II. ESTRUCTURALISMO Y CONDUCTISMO
II. 1 Método Directo
5.2.1.1PCR Amplification of Solyc08g077740Tristar and Solyc08g077740M82
PCR Amplification of Solyc08g077740Tristar from Tristar and Solyc08g077740M82 from M82 was done using primers that enabled the generation of cohesive ends compatible with the LIC vector. Forward primers contained the 15 compatible bases necessary for annealing following T4 DNA polymerase treatment, plus a G that must be present to terminate the exonuclease action of the polymerase in the presence of dCTP, followed by 6 bases encoding a methionine that serves as a translation initiation site and a glycine, then the first 25 bp of the gene sequence from the start codon. Similarly, the reverse primers contain 15 compatible bases plus a G, then the last 25 bp of the gene sequence including the stop codon. Primers were designed using
137
Solyc08g077740Tristar and Solyc08g077740M82 consensus sequences obtained
from the RNA-seq transcript data. The primer sequences are shown below: LIC7774 Tristar forward actatttacaattacgatgggaATGGAGTACCAACAATTGCTAATAG LIC7774 Tristar reverse tcctctccaaattacgCTAATTCATTCTTACACCACGTCTT
LIC7774 M82 forward actatttacaattacgatgggaATGGAGTACCAACAGTTGCTAATAG LIC7774 M82 reverse tcctctccaaattacgCTAATTCATGCTTAAACCACGTTTT.
Lowercase letters indicate primer sequence required for LIC cloning. Upper case letters indicate Solyc08g077740 primer sequence.
PCR amplification was done using iProof Polymerase (BioRad Laboratories, Hercules, CA, USA), following the manufacturer’s instructions. Genomic DNA (50 ng) from Tristar and M82 plants was used as a template in each reaction. The PCR products obtained were cleaned using a Wizard Clean-Up Kit (Promega, Madison, USA) and DNA concentrations were determined using a Qubit 2.0 Fluorometer (Invitrogen, Life Technologies, Carlsbad, CA, USA), following the manufacturer’s instructions.
5.2.1.2 T4 DNA polymerase treatment of PCR products
A minimum of 100 ng of each purified PCR product was treated with T4 DNA polymerase (NEB; Ipswich, Massachusetts, USA) in 1X Buffer 2 (NEB) and 2.5 mM dCTP at 22°C for 30 minutes. After treatment, samples were incubated for 20 minutes at 75°C for inactivation of T4 DNA polymerase and then cooled at 4°C. This treatment produces overhangs complementary to the vector overhang via the 3’ to 5’ exonuclease activity of T4 DNA polymerase. In the presence of dCTP, the polymerase will replace cytosine nucleotides due to its polymerase activity, but will also remove them due to its exonulease activity, resulting in a constant cycle of removal and addition, which therefore defines the overhang.
5.2.1.3 SnaBI digestion and T4 DNA polymerase treatment of pL2 vector
The pL2 binary vector was developed by Laura Rolston (Plant Disease Resistance Lab, RSB, ANU) by modifying pCBJ352, which is a pGreenII, vector containing a kanamycin resistance gene, and 35S promoter and terminator sequences. The pL2 vector map and sequence are shown in Appendix 5.
To linearize the vector, 1 µg of pL2 was digested with SnaBI at 37°C for 3 hours. Next, linearized pL2 was purified using the Wizard Clean-Up Kit and plasmid DNA concentration was determined using a Qubit® 2.0 Fluorometer. To produce overhangs in pL2 complementary to the insert overhangs, pL2 was treated with T4 DNA polymerase in 1X Buffer 2 and 2.5 mM dGTP, at 22°C for 30 minutes, followed by 20 minutes at 75°C and then cooled at 4°C.
5.2.1.4 Insert and vector annealing
T4 DNA polymerase treated PCR product (75 ng) and pL2 vector (50 ng) were annealed using a 3:1 insert to vector molar ratio. Annealing was done by mixing the vector and insert in a total volume of 10 µL with water and incubating at 65°C for 1 minute, then 22°C for 20 minutes. The final constructs were designated pL2-Tristar (carrying Solyc08g077740Tristar) and pL2-M82 (carrying
Solyc08g077740M82).
5.2.1.5 Transformation of constructs into Escherichia coli and Agrobacterium tumefaciens competent cells
E. coli Mach1 chemically competent cells were thawed on ice, mixed gently, then added to 5 µL of the annealing reaction and incubated for 30 minutes on ice. The cells were transformed by heat-shock by incubating the cell-DNA mix for 45 seconds at 42°C, then placing immediately on ice for 2 minutes. Next, 500 µL of LB was added and the solution was transferred to a 2 mL microcentrifuge tube. Tubes were incubated at 37°C for 1 hour on a rotary shaker (200 rpm). After incubation, 150 µL of the cultures were plated on LBA with kanamycin (50 µg/mL). The LBA plates were then incubated at 37°C overnight.
139
Transformants were confirmed by colony PCR using CAPS marker 7774 (see Section 4.3.7), then grown overnight in LB at 37°C on a rotary shaker (200 rpm). From the liquid culture, plasmids were extracted using an AccuPrep Plasmid Mini extraction kit (Bioneer, Daejeon, Republic of Korea) following the manufacturer’s instructions. Plasmids were checked by Sanger sequencing using the primers shown in Table 5.1.
Table 5.1 Primers for sequencing of Solyc08g077740 alleles. Primers labelled with an asterisk (*) were also used for amplification of alleles before sequencing.
Primer name Nucleotide Sequence
7774seq1 GGACACGCTCGAGTATAAGAGC 7774seq2 GGGAGATAATCCGTCG 7774seq3 GGGGAATTGCCAAATGAGC 7774seq4 GTAGAGAGAGACTGGTG 7774seq6 GTGCCTGTTAACGACGGATT 7774seq9 CCATTTCCTGAGTTACGAATC 7774R2 TGAAGGAAAGGTCAAAGATTCG 7774TrisR3 GGTATAAGAGAAGTCCAACTC 7774F4 CCATTTCCTGAGTTACGAATC 7774TNR2* TATggatccTCAAGTCGTGCGAATTTG 7774TNF3* ATAggatccGGTTTATTTGCTAATTCA
Plasmids were transformed into electro-competent Agrobacterium tumefaciens GV3101 (pMP90). Cells were thawed on ice and mixed gently by tapping. Approximately 100 ng of the pL2 construct was added along with 100 ng of pSoup (www.pgreen.ac.uk/JIT/pSoup.htm), which contains the RepA gene lacking in pGreen vectors and needed for their replication in Agrobacterium (Hellens et al., 2000). Cells were electroporated as described in Section 2.2.6. After incubation at 28°C, 200 µL of the culture was plated on LBA with kanamicyn 50 µg/mL (pL2-construct selection), tetracycline 10 µg/mL (pSoup selection), rifampicin 50 µg/mL and gentamycin 25 µg/mL then incubated at 28°C for 48 hours. Transformants were screened by colony PCR using the CAPS marker 7774. Plasmids from positive A. tumefaciens transformants were extracted using an alkaline lysis plasmid DNA isolation protocol as described in Section 2.2.6. Following extraction, plasmids were transformed into electrocompetent E. coli Mach1 cells as described in Section 2.2.4, then two colonies were selected for plasmid extraction using an AccuPrep Plasmid Mini extraction kit. The fidelity of these plasmids were then confirmed by Sanger sequencing.