• No se han encontrado resultados

INVESTIGACIONES RELACIONADAS CON DISGRAFÍA

4. Trastornos del esquema corporal y de las funciones perceptivo motrices.

2.1.6 INVESTIGACIONES RELACIONADAS CON DISGRAFÍA

The recloned plasmid was analysed using many different molecular biological methods to show that a promoter converted provirus had been isolated and that the conversion had taken place correctly.

3.1.8.1 Southern Blot Analysis

also digested with the same enzyme in parallel. TheKpnI recognition site is present in the R region of both LTRs. After digestion withKpnI two fragments of 7.7 kb and approximately 3 kb could be seen in the recloned plasmid (Fig. 3.13, lane 1). In pMMTV-BAGgal bands of 7.7 kb und 0.7 kb (Fig. 3.13, lane 2) were expected. In the recloned plasmid both the 7.7 kb as well as the 3 kb fragment should contain the U3 region of MMTV if promoter conversion has taken place. In the plasmid pMMTV-BAGgal the U3 region of MMTV is only present in the 3’LTR and should only be detected in the 7.7 kb fragment. The gel was blotted and hybridised to an MMTV U3 specific probe. As expected both the 7.7 kb and the 3 kb band from the recloned plasmid hybridised to the probe giving a signal (lane 1), and only the 7.7 kb product in pMMTV-BAGgal gives a hybridisation signal.

Figure 3.13: Southern Blot

a)1 µg of plasmid DNA was digested with the restriction enzymeKpnI. This enzyme was chosen as it could be used to show the presence of the U3 of MMTV in the 5' LTR after hybridisation.

b) TheKpnI digest shows a 7.7 kb fragment and an approximately 3 kb fragment in the recloned plasmid. Here it was expected that the U3 of MMTV would be present in both fragments after reverse transcription. The 3 kb fragment represents the remaining parts of the 5' and 3' LTRs as well as genomic DNA from the integration site. pMMTV-BAGgal gave fragments of 7.7 kb and 0.7 kb as expected. A molecular weight marker (1 kb Ladder, Life Technologies) is present in the lane marked M. The recloned plasmid is in lane 1 and pMMTV-BAGgal in lane 2. Some unspecific bands can also be seen. This is due to the star activity ofKpnI, resulting in bands of unspecific sizes.

c) After transfer to a nylon membrane, the DNA was hybridised to a radioactively labelled probe. In lane 1 the recloned, promoter converted plasmid shows two hybridised bands corresponding to the 7.7 and 3 kb fragments from theKpnI digest. In lane 2, pMMTV-BAGgal shows only the 7.7 kb hybridised band as expected.

3.1.8.2 PCR Analysis of the Recloned Vector

PCR was used to further characterise the recloned plasmid. The primers used can be see in figure 3.14, one binding at the beginning of the MMTV U3 region in the 5’ LTR and the other binding in the packaging signal. If the MMTV U3 region has been duplicated and translocated from the 3’ LTR to the 5’ LTR a 1.2 kb band would be expected in the PCR reaction. As expected the 1.2 kb PCR product can be seen in lane 1 from the recloned plasmid and a 1.9 kb product in lane 3 arising from the plasmid control pMMTV-BAGgal as the U3 of MMTV is only present in the 3’LTR. A product of 4.2 kb could also be obtained in pMMTVProCon as the MMTV U3 specific primer could also bind in the 3’ LTR. However, in any PCR reaction, the shorter fragments are preferentially amplified. Hence, the 4.2 kb fragment is not amplified. Genomic DNA from Rat-2 cells that had been previously infected with the hybrid MMTV- BAGgal was used as a positive control and can be seen in lane 2. The resulting gel was then blotted to a nylon membrane (see 2.2.7.1.) and hybridised (see 2.2.7) to a 0.9 kb radioactively labelled (see 2.2.6.1) probe isolated from the U3 region of MMTV in order to check the specificity of the bands present. After hybridisation a strong band could be seen at the expected size. This shows the presence of the MMTV U3 region in the 5’LTR of the recloned plasmid.

Figure 3.14: PCR Analysis of the Recloned Vector

1 ng of plasmid DNA was amplified by PCR using 40 pmol of each primer, one being specific for the MMTV U3 region and the other primer specific for the MLV packaging region. The PCR was perfomed under the following reactionconditions: denaturating for 1 min at 94°C, annealing for 2 mins at 55°C (P1-P2), and elongation for 3 mins at 68°C. 35 cycles were made. The primer pair P1-P2 gave a 1.2 kb PCR product (Lane 1) from the recloned plasmid (pMMTVProCon) and from infected Rat-2 cells (Lane 2) whereas a 1.9 kb PCR product (Lane 3) arose from pMMTV-BAGgal. 10 µl of the PCR product was separated on a 0.8% agarose gel and transferred to a nylon membrane. The membrane was then hybridised against a α32P-labelled 0.9 kb MMTV U3 specificPstI fragment from the plasmid p0.9pstI.

3.1.8.3 Sequencing of the Recloned Plasmid

Sequencing was used to show that the promoter conversion had taken place correctly at the level of DNA sequence and also to determine the sequence at the integration site. After promoter conversion it would be expected that the U3 of MMTV should be present in both LTRs. The recloned plasmid was digested with KpnI, which recognises sites present in both LTRs, to separate the 5’and 3’LTRs and thus facilitate analysis of both LTRs separately. Two fragments were observed, a 7.7 kb fragment and a 3 kb fragment (Fig. 3.13). The 7.7 kb fragment containing the U3 region of MMTV present in the 3’ LTR and a part of the R region and the 3 kb fragment containing the MMTV U3 region present in the 5’ LTR and part of the R region. The 3kb fragment was used for sequencing as it contains the promoter converted LTR.

Two primers were chosen for the sequencing reactions (see 2.2.5.1.3), one of which was complementary to the U3 region of MMTV (S1) and the other of which was complementary to the R region of MLV (S2). Sequencing of the junction between the rat flanking sequence and at the 5’ end of the provirus revealed that the SacII restriction site and MMTV U3 sequences inserted into this site were intact, as expected. The MLV IR was also present, but it had been shortened 2 bp, as expected due to processing during the integration event (Goffet. al, 1992). Similarly, the sequence at the border between the MMTV U3 and MLV R regions in the 5’LTR revealed that the MMTV U3,MluI restriction site, and MLV R sequence were also intact (Fig. 3.15). Sequencing into the flanking regions, where the provirus had integrated, was also performed. Alignment of the obtained data with online databases (BLAST) showed no significant homology with known sequences.

MMTV U3 MMTV U3 TTTTTTGAGTAAACTTACGCGTGCGCCAGTCCTCCGATTGA cacgtacagagtttgaggtTGAAAGACCCCGCGGAAAAAGGG MluI SacII IR MMTV U3 MMTV U3 +1 R

Figure 3.15: Sequencing of the Junction Regions of a Recloned Provirus.

5µg of plasmid DNA was digested with the restriction enzymeKpnI. A 3 kb fragment, which contains the MMTV U3 region present in the 5' LTR, was taken and extracted for sequencing.

Sequencing was carried out with an automatic sequencer (ABI 373a; Applied Biosystems). The reactions were performed with a dye terminator cycle sequencing kit (Applied Biosystems, see 2.2.5.1.3) according to the manufacturer’s instructions. PCR mixtures contained 1 µg of plasmid DNA and 4 pmol of primer, one of which was complementary to the U3 region of MMTV (S1, 5'-CCTTGGCTGCTTCTC-3') and the other of which was complementary to the R region of MLV (S2, 5'-CCACAAGTCGGATGCAACTG-3'). Shown are the sequences at the U3-R junction of the 5' LTR and the integration site-U3 junction of the 5' LTR. The sequence analysis reveals that (i) the borders between the MMTV U3 and MLV R regions are intact after promoter conversion and (ii) the IR has been used for integration. The SacII restriction enzyme cleavage site and theMluI site used to introduce the MMTV U3 region are marked. +1 indicates the position of the classic CAP site.

Documento similar