• No se han encontrado resultados

1.5. OBJETIVOS DE LA INVESTIGACIÓN

2.2.4. JURISPRUDENCIA NACIONAL RESPECTO A LOS BENEFICIOS

Sequencing was performed using protocols based on the chain term ination method of Sanger et oL, 1977. A ll sequencing protocols used a modified form of DNA pofymerase, w ith the normal 3’ to 5’ exonuclease activity removed.

Genomic DNA was amplified by the PCR (2.2.4). A ll of the products were sequenced using Dynabead strand separation and the Sequenase II k it (USB), except when exons 1 and 4 were amplified using the primers in table 6, which were analysed by cycle sequencing.

2.2.7.1 The primers used for sequencing

Exons that were PCR-amplified as a single product (as in table 6) were sequenced using the same non-biotinylated primer as that used for the PCR. The four products containing exons 1, 2, 3-4 and 5-7, amplified as in table 7, were sequenced using the primers indicated in table 8, obtained from D r CM Eng, Mount Sinai Medical Center, New York.

Table 8: Internal, intronic primers for sequencing the a-qalactosidase A aene

Exon + e r ­ st rand

Sequencing primer (5'->3 ) Gene

nucieotide nos. (Kornreich at a/., 1989) 1 CTGGCTCTTCCTGGCAGTCAA 1360-1340 3 + TGGTTCTCTCTTTCTGCTACC 7198-7218 4 + TATAGCOCCAGCTGGAAATT 8261-8280 5 - GCATCCTGCTCTAAGTACTCT 10418-10398 6 - AGATTTAGGGCOAAGAG 10776-10760 6 + GGGTGATGTAGGTAAGTTTAAG 10442-10663 7 + ATGAATGGGAAAGTAAG 10910-10916 2.2.7.2 Sequenase II sequencing

2.2.7.2.1 Strand separation using Dynabeads

DNA was amplified (2.2.4) using 5-20pmol of each primer, one of which was biotinylated at the 5’ end. The biotinylated product was bound to m etallic beads coated w ith streptavldin, allowing them and the attached DNA to be concentrated and washed by attraction to a magnet, as described below (Hultm an et a l, 1989). This process was carried out in a 0.5m l Eppendorf tube and at each step in which a solution was removed or the beads washed, the tube was placed in a Dynal MPC-E magnet for 30 seconds and the supernatant discarded. When a solution was added, the beads were resuspended fully. TES contained lOOmM NaCl, lOmM Tris- HCl at pH 8 and Im M EDTA at pH 8.

For each PCR product, SOpl of Dynabeads™ M -280 streptavldin beads were withdrawn, the liquid storage solution was removed and the beads were washed twice in l(X)pl of TES, to remove traces of sodium azide. PCR product, 50pl out of a lOOpl reaction, was added to the washed Dynabeads and left for 15-30 minutes to allow the formation of biotin-streptavidin bonds. The beads were then washed once w ith TES before adding lOOpl of freshfy prepared 0.1-0.15M NaOH solution and incubating for 10-20 minutes to denature the DNA. The non-biotinylated strand was released into the supernatant and discarded. The pellet was washed w ith lOOpl of NaOH solution to ensure removal of the non-biotinylated strand. Finally,

the single-stranded DNA, biotinylated DNA, which was attached to the beads, was washed once w ith TE)S and then once w ith TE buffer before resuspension of the pellet in 7pl of dHzO for sequencing.

2.27.2.2 The sequencing reaction

The protocol described in the Sequenase II k it (USB) was used to sequence single­ stranded DNA (2.2.7.2.1) and consisted of three steps: prim er annealing; extension by DNA potymerase, in the absence of dideo^qmucleotides; and term ination of sequence by incorporation of didecogmucleotides.

The following solutions were prepared, (a) 5x reaction buffer contained 2(X)mM Tris-HCl at pH 8.0, lOOmM MgCb and 250mM NaCl; (b) enzyme dilution buffer contained lOmM Tris-HCl at pH 7.5, 5mM DTT and 0.5m g/m l BSA. It was used to dilute the Sequenase II enzyme 8 fold, immediatety prior to use; (c) labelling m ixture contained 7.5pM dGTP; 7.5|jM dATP, 7.5pM dTTP, 7.5|iM dCTP and was diluted 5-20 fold; (d) four dideoxytermination mixtures, each of which contained 50mM NaCl, 80pM dGTP, 80pM dATP, 80pM dTTP, 80pM dCTP and 8pM of one ddNTP, either ddGTP, ddATP, ddCTP or ddCTP; (e) stop solution contained 95% (v/v) deionised formamide, 20mM EDTA at pH 8, 0.05% (w /v) bromophenol blue and 0.05% (w /v) xylene cyanol.

Single stranded template, 5pmol of PCR product in a volume of 7pl, was mixed w ith 2pl of 5x reaction buffer and l|il of sequencing prim er which was complementary to the 3’ end of the template. The mixture was heated at 65°C for 2 minutes and cooled to room temperature for 20-30 minutes to anneal the primer.

Extension of primers by DNA potymerase was conducted in the presence of radiolabelled [a-^S] dATP, to allow detection by autoradiography. The annealed prim er-tem plate was mixed w ith Ip l of 0. IM DTT, 2pl of diluted labelling m ixture and 0 .5 |il of [a-^ss] dATP (l(KX)Ci/m m ol. Potymerisation was initiated by adding 2)j1 of diluted Sequenase II enzyme and the mixture was incubated for 2-3 minutes at room temperature.

Chain-term tnation occurred in the presence of dideoxynucleotides. For one sequencing reaction, four tubes, each containing 2.5pl of one of the four dideoxytermination mixtures, were preheated to 37-42«C for 5 minutes. Four 3.5pl

aliquots of the potymerase extension m ixture were withdrawn and added to each of the dideoxytermination mixtures. The chain-term ination reactions were incubated at 37-42°C for 2-5 minutes and then stopped w ith 4pl of stop solution. A ll reactions were stored at -2 0 C .

For sequencing close to the prim er, less than 50 bases, 20 fold dilutions of labelling m ixture and short incubation times were used for the extension and term ination steps. The chain-term ination reaction was usually conducted at 40°C to help decrease formation of secondary structure in the template and failure of the polymerase to extend the sequence in this region of DNA.