The cultures of Achromobacter were made by directly plating stock culture on LB agar and incubating at 37°C overnight. Plates were labelled with the code of isolates as described in section 2.3.
3.2.1. Biochemical property-based identification (Conventional method)
In collaboration with Ramathibodi Hospital in Bangkok, Thailand, all of the Thai clinical isolates were identified using traditional microbiological procedure at Ramathibodi Hospital, by courtesy of Dr Pitak Santaniand. For clinical isolates from Liverpool, all of them were previously identified using API20 NE kit prior to this study. To standardise the identification of the isolates, all British isolates was subjected to conventional identification.
Figure 3.1: The identification algorithm for A. xylosoxidans (adapted from
Manual of Clinical Microbiology(Murray et al., 2007)
The identification of A. xylosoxidans was carried out as shown in Figure 3.1 with further biochemical analysis described in Table 3.1. All isolates were cultured on
MacConkey agar Pink colony ? Yes No Oxidase Negative Positive Indole Negative Positive Glucose fermentation Negative Positive Motility Yes No Follow Table 3.1 Not A. xylosoxidans Not A. xylosoxidans Not A. xylosoxidans Not A. xylosoxidans Not A. xylosoxidans
MacConkey agar to investigate whether they were Gram-negative bacteria as well as to determine if they were lactose fermenters. According to Yabuuchi (Yabuuchi & Oyama, 1971; Yabuuchi & Yano, 1981; Yabuuchi et al., 1998), A. xylosoxidans is a Gram-negative, motile, oxidase-positive, indole-negative, non lactose fermenting, glucose-fermenting, rod-shape bacterium with peritrichous flagellation.
Table 3.1: A summary of expected phenotypes of A. xylosoxidans based on biochemical properties. This table is a summary of table in Manual of Clinical Microbiology (Murray et al., 2007).
Biochemical reaction A. xylosoxidans
(percent positive) Indole production* 0 Motility* 100 Sugar fermentation Lactose 0 Sucrose 0 Glucose 78 Xylose 99 Mannitol 0 Maltose 0 10% Glucose 100 Simmons‟ Citrate 95 Christensen's Urea 0 Nitrate reduction 100
Gas production from Nitrate 60
Nitrite reduction+ 0
Triple Sugar Iron (TSI) medium
TSI slant, acid 0
TSI buttom, acid 0
TSI buttom, H2S 0
Protein / Amino acid utilization
Gelatin hydrolysis 0
Aesculin hydrolysis 0
Lysine decarboxylation 0
Ornithine decarboxylation* 0
* Using Motility-Indole-Ornithine medium +
Nitrite reduction is performed in Nitrate reduction-negative and Gas production from Nitrate-negative isolates only
3.2.2. 16S rDNA sequencing
The diversity of the 16S rDNA gene was determined by species-specific PCR amplification 16S rDNA, using the primers shown in Table 3.2.
Table 3.2: 16S rDNA – based PCR primers used in this project (Liu et al., 2002). AX-F1 and AX-B1 are specific to Achromobacter, whereas UFPL and URPL are universal primers for Kingdom Bacteria
Primer Sequence (5‟ 3‟) Product size
(bp) AX-F1 GCAGGAAAGAAACGTCGCGGGT 163 AX-B1 ATTTCACATCTTTCTTTCCG UFPL AGTTTGATCCTGGCTCAG 1,490 URPL GGTTACCTTGTTACGACTT
The PCR amplification was conducted in a total volume of 25 μL, containing 50 ng of genomic DNA template, 2.5 pmoles of primers, 1.25 mmol of MgCl2, and 12.5 μL of 2X Biomix Red (Bioline, U.K.). Amplification was performed using a Veriti thermal cycler (Life Technology, USA) with the following conditions: 94°C for 1 min, followed by 35 cycles of 94°C for 1 min, 56°C for 45 s and 72°C for 1 min. Then, the mixture was heated to 72°C for 10 min in the final extension step. PCR products were visualised using 1% (w/v) agarose gel electrophoresis in TAE buffer (recipe described in section 2.1.1) at 100V for 45 min.
Amplicons generated using the UFPL and URPL primers were isolated using the ISOLATE PCR & Gel kit (Bioline, U.K.) and quantified by Qubit (Invitrogen, U.K.). Finally, the sequencing of PCR products was executed using Sanger sequencing (GATC Biotech, Germany). After obtaining the partial sequence of the 16S rDNA gene, the chromatograms of the sequence were manually verified via Geneious version 6.1.7 (Biomatters Ltd, New Zealand). After editing the sequences, nucleotide sequence alignments were processed using the MUSCLE
algorithm in the Geneious version 6.1.7 (Biomatters Ltd, New Zealand). A phylogenetic tree was then constructed by maximum likelihood method using PhyML (Guindon, 2010) with 1,000 bootstrap replications. The tree was visualised using Figtree version 1.4.2 (http://tree.bio.ed.ac.uk/software/figtree). The partial sequences of 16S rDNA gene were used to search the database using BLAST (http://blast.ncbi.nlm.nih.gov). The option „16S ribosomal RNA sequences (Bacteria and Archeae)‟ and „megablast‟ were selected for alignment database and for programme selection, respectively.
3.2.3. Matrix- assisted Laser Desorption / Ionisation – Time – of –Flight Mass spectrophotometry (MALDI-TOF MS)
A protein-based method to identify bacterial species was applied using MALDI- TOF mass spectrometry on a MALDI-TOF Biotyper (Broker Daltonic, Germany). A single colony was suspended in 200 μL of molecular grade water. Then 900 μL of absolute ethanol was added into the mixture and the mixture was centrifuged at 13,000 x g for 2 min. After supernatant removal, the mixture was centrifuged at 13,000 x g for 2 min. The residual ethanol was removed from the tube and the sample was set to air-dry. The pellet was mixed with 40 μL of 70% (v/v) formic acid. After leaving at room temperature for 2 minutes, 40 μL of absolute acetonitrile was added to the mixture, and then the mixture was centrifuged at 13,000 x g for 2 min. One microlitre of the supernatant was transferred to a steel plate and the sample was allowed to air-dry. Finally, 1 μL of α-Cyano-4-hydroxycinnamic acid matrix was overlaid on the air-dried sample, and the steel plate was inserted into the MALDI-TOF to analyse the sample. The analysis was conducted using built-in Biotyper software by comparing obtained spectra with a reference database provived. Species identification was achieved using an identification score ≥ 2.00.
3.2.4. Random amplification of polymorphic DNA (RAPD) PCR
Bacterial DNA was prepared by as previously described in section 2.6.1.1. and the concentration of DNA was adjusted to 40 ng/μL.
In this study, primer 270 (Mahenthiralingam et al., 1996; Kaur et al., 2009) was used to reveal discriminatory variation between isolates. Primer 270 is a 10-mer long DNA sequence: TGCGCGCGGG. To perform RAPD – PCR, the mixture was prepared in total volume of 25 μL, containing 40 ng of gDNA template, 7.5 pmol of primer 270 (Eurofin MWG), 1.25 μmol of MgCl2 (Promega, USA), 0.5 μL of mixed dNTP (Promega, USA), 0.25 μL of GoTaq® DNA Polymerase (Promega, USA) and 2.5 μL of 10X Green GoTaq® flexi buffer (Promega, USA). PCR amplification was performed using Mastercycler® Thermal cycler (Eppendorf) using the following protocol, which was obtained from Kaur et al.
(2009): 94°C for 15 minutes, then 4 cycles of 94°C for 5 minutes, 36°C for 5 minutes and 72°C for 5 minutes, followed by 30 cycles of 94°C for 1 minute, 36°C for 1 minute and 72°C for 1 minute, and 72°C for 10 minutes for the last step. The products were analysed using 1.5% (w/v) agarose gel electrophoresis in 0.5X TBE buffer using 95 Volts for 2 hours. Hyperladder I (Bioline) molecular weight marker was included on the gel. Finally, the DNA fingerprint from RAPD was analysed using Gelcompare II software (Applied Maths, Belgium).
3.2.5. Multi-locus sequence type (MLST)
Sequence typing of A. xylosoxidans was performed based on the standard seven housekeeping genes; eno, gltB, lepA, nrdA, nuoL, nusA, and rpoB (Spilker, Vandamme & LiPuma, 2012). The gene sequences of isolates were obtained from whole genome sequencing information (Chapter 4) and the gene sequences of other Achromobacter were obtained from the Achromobacter MLST database (http://pubmlst.org/achromobacter). After concatenating gene sequences, multiple sequence alignment was performed using Geneious version 6.1.7 (Biomatters Ltd, New Zealand) with MUSCLE and a maximum-likelihood phylogenetic tree was built on the alignment with 1,000 bootstrap replications. The analysis for population structure of Achromobacter isolates in this study was performed using eBURST algorithm (Feil et al., 2004) implemented in goeBURST version1.2.1 (Francisco et al., 2009).