS, Wobudeya E, Ndeezi G, Mworozi EA, Tumwine JK. 2010. Prevalence and factors associated with rotavirus infection among children admitted with acute diarrhea in Uganda. BMC Pediatr 10:69.
23. Howard G, Teuton J, Luyima P, Odongo R. 2002. Water usage patterns in low-income urban communities in Uganda: implications for water supply surveillance. Int J Environ Health Res 12:63-73.
24. Tumwine J, Kekitiinwa A, Nabukeera N, Akiyoshi D, Rich S, Widmer G, Feng X, Tzipori S. 2003. Cryptosporidium parvum in children with diarrhea in Mulago Hospital, Kampala, Uganda. American Journal of Tropical Medicine and Hygiene 68:710-715. 25. Lwasa S. 2010. Adapting urban areas in Africa to climate change: the case of Kampala.
Current Opinion in Environmental Sustainability 2:166-171.
26. Anonymous. 2010. Microbiological Indicator Testing in Developing Countries: A Fact Sheet for the Field Practitioner. Prevention CfDCa,
27. Bain R, Cronk R, Wright J, Yang H, Slaymaker T, Bartram J. 2014. Fecal contamination of drinking-water in low- and middle-income countries: a systematic review and meta-analysis. PLoS Med 11:e1001644.
28. Anonymous. 1997. Water sampling and analysis, Guidelines for drinking-water quality, 2 ed. World Health Organization.
29. Anonymous. 2011. Microbial aspects, Guidelines for drinking-water quality, 4 ed. World Health Organization.
30. Lund V. 1996. Evaluation of E. coli as an indicator for the presence of Campylobacter jejuni and Yersinia enterocolitica in chlorinated and untreated oligotrophic lake water. Water Research 30:1528-1534.
31. Bonadonna L, Briancesco R, Ottaviani M, Veschetti E. 2002. Occurence of Cryptosporidium oocysts in sewage effluents and correlation with microbial, chemical and physical water variables. Environmental Monitoring and Assessment 75:241-252. 32. Harwood VJ, Levine AD, Scott TM, Chivukula V, Lukasik J, Farrah SR, Rose JB.
2005. Validity of the indicator organism paradigm for pathogen reduction in reclaimed water and public health protection. Appl Environ Microbiol 71:3163-3170.
33. Rochelle-Newall E, Nguyen TM, Le TP, Sengtaheuanghoung O, Ribolzi O. 2015. A short review of fecal indicator bacteria in tropical aquatic ecosystems: knowledge gaps and future directions. Front Microbiol 6:308.
34. Helena SM, Wolfert MA, Desmarais TR, Palmer CJ. 1999. Sources of Escherichia coli in a coastal subtropical environment. Applied and Environmental Microbiology 66:230-237.
35. Zhang C, Xu J, Ma W, Zheng W. 2006. PCR microfluidic devices for DNA amplification. Biotechnology Advances 24:243-284.
36. Byappanahalli MN, Nevers MB, Whitman RL, Ishii S. 2015. Application of a Microfluidic Quantitative Polymerase Chain Reaction Technique To Monitor Bacterial
Pathogens in Beach Water and Complex Environmental Matrices. Environmental Science & Technology Letters 2:347-351.
37. Ishii S, Nakamura T, Ozawa S, Kobayashi A, Sano D, Okabe S. 2014. Water quality monitoring and risk assessment by simultaneous multipathogen quantification. Environ Sci Technol 48:4744-4749.
38. Ishii S, Kitamura G, Segawa T, Kobayashi A, Miura T, Sano D, Okabe S. 2014. Microfluidic quantitative PCR for simultaneous quantification of multiple viruses in environmental water samples. Appl Environ Microbiol 80:7505-7511.
39. Ishii S, Segawa T, Okabe S. 2013. Simultaneous quantification of multiple food- and waterborne pathogens by use of microfluidic quantitative PCR. Applied and Environmental Microbiology 79:2891-2898.
40. Fout GS, Dahling DR, Safferman RS. 2001. USEPA Manual of Methods for Virology. Agency USEP, Washington, DC.
41. Funk C, Rowland J, Eilerts G, White L. 2012. A Climate Trend Analysis of Uganda. U.S. Department of the Interior USGS, USAID, Rolla Publishing Service Center,
42. Kigobe M, Mcintyre N, Wheater H, Chandler R. 2011. Multi-site stochastic modelling of daily rainfall in Uganda. Hydrological Sciences Journal 56:17-33.
43. Mattioli MC, Pickering AJ, Gilsdorf RJ, Davis J, Boehm AB. 2013. Hands and water as vectors of diarrheal pathogens in Bagamoyo, Tanzania. Environ Sci Technol 47:355- 363.
44. Victoria M, Guimaraes F, Fumian T, Ferreira F, Vieira C, Leite JP, Miagostovich M. 2009. Evaluation of an adsorption-elution method for detection of astrovirus and norovirus in environmental waters. J Virol Methods 156:73-76.
45. Ikner LA, Gerba CP, Bright KR. 2012. Concentration and recovery of viruses from water: a comprehensive review. Food Environ Virol 4:41-67.
46. Gonzalez-Escalona N, Hammack TS, Russell M, Jacobson AP, De Jesus AJ, Brown EW, Lampel KA. 2009. Detection of live Salmonella sp. cells in produce by a TaqMan- based quantitative reverse transcriptase real-time PCR targeting invA mRNA. Appl Environ Microbiol 75:3714-3720.
47. Jothikumar N, Cromeans TL, Hill VR, Lu X, Sobsey MD, Erdman DD. 2005. Quantitative real-time PCR assays for detection of human adenoviruses and identification of serotypes 40 and 41. Appl Environ Microbiol 71:3131-3136.
48. Monpoeho S, Dehee A, Mignotte B, Schwartzbrod L, Marechal V, J.C. N, Billaudel S, Ferre V. 2000. Quantification of Enterovirus RNA in sludge samples using single tube real-time RT-PCR. BioTechniques 29:88-93.
49. Miura T, Parnaudeau S, Grodzki M, Okabe S, Atmar RL, Le Guyader FS. 2013. Environmental detection of genogroup I, II, and IV noroviruses by using a generic real- time reverse transcription-PCR assay. Appl Environ Microbiol 79:6585-6592.
50. Costafreda MI, Bosch A, Pinto RM. 2006. Development, evaluation, and standardization of a real-time TaqMan reverse transcription-PCR assay for quantification of hepatitis A virus in clinical and shellfish samples. Appl Environ Microbiol 72:3846- 3855.
51. Kitajima M, Matsubara K, Sour S, Haramoto E, Katayama H, Ohgaki S. 2009. First detection of genotype 3 hepatitis E virus RNA in river water in Cambodia. Trans R Soc Trop Med Hyg 103:955-957.
52. Kitajima M, Oka T, Takagi H, Tohya Y, Katayama H, Takeda N, Katayama K. 2010. Development and application of a broadly reactive real-time reverse transcription- PCR assay for detection of murine noroviruses. J Virol Methods 169:269-273.
53. Tago K, Ishii S, Nishizawa T, Otsuka S, Senoo K. 2011. Phylogenetic and Functional Diversity of Denitrifying Bacteria Isolated from Various Rice Paddy and Rice-Soybean Rotation Fields. Microbes and Environments 26:30-35.
54. Liu J, Gratz J, Amour C, Kibiki G, Becker S, Janaki L, Verweij J, Taniuchi M, Sobuz SU, Haque R, Haverstick DM, Houpt ER. 2012. A Laboratory-Developed TaqMan Array Card for Simultaneous Detection of 19 Enteropathogens. Journal of Clinical Microbiology 51:472-480.
55. Pang XL, Lee B, Boroumand N, Leblanc B, Preiksaitis JK, Yu Ip CC. 2004. Increased detection of rotavirus using a real time reverse transcription-polymerase chain reation (RT-PCR) assay in stool specimens from children with diarrhea. . Journal of Medical Virology 72:496-501.
56. Mouritzen P, Noerholm M, Nielsen P, Jacobsen N, Lomholt C, Pfundheller H, Tolstrup N. 2005. Probe Library: A new method for faster design and execution of quantitative real-time PCR. Nature Methods 2:313-316.
57. Romero-Maraccini OC, Sadik NJ, Rosado-Lausell SL, Pugh CR, Niu XZ, Croue JP, Nguyen TH. 2013. Sunlight-induced inactivation of human Wa and porcine OSU rotaviruses in the presence of exogenous photosensitizers. Environ Sci Technol 47:11004-11012.
58. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL, Vandesompele J, Wittwer CT. 2009. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem 55:611-622.
59. Sinigalliano CD, Ervin JS, Van De Werfhorst LC, Badgley BD, Balleste E, Bartkowiak J, Boehm AB, Byappanahalli M, Goodwin KD, Gourmelon M, Griffith J, Holden PA, Jay J, Layton B, Lee C, Lee J, Meijer WG, Noble R, Raith M, Ryu H, Sadowsky MJ, Schriewer A, Wang D, Wanless D, Whitman R, Wuertz S, Santo Domingo JW. 2013. Multi-laboratory evaluations of the performance of Catellicoccus marimammalium PCR assays developed to target gull fecal sources. Water Res 47:6883- 6896.
60. Fleige S, Pfaffl MW. 2006. RNA integrity and the effect on the real-time qRT-PCR performance. Mol Aspects Med 27:126-139.
61. Fagan PK, Hornitzky MA, Bettelheim KA, Djordjevic SP. 1999. Detection of Shiga- Like Toxin (stx1 and stx2), Intimin (eaeA), and Enterohemmorrhagic Escherichia coli (EHEC) Hemolysin (EHEC hyla) Genes in Animal Feces by Multiplex PCR. Applied and Environmental Microbiology 65:868-872.
62. Colwell RR. 1996. Global Climate and Infectious Disease: The Cholera Paradigm. Science 274:2025-2031.
63. Halage AA, Ssemugabo C, Ssemwanga DK, Musoke D, Mugambe RK, Guwatudde D, Ssempebwa JC. 2015. Bacteriological and physical quality of locally packaged drinking water in Kampala, Uganda. J Environ Public Health 2015:942928.
64. Jovanelly TJ, Johnson-Pynn J, Okot-Okumu J, Nyenje R, Namaganda E. 2015. Pioneering water quality data on the Lake Victoria watershed: effects on human health. J Water Health 13:920-930.
65. Etchie AT, Etchie TO, Adewuyi GO, Krishnamurthi K, Saravanadevi S, Wate SR. 2013. Prioritizing hazardous pollutants in two Nigerian water supply schemes: a risk- based approach. Bull World Health Organ 91:553-561J.
66. Parker AH, Youlten R, Dillon M, Nussbaumer T, Carter RC, Tyrrel SF, Webster J. 2010. An assessment of microbiological water quality of six water source categories in north-east Uganda. J Water Health 8:550-560.
67. Muyodi FJ, Hecky RE, Kitamirike JM, Odong R. 2009. Trends in health risks from water-related diseases and cyanotoxins in Ugandan portion of Lake Victoria basin. Lakes & Reservoirs: Research and Management 14:247-257.
68. Kaddumukasa M, D. N, Muyodi FJ. 2012. Occurence of culturable Vibrio cholerae from Lake Victoria, and Rift Valley Lakes Albert and George, Uganda. Lakes & Reservoirs: Research and Management 17:291-299.
69. Howard G, Godfrey S, Tibatemwa S, Niwagaba C. 2005. Water safety plans for piped urban supplies in developing countries: a case study from Kampala, Uganda. Urban Water Journal 2:161-170.
!
APPENDIX A: SUPPLEMENTAL DATA
Table 3. Primer and probe sequences for qPCR and MFQPCR assays.
Target Microorganism Sequence (5'-3') Ref.
Adenovirus 40/41b,d FP GGACGCCTCGGAGTACCTGAG (47)
RP ACIGTGGGGTTTCTGAACTTGTT
Flu. Pr. FAM-CTGGTGCAG/ZEN/TTCGCCCGTGCCA-IBFQ
Enterovirusa,d FP CCCCTGAATGCGGCTAATC (48)
RP GATTGTCACCATAAGCAGC
Flu. Pr. FAM-CGGAACCGA/ZEN/CTACTTTGGGTGTCCGT-IBFQ
Human norovirus GIb,d FP ATGTTCCGCTGGATGCG (49)
RP CCTTAGACGCCATCATCATTTAC
Flu. Pr. FAM-TGTGGACAG/ZEN/GAGAYCGCRATCT-IBFQ
Human norovirus GIIa,d FP ATGTTCAGRTGGATGAGRTTCTC (49)
RP TCGACGCCATCTTCATTCACA
Flu. Pr. FAM-AGCACGTGG/ZEN/GAGGGCGATCG-IBFQ
Hepatitis A virusa,f FP TCACCGCCGTTTGCCTAG (50)
RP GGAGAGCCCTGGAAGAAAG
Flu. Pr. FAM-CCTGAACCTGCAGGAATTAA-NFQ-MGB
Hepatitis E virusb,d FP CGGCGGTGGTTTCTGGRGTG (51)
RP GGGCGCTKGGMYTGRTCNCGCCAAGNGGA
!
Table 3 (cont). Primer and probe sequences for qPCR and MFQPCR assays.
Target Microorganism Sequence (5'-3') Ref.
Rotavirus Aa,d FP ACCATCTACACATGACCCTC (55)
RP GGTCACATAACGCCCC
Flu. Pr. FAM-ATGAGCACA/ZEN/ATAGTTAAAAGCTAACACTGTCAA-IBFQ
General E. coli - ftsZa,e
FP CTGGTGACCAATAAGCAGGTT (39)
RP CATCCCATGCTGCTGGTAG
Flu. Pr. UPL #71
EHEC - eaeAa,e FP GGCGAATACTGGCGAGACTA (39)
RP GGCGCTCATCATAGTCTTTCTT
Flu. Pr. UPL #28
EHEC - stx1a,e FP TGTAATGACTGCTGAAGATGTTGAT (39)
RP TCCATGATARTCAGGCAGGA
Flu. Pr. UPL #60
EHEC - stx2a,e FP TCTGGCGTTAATGGAGTTYAG (39)
RP GTGACAGTGACAAAACGCAGA
Flu. Pr. UPL #126
Shigella spp. - ipaH 7.8a,e FP TCTGAGAATCCTGACTGAATGG (39)
RP AAGCAATGCCTCGCTCTTC
Flu. Pr. UPL #7
!
Table 3 (cont). Primer and probe sequences for qPCR and MFQPCR assays.
Target Microorganism Sequence (5'-3') Ref.
Shigella spp. - ipaH alla,e FP AAGGCCTTTTCGATAATGATACC (39)
RP ATTTCGAGGCGGAACATTT
Flu. Pr. UPL #108
Shigella spp. - virAa,e FP GGCAATCTCTTCACATCACG (39)
RP TTCGGACATAATTTGGGCATA
Flu. Pr. UPL #6
Salmonella spp. - invAa,d FP GCATCAATAATACCGGCCTTC (46)
RP ATGGTATGCCCGGTAAACAG
Flu. Pr. FAM-CTCTTTCGT/ZEN/CTGGCATTATCGATCAGTACCA-IBFQ
Salmonella spp. - ttrCa,e FP GCCTTACAGGCGTTCTTCG (39)
RP ATTTTTGGCAGCCTTACCG
Flu. Pr. UPL #149
Camplyobacter jejuni - ciaBa,e FP GCGTTTTGTGAAAAAGATGAAGATAG (39)
RP GGTGATTTTACTTTCATCCAAGC
Flu. Pr. UPL #137
Legionella pneumophila - mipa,e FP GGATAAGTTGTCTTATAGCATTGGTG (39)
RP CCGGATTAACATCTATGCCTTG
!
Table 3 (cont). Primer and probe sequences for qPCR and MFQPCR assays.
Target Microorganism Sequence (5’-3’) Ref.
Pseudogulbenkiania sp. NH8Bb,e FP CAGGCCGTGAAGTCAAGC (39, 53)
RP GAGGCGATGTGGATGGTC
Flu. Pr. UPL #56
Vibrio Cholerae - ctxAa,d FP TTTGTTAGGCACGATGATGGAT (39)
RP ACCAGACAATATAGTTTGACCCACTAAG
Flu. Pr. FAM-TGTTTCCAC/ZEN/CTCAATTAGTTTGAGAAGTGCCC-IBFQ
Cryptosporidiumb,f FP GGGTTGTATTTATTAGATAAAGAACCA (54)
RP AGGCCAATACCCTACCGTCT
!
Table 4. MFQPCR specifications for standards used in final quantification.
Assay LLQ ULQ Slope r2 Efficiency Plate
Enterovirus 3 3 x 106 -3.45 0.96 95 0.45 E. coli ftsZ 3 3 x 106 -3.32 0.98 100 0.45 EHEC eaeA 30 3 x 106 -3.61 0.99 89 1.6 EHEC stx1 3 3 x 106 -3.36 0.99 99 1.6 EHEC stx1 3 3 x 106 -3.25 0.94 103 0.45 EHEC stx2 3 3 x 106 -3.42 0.96 96 1.6 Shigella spp. ipaH 7.8 3 3 x 106 -3.44 0.96 95 1.6
Shigella spp. ipaH all 3 3 x 106 -3.21 0.97 104 1.6 Salmonella spp. invA 3 3 x 106 -3.35 0.95 99 0.45
Salmonella spp. ttrC 3 3 x 106 -3.252 0.98 103 1.6 Salmonella spp. ttrC 3 3 x 106 -3.16 0.94 107 0.45 Vibrio cholerae ctxA 3 3 x 106 -3.37 0.94 98 0.45