Capítulo III. Propuesta de política pública
3.4. Análisis cuantitativo
3.4.2 IVPE en el estado de Puebla
The results of this investigation are described in four chapters. In chapter 3 , 1 introduce
the method of positional cloning and then present the results of such an analysis for bal,
for which I have identified the laminin a l chain as a candidate. In chapter 4, I
characterize the zebrafish lamal gene, including identification o f the mutation
responsible for the bal phenotype. Chapter 5 contains the results from the positional
cloning of the related notochord mutant, gup, along with some characterization of the
gene Iambi (encoding laminin (31). I also present the analysis of other laminin a chains
(lama2, lama4 and lama5) and make conclusions concerning roles for particular laminin
isoforms during zebrafish development. In chapter 6, 1 provide evidence suggesting that
some members of the integrin family and a downstream component, integrin-linked kinase (ILK) are not involved in differentiation of the notochord per se, but instead function control cell movements during gastrulation. Finally, the general discussion provides some speculations and future directions that this work might take.
C h a p t e r 2 M aterials a n d m e t h o d s
C h a p t e r 2 M a teria ls a n d m e t h o d s
Chapter 2
Materials and methods
2.1 Embryo collection... 54 2.2 Embryo labelling and microsurgery... 55 2.3 Culture of embryonic shields...56 2.4 General molecular biology techniques... 56 2.5 Preparation o f genomic DNA from Adult Fish... 59 2.6 Preparation o f genomic DNA from embryos...59 2.7 Oligonucleotide labeling...60 2.8 Polymerase Chain Reaction (PCR)... 60 2.9 RFLP analysis of genomic DNA from embryos... 61 2.10 Polyacrylamide Gel Electrophoresis... 61 2.11 YAC libraries... 62 2.12 PAG and BAC libraries...63 2.13 Radiation hybrid panels... 64 2.14 RT-PCR... 64 2.15 Rapid amplification of cDNA ends... 65 2.16 Whole-mount in situ hybridization... 66# 2.17 Whole-mount immunocytochemistry... 67 2.18 Morpholino inj ection...67 2.19 Electron microscopy...67 2.20 Photomicrography... 68
2.1 Embryo collection
Zebrafish (Danio rerio) embryos were raised at 28°C in embryo water (red sea salt 0.03
g/1, methylene blue 2 mg/1) or in 0.3X Danieau solution, IX Danieau solution is 58 mM
NaCl, 0.7 mM KCl, 0.4 mM MgS0 4, 0.6 mM Ca(N0 3)2, 5 mM HEPES, pH 7.6).
Approximate stages are given in hours-post-fertilisation (hpf) at 28°C according to the morphological criteria provided in (Kimmel et al., 1995).
C h a p t e r 2 M a teria ls a n d m e t h o d s
2.2 Embryo labelling and microsurgery
For shield transplantation experiments, chorions of donor embryos were removed by 4 minutes incubation in 0.5 mg/ml pronase (Sigma) in 0.3X Danieau solution followed by several washes in 0.3X Danieau solution. Donor embryos were then transferred into ramps made of 2% agarose in 0.3X Danieau solution covered with 0.3X Danieau solution. Donor embryos were labelled at the 1-4 cell stage by micro-injection into the yolk cell with rhodamine dextran (Molecular Probes) in 0.2 M KCl.
Transplantation pipettes were pulled from 1 mm borosilicate glass capillaries (World Precision Instruments, IB 100-4) and cut with a diamond pencil to an inner diameter of approximately 200 pm. A sharp inner edge is optimal and the plane of the cut was orthogonal to the long axis of the pipette. The pipettes were initially filled with medium and then loaded into a pipette holder filled with mineral oil. The pipette holder (World Precision Instruments, 5430-10), carried by a 3-axis micro-manipulator (Narishige, MN-153), was connected, via a continuous column o f mineral oil, to a 50 pi Hamilton syringe driven by a micrometer controlled syringe pump (Stoelting, 51218).
Microsurgery was performed at 1 9 -2 rc in IX Danieau solution containing 5%
penicillin/streptomycin (Gibco-BRL, 15140-114). The chorion of host embryos was removed with watchmaker’s forceps shortly before transplantation. Donor and host embryos were loaded into transplantation wells that had been pre-formed with an acrylic mould in 2% agarose/IX Danieau solution. Transplantation wells were 1.0 mm deep by 1.0 mm wide, with the bottom surface of the well sloping from the back wall of the well approximately 1.3 mm to the surface of the agarose.
To remove shield tissue, donor embryos were oriented such that the shield faced the pipette tip and the transplantation pipette was placed over the shield. Shield tissue was gently drawn in and out of the pipette generally 3 or 4 times until the yolk cell and shield tissue became separated. To transplant the shield tissue, hosts were oriented so that the site of transplantation was 180° from the host shield. With the donor shield in the pipette, the tip of the pipette was placed onto the host embryo, at the margin, and a
C h a p t e r 2 M a teria ls a n d m e t h o d s
host inflated a little, making spaee for the donor tissue. For aeceptable transplants, the donor shield tissue became trapped under the EVL either directly beneath or immediately adjacent to the hole. Transplanted embryos were left in the transplantation well for about 10 minutes to recover then transferred to 0.3X Danieau with 5% penicillin/streptomycin on 2% agarose/ 0.3X Danieau for overnight culture.
2.3 Culture of embryonic shields
The embryonic shield was cultured in complete medium (CM) comprising L I5 medium + 10% fetal calf serum (Gibco) and ImM HEPES pH 7.0 + 1% pennicillin streptomycin solution (Gibco). Shields were cultured on the Permanox Chamber Slide System® (Lab- Tek). Each well was pre-treated as follows. 200pl o f a 0.1 mg/ml solution of poly-D- lysine (Sigma) was placed in each well and immediately removed. The wells were then air-dried for 2hours and washed twice with ddH20. Finally, 200pl of 250pg/ml fibronectin solution (Biomedical technologies) was added to each well for 2mins and then removed, and replaced with CM.
The same procedure as described in 2.2 was used to remove the morphological shield with the exception that all embryos were dechorionated manually with watchmakers forceps. Typically, 5 shields were removed at a time, and then transferred using a P20 pipette in minimal volume of IxDanieau, to a pre-treated well and allowed to settle and attach for 30mins, before adding 250pl of CM to just cover the shields. The chamber slide was then incubated overnight in a humidified incubator at 28°C. The following morning each well was flooded with 300pl CM.
2.4 General molecular biology techniques
2.4.1 Small scale preparation of DNA
The Qiagen Spin miniprep kit was used for all small scale plasmid preparations (Qiagen). From a 5ml overnight culture of bacteria in selective LB medium, 1.5 ml was transferred to a 1.5 ml microcentrifuge tube and spun for 20 seconds. The supernatant was removed completely and the pellet resuspended in 250 pi of Resuspension Buffer
C h a p t e r 2 M a teria ls a n d m e t h o d s
room temperature to allow alkaline lysis of the cells. Lysis solution was then
neutralised by adding 350 pi of ice-cold Neutralisation Buffer (Qiagen; 3M KOAc pH 5.5) and mixed carefully by inverting the tube a few times, followed by 10 minutes incubation on ice. The tube was spun for 15 minutes at room temperature and the supernatant was transferred into a fresh microcentrifuge tube and washed with 750pl of
100% EtOH. DNA was then eluted from the membrane using 50pl of sterile water. DNA and RNA were quantified by spectrophotometry at 260 nm (an OD of 1 equates to 50 pg/ml double stranded DNA, 35 pg/ml single stranded DNA and 40 pg/ml RNA). The ratio between the readings at 260 nm and 280 nm provided an estimate of the purity of the nucleic acid preparation (pure preparations o f DNA and RNA should have
OD260/OD280 values of 1.8 and 2.0, respectively).
2.4.2 Gel extraction of DNA
For the extraction of DNA from agarose gels, the QIAquick Gel Extraction Kit (Qiagen) was used according to manufacturers protocol. Samples were eluted in 30pl of water and 4pl of this was used for TOPO cloning or standard ligation reactions.
2.4.3 Phenol/Chloroform extraction
To remove proteins from nucleic acid solutions, a mixture of
phenol:chloroform:isoamyl-alcohol (25:24:1 volume ration) was added in a 1:1 volume ratio to the DNA solution and vortexed for 1 minute. After a 5 minutes centrifugation, the upper (aqueous) layer was transferred into a new microcentrifuge tube and extracted with an equal volume of chloroform.
2.4.4 Ethanol Precipitation
Ethanol precipitation was carried out by adding 3 M NaOAc pH 5.5 (to a final concentration of 0.3 M) and 2.5 volumes o f 100% ethanol to the DNA solution that was then left on dry ice for approximately 20 minutes. 1 pi of 10 mg/ml glycogen was often used as a carrier to visualise the pellet at the bottom of the tube. Centrifugation at 20
C h a p t e r 2 M a teria ls a n d m e t h o d s
2.4.5 TOPO cloning
The cloning of PCR products was performed using the TOPO TA Cloning®kit (Invitrogen). The cloning reaction was performed according to the following conditions: 4 pi fresh PCR product or 4pl of gel purified product, Ipl of 1.2M NaCl solution and 0.5 pi pCR®-TOPO® vector. These were mixed gently and incubated for 5 minutes at room temperature.
2.4.6 Transformation of chemically competent bacteria
Transformation of the ligated vector was performed using chemically competent TOPIC cells (Invitrogen). Briefly, 2pi of TOPO ligation mix was added to 25pi cells and incubated on ice for 30mins. Cells were then heat shocked for 30s at 42°C, then immediately transferred to ice, incubated for 2mins before adding 250pl SOC added. Cells were then incubated at 37°C for Ihr and an aliquot of 10 to 200 pi from each transformation was spread onto a selective agar plate (100 mg/ml o f ampicillin) and incubated overnight at 37°C. 40 pi of X-Gal (20 mg/ml in dimethylformimide) and 40 pi of IPTG (200 mg/ml) were used per plate for selection.
2.4.7 Transformation of electrocompetent cells
Up to 100 ng of DNA was added to 20 pi of TOPIC elctrocompetent cells (Invitrogen) cells that had been thawed on ice, then immediately transferred to a pre-cooled 0.1 cm electroporation chamber. Cells were electroshocked under 1.8 kV, 25 pF and 200 Q. 1 ml of SOC medium was immediately added, the mixture was transferred to a plastic tube and incubated with shaking at 37 °C for 1 hour. Cells were plated as described for chemical transformation.
2.4.8 Restriction digestions
Restriction enzyme digests were performed at the recommended temperature for approximately 2hrs using commercially supplied restriction enzymes and buffers (Boehringer Mannheim, Promega, New England Biolabs). The enzyme component of the reaction never comprised more than 10% of the reaction volume. For enzyme
C h a p t e r 2 M a teria ls a n d m e t h o d s
digests using more than one restriction enzyme, the buffer suggested by the manufacturer was used.
2.4.9 DNA Sequencing
DNA sequencing was performed using the ABI PRISM Big Dye Terminator Cycle Sequencing Ready Reaction kit, according to the manufacturers instructions, in an ABI 377 automatic sequencer.
2.4.10 Bioinformatics
All PCR primers were designed using the program primerB (http://www- genome.wi.mit.edu/cgi-bin/primer/primer3 www.cgi). The RZPD site was used extensively to obtained cDNA clones, identified through EST searches of GenBank. All manipulations of DNA sequence was performed with Sequencher and DNAstar software, with BLAST site from NCBI used for sequence analysis. Clustal was used for sequence alignments. The Sanger centre zebrafish genome project was used for
identification of genomic fragments containing exons of interest
(http://www.sanger.ac.Uk/Proiects/D rerio/V
2.5 Preparation of genomic DNA from Adult Fish
Whole tail fin from adult fish was dissected and placed in 0.5ml of extraction buffer (0.5% SDS, 0.1 M EDTA pH.8.0, lOmM Tris pH.8, 100 pg/ml Proteinase K) for 5 hours at 55°C. Phenol chloroform extraction and ethanol prepcipitation were carried out, and the final pellet was resuspended in 30pl TE. A 1:100 dilution of this was used PCR template.
2.6 Preparation of genomic DNA from embryos
The digestion of each single embryo was done by incubating in 100 pi of extraction buffer (0.5% SDS, 0.1 M EDTA pH.8.0, lOmM Tris pH.8, 100 pg/ml Proteinase K) for 5 hours at 55°C. The DNA was purified using Multiscreen-GV, sterile column plates
C h a p t e r 2 M a teria ls a n d m e t h o d s
2.7 Oligonucleotide labeling
When testing for SSLP markers we always labelled both oligonucleotides. For 30 reactions, we mixed 0.5p,l lOx T4 polynucleotide kinase buffer, 2.9 pi of lOpM
oligonucleotide, 0.1 pi T4 polynucleotide kinase (10 U/pl) and 1.5 pi dATP,
6000Ci/mmole, lOmCi/pl. This reaction was then incubated for 30 minutes at 37°C.
2.8 Polymerase Chain Reaction (PCR)
2.8.1 SSLP mapping
All PCR reactions were performed in 96-well plates with a final reaction volume of either 10 pi or 20 pi. Purified DNA from mutant embryos was diluted 10 times in low TE before being used. Adult fish DNA was used in a concentration of about 10-50 ng/pl. For a 20 pi reaction we used 14.3 pi PCR mix, 0.15 pi of each labelled oligonucleotide, 0.2 pi of Taq polymerase (5u/pl) and 5 pi o f DNA template. The PCR mix was made by adding 122 pi of lOx Taq buffer, 9.8 pi o f 25 pM dNTPs, 740.8 pi of distilled water to final volume of 872.6 pi. Each reaction mixture was overlaid with 1 drop of mineral oil. The PCR conditions were as follows:
94°C for 3 minutes 35 cycles:
92°C for 1 min 58°C-60°C for 1 min 72°C for Imin and 30s 72°C for 7 minutes
This PCR program was also used for all RH mapping and for physical mapping of SSLP markers onto YAC, PAC and BAC templates. AmpliTaq Gold (Perkin Elmer) was used in all cases.
C h a p t e r 2 M a te ria ls a n d m e t h o d s
2.8.2 Long range PCR
Cloning of the laminin a l cDNA required long range PCR. This was performed using the eLongase kit (GibcoBRL), following manufacturers guidelines. Optimal yield was achieved with 2mM MgCh. The PCR conditions were as follows:
94°C for 3 minutes 40 cycles: 92°C for 1 min 55°C for 1 min 72°C for 8 mins 72°C for 7 minutes
2.9 RFLP analysis of genomic DNA from embryos
The allele is a mutation that results in the loss of a Fokl restriction site. Primers
were used to PCR amplify a genomic region surrounding this locus
(TTCTGCGCTGACATCTGTTG and CACACAGTGCTGTTTTCCTCA). These were used in a 20pl reaction with SSLP PCR program described previously. 5pi of genomic DNA was used from a 1:10 dilution of DNA prepared as section 2.6. 30 cycles were performed and then 3U of Fokl was added directly to each sample. Digests were run on a 2% agarose gel.
2.10 Polyacryiamide Gel Electrophoresis
For each gel, 80 ml of gel mix was added to 600 pi o f 10% ammonium persulfate and mixed. IL of gel mix consisted of 240ml of Ultrapure SEQUAGEL Concentrate, 660 ml of Ultrapure SEQUAGEL Diluent and 100 ml o f gel mix buffer. IL of gel mix buffer consisted of 500 g of Urea, 108 g Tris base, 53 g of boric acid, 40 ml o f EDTA, 10 ml of N, N, N ’, N ’-tetramethyl-ethylenediamine (TEMED) and distilled water up to 1 litre. After pouring, the gel was left to polymerise for at least 30 minutes. To each PCR product was added the same volume of loading buffer (50 ml: 75 pg Bromophenol
C/)ap/er 2 Ma^e/va/s arid
for 90-150 minutes, depending on the size for PCR product, in 0.5x TBE at room temperature and 85 W with constant power. Finally, the gels were transferred onto Whatman filter paper, covered with plastic wrap and exposed overnight to X-ray films in cassettes at -80°C.
2.11 YAC libraries
2.11.1 Isolation of yeast genomic DNA
A PCR-based zebrafish library from Research Genetics was used during positional cloning. Yeast clones containing a specified YAC (Research Genetics) were streaked on YPD agar plates and incubated for 2 days at 30°C. From the plates, single clones were picked with a sterile loop and used to inoculate 30 ml YPD medium cultures. The yeast cultures were left to grow until saturation at 30°C, when they were collected by centrifugation for 2 minutes. Subsequently, supernatant was discarded and the pellet was re-suspended in 0.5 ml of distilled water. The suspension was transferred to a 1.5 ml and centrifuged for 5 seconds. The resulting supernatant was decanted and the cells were re-suspended in the residual liquid by vortexing. The cells lysis was performed by addition of 0.2 ml of 2% Triton X-100, 1% SDS, 100 mM NaCl, 10 mM Tris-HCl pH8
and ImM Na2EDTA. To this mixture, 0.2 ml of phenol:chloroform:isoamyl alcohol
(25:24:1) and 0.3 g of acid-washed glass beads (0.45-0.5 mm beads (Sigma) soaked in nitric acid and washed in distilled water) were added. After vortexing for 4 minutes, 0.2 ml of TE, pH8 was added. The lysate was then centrifuged for 5 minutes after which the aqueous layer was transferred to a fresh tube. 1 ml of 100% ethanol was added. The sample was mixed by inversion, centriftiged for 2 minutes and after decanting the supernatant, the pellet was re-suspended in 0.4 ml of TE plus 3 pi of a 10 mg/ml solution of RNAse A (in 50 mM potassium acetate pH 5.5, boiled for 10 minutes). After incubation for 5 minutes at 37^C, the DNA was precipitated with 10 pi of 4M ammonium acetate plus 1 ml of 100% ethanol. The DNA samples were centrifuged for 2 minutes and the DNA pellet (± 20 pg DNA) was resuspended in 50pl of Low TE.
C h a p t e r 2 M a teria ls a n d m e t h o d s
2.11.2 Recovery of YAC ends
YAC ends were rescued through digestion followed by re-circularisation. 5 jul of yeast DNA (± 2 |ig) was digested with BamHl (or Spel), for 5 hours at 37®C. The restriction digests were set up according to the following conditions: 2 pi BamHI (Spel), 10 pi buffer B (H), 5 pi yeast DNA and 83 pi deionised water. The digestion products were extracted with phenol:chloroform:isoamyl alcohol (25:24:1) and ethanol precipitated. The samples were then centrifuged for 15 minutes at 12000 x g at 4°C. The resulting supernatants were decanted and the pellets were re-suspended in 25 pi Low TE. YAC ends can form plasmids by self-ligation. The ligation reaction was set according to the following conditions: 25 pi restriction products, 10 pi ligase buffer, 5 pi ligase (400 units/pl New England Biolabs) and 60 pi deionised water. The mixture was incubated overnight at 16^C. The next day, ligation products were ethanol precipitated and centrifuged at 12000 x g for 15 minutes at 4°C. The pellet was re-suspended in
deionised water and electroporated into electrocompetent E.coli.
2.12 PAC and BAC libraries
A zebrafish BAC library (‘Down-to-the-well’) was obtained from Genome Systems, Inc. (St. Louis). It is a PCR based library housed in 192 microtitre plates. The PCR protocol was the same as that given earlier for the meiotic mapping. The library is arrayed into 13 microtiter dishes. Initially 19 upper pools are screened to restrict the search to 10 possible plates. Screening of these 10 plate pools then identifies the plate. Finally, the specific clone is identified by performing 40 PCR reactions on ‘down-to- the-well’. A zebrafish PAC library was obtained from RZPD (Amemiya et al., 1999).
2.12.1 Isolation of PAG and BAC DNA
This procedure was based upon the Qiagen Maxi-prep kit. Bacterial clones were streaked on selective LB agar plates (lOpg/ml kanamycin for PACs; 50pg/ml chloramphenicol for BACs) and incubated overnight at 37®C. From the plates, single