LAREPUBLICA.PE, LA WEB DEL DIARIO PRO DERECHOS HUMANOS

2.8.1 Agarose gel electrophoresis

DNA was fractioned according to mass using ultra pure agarose (Gibco BRL, UK). Gels were made with 0.8% w/v agarose in 0.5x TAB buffer (Table 2.1) and 0.1j[tg/ml ethidium bromide and submerged in 0.5xTAE buffer in a Mupid minigel tank (Eurogentec, UK). DNA was prepared in DNA loading buffer (40% glycerol, orange G) and 15pl loaded into each well and electrophoresed for approximately 20 minutes until adequate separation was achieved. Depending on the size of the DNA to be identified, the molecular weight standards used were a 100 base pair ladder, or 1 Kb ladder (Gibco BRL, UK). DNA was visualised by illumination with short wave (254 nm) ultraviolet light.

2.8.2 DNA extraction from agarose gels

DNA was extracted from agarose gels using the Qiaquick gel extraction kit (Qiagen, UK). The DNA band of the appropriate size was excised from a TAE gel using a clean scalpel and weighed. 300pi of buffer QG was added for each lOOmg of gel. This was then incubated at 50°C for 10 minutes or until the gel slice had completely dissolved. Buffer QG contains a pH indicator that is yellow if the pH is 7.5 or below and orange/violet if pH is above 7.5. Appropriate conditions for DNA to bind to the silica membrane are pH below 7.5. Therefore if buffer QG was not yellow, 3M acetate pH 5 was added until the buffer colour returned to yellow. lOOpl of isopropanol was then added for every lOOmg of gel originally used. The sample was then added to a Qiaquick column and placed on a vacuum manifold. 0.5ml of buffer QG was added to the column and vacuum switched on. 0.75ml of buffer PE was then added to the column. The column was removed from the vacuum manifold and centrifuged for 1 minute to remove residual buffer PE. To elute the DNA from the column 50pl of buffer EB was added to the column and allowed to stand for 1 minute and then centrifuged for 1 minute.

2.8.3 Plasmid purification

4ml of LB-Broth (Table 2.1) containing 50p,g/ml ampicillin was inoculated with a single bacterial colony from an agar plate (2.8.9) and grown overnight at 37°C with shaking. Cells were pelleted by centrifugation at 3000g for 15 minutes and resupended in 250|il buffer PI (containing RNase A) of a Qiagen Miniprep kit (Qiagen, UK) and transferred to a 1.5ml microcentrifiige tube. 250|il of buffer P2 was then added and the tube gently inverted 4-6 times. 350pl buffer N3 was added within 5 minutes and the tube gently inverted 4-6 times. The white precipitate formed was pelleted by centrifugation for 10 minutes. Plasmid DNA was purified from the supernatant on an anion exchange resin using a vacuum manifold. The resin was washed once with buffer PB and once with buffer PE using the vacuum manifold. The column was removed from the vacuum manifold and centrifuged for 1 minute to remove residual buffer PE. Plasmid DNA was eluted by the addition of 50pl TE.

2.8.4 DNA quantitation

The concentration of nucleic acids in aqueous solution was determined by spectrophotometry at 260 nrti. An absorbance of 1.0 cm'^ was taken to be equivalent to 50pg/ml of DNA

2.8.5 Plasmids

ROD A molecular clone pACR23 (Keller et a l, 1993) and ROD B clone B.14 (Reeves and Schulz, 1997b) were used for the production of ROD A and ROD B virus stocks. For HIV envelope pseudotypes the following plasmids were used. The packaging plasmid pCMVAR8.2 encodes HIV-1 gag, pol and regulatory genes tat, rev vif, vpr, vpu and nef (Naldini et al., 1996). The vector plasmid pSincpptcmveGFP contains a cytomegalovirus promoter (CMV)-driven emerald green fluorescent protein (eGFP) expression cassette (Follenzi et al., 2000). VSV-G envelope protein was in pMD-G (Naldini et al., 1996). Packaging, vector and VSV-G plasmids were kindly provided by M. Collins (UCL, UK). Plasmid (pCR3.1, Invitrogen, UK) containing ROD A and ROD B envelope were prepared as described in section 2.8.7.

2.8.6 Primers

Env 5’ (phosphorylated) GTCTTCTGCATCAGACAAGTGAGTATG

Env 3 ’ CATCCCTTCCAGTCCCCCTTTTTCTTTTA

V3 13418 GGTTTGGCTTTAATGGCACTAGAG

V3 13420 TTCTCCTCTGCAGTTAGTCCACAT

Table 2.5. Primers.

A ll primers were obtained from O sw ell, UK.

2.8.7 Amplification of HIV-2 envelope

Full length envelope, gpl60, of ROD A and ROD B was amplified based on the strategy for amplification of HIV-1 envelope clones (Gao et al., 1996). PGR amplifications were performed using primers Env 5’ and Env 3’ (see Table 2.5) and the Expand High Fidelity DNA polymerase system (HiFi, Roche, Germany). 25 /xl reactions were run containing 5 pmol of each primer, 2.5 pi of HiFi reaction buffer, 0.4/xl of HiFi and 0.5jLtl of 40mM dNTPs (Table .2.1), together with 0.25ng of DNA of pACR23 or ROD B.14. The PGR conditions were as follows: 20 cycles of 94°G for 45 seconds, 50°G for 45 seconds and 72°G for 4 minutes followed by 15 cycles of 94°G for 45 seconds, 50°G for 45 seconds and 72°G for 4 minutes 15 seconds. 5 p\ of the

PCR was run out on a 0.8% agarose gel (see section 2.8.1), and reactions giving a band of the appropriate size (approximately 3kb) were ligated into vectors as described in section 2.8.8.

2.8.8 Cloning into pCR 3.1 uni

Due to the phosphorylation of the Env 5’ primer, envelope clones could be unidirectionally ligated into pCR3.1 (TA unidirectional cloning kit, Invitrogen, UK.). Approximately 150ng of PCR product together with 60ng of vector were ligated overnight at 15°C in a total of 10 fi\ using the T4 ligase and lOX Hgase buffer (60mM Tris-HCl, pH 7.5, 60mM MgCE, 50mM NaCl, 1 mg/ml bovine serum albumin (BSA),

lOmM p-mercaptoethanol, ImM ATP, 20mM dithiothreitol, lOmM spermidine). 2.8.9 Transformation of competent bacteria

2pl of a ligation reaction (section 2.8.8) or molecular clone DNA was added to 50|xl competent Escherichia coli strain TOPFIO (Invitrogen, UK) and incubated on ice for 30 minutes. Cells were heat shocked for 45 seconds at 42°C and then incubated on ice for 5 minutes. 250pl of preheated SOC media from TA cloning kit was added and incubated with shaking at 37°C for 1 hour. Bacterial cells were then spread on agar plates containing ampicillin (100/ig/ml) and incubated overnight at 37°C.

2.8.9 Colony screening

After overnight growth on agar plates colonies were picked and screened by PCR for V3 loop of HIV-2 envelope. A small amount of bacterial colony was transferred directly to a 50 pi PCR reaction containing lOpmol each of primers V3 13418 and V3 13420 (see Table 2.3). PCR was performed for 38 cycles at 96°C for 1 minute, 63°C for 1 minute and 72°C for 2 minutes resulting in a 381 nucleotide fragment. Clones that were positive by PCR for HIV-2 V3 loop were amplified and plasmid DNA purified (section 2.8.3). Plasmid DNA was digested using Nhel and

EcoRl sites that are present in the vector 5’ and 3’ of the insert respectively. Ipl of plasmid DNA was digested with 0.5pl of each enzyme (Promega, UK) by incubation for I hour at 37°C in Multicore buffer (Promega, UK). The reactions were then run out on a 0.8% agarose gel and a 3kb fragment was observed in positive clones.