Modelo de simulación dinámica

Primer sequences, annealing temperatures and the templates used for the PCR reactions are listed in Table 2.1. PCR with KOD Polymerase was performed according to the manufacturers instructions with the following cycle:

1.) 2 min at 95 ºC 2.) 60 s at 95 ºC

3.) 45 s at X ºC (see Table 2.1) 4.) 60 s at 72 ºC

5.) 5 min at 72 ºC

The PCR products and the pET23a vector were cut with Nde I and BamH I according to the manufacturers instructions. The double digested PCR products and vectors were ligated with T4- DNA Ligase at 16 ºC according to the manufacturers instructions. The ligation reaction was used

to transform TOP10 E. coli cells (Chapter 2.1.1.). Vectors with the correct sequence were

identified by sequencing of the plasmid (Allan Wilson Centre for Molecular Ecology and Evolution, Massey University, New Zealand).

Construct Name Forward Primer (5’-3’) Reverse Primer (5’-3’) Template _TemperatureAnnealing

pCFE-GST-3C pCFE-GST-TEV pCFE-GST-TEV2 pCFE-HMal-TEV pCFE-HTEV pCFE-TrxH-TEV CTGGCATATGTCCCCTATA CTAGGTTAT CCGGGGATCCCAGGGGCCCC TGGAACAG pGex-4T-3 55 ºC CTGGCATATGTCCCCTATA CTAGGTTAT CCGGGGATCCCTGAAAATAC AGGTTTTCATCCGATTTTGG AGGATG pGex-4T-3 55 ºC CTGGCATATGTCCCCTATA CTAGGTTAT CCGGGGATCCCTGAAAATAC AGGTTTTCGGTCGTTGGGAT ATCGTAATCATCCGATTTTG GAGGATG pGex-4T-3 45 ºC GGGAATTCCATATGCATCA CCATCACCATCACATGAAA ACTGAAGAAGGTAAACTGG CCGGGGATCCCTGAAAATAC AGGTTTTCCCCGAGGTTGTT GTTATTGTT HpMal-c2P 50 ºC GAGCGGCCATATGTCGTAC TACCATCACCATCACC TGCCAAGCTTTCTAGAGGAT CCGGATTGAAAATACAGGTT TTCGGTC pET32TEV 55 ºC CTGGCATATGAGCGATAAA ATTATTCAC CCGGGGATCCCTGAAAATAC AGGTTTTCGGTCGTTGGGAT ATCGTAATCGTGATGGTGAT GGTGATGCATATG pET32a 55 ºC

Table 2.1 − Preparation of cell free expression vectors. Primer sequences, DNA templates and annealing temperatures used for PCR amplification to prepare the cell free expression vectors.

2.3.2. Results and Discussion

Cell free expression [188] is a method combining in vitro transcription and translation for rapid protein expression. Therefore, the time consuming fermentation of E. coli cell cultures is not necessary. This also allows the expression of proteins that would be toxic to the expression host. Additives such as ligands, detergents or chaperones can be added to increase the yield in folded protein [188]. Another advantage that this system allows is selective isotopic labelling. Using defined combinations of isotopically labelled and unlabelled amino acids, various

labelling schemes can be achieved. As cell free expression is based on in vitro transcription with

T7-RNA-Polymerase from plasmid DNA, co-expression of various proteins from different plasmids containing the T7-promoter is possible. Co-expression of Par-4 proteins with potential

binding partners, in particular with the zinc finger domain of aPKCζ, was considered as a potential expression method for Par-4, as complex formation might increase the solubility of full-length Par-4. The aPKCζ constructs and particularly full-length Par-4 (Chapter 2.6.) are mostly insoluble in native lysis buffer and different purification strategies had to be considered. The requirements for a cell free expression vector are (i) a T7-promoter and T7-terminator for transcription initiation and termination, (ii) a ribosome binding site and an initiation codon for translation initiation and (iii) a multi cloning site for insertion of the protein sequence. These requirements are based on the cell free expression system used by our collaborator Dr. Andrew

Kralicek (HortResearch, Auckland, New Zealand). It was further necessary to exclude a lac

operator from the operon. Since in vitro translation systems use cell lysates [188], in particular

from E. coli, endogenous lac repressor may prevent transcription from vectors containing a lac

operator. Hence, the lac repressor coding lacI gene must be removed. Therefore, the pET23a

vector was chosen as the backbone for all cell free expression vectors (pCFE-vectors) listed in Table 2.1. pET23a contains no lac operator and lacI gene, but instead it has a T7 promoter and a T7 terminator. Also the ribosome binding site and initiation codon are correctly spaced relative to each other. The multi cloning site offered the use of the same restriction enzymes as were already used by our group. This allows a simple transfer of Par-4 inserts from existing vectors to the new pCFE-vectors. Expression tags such as glutathione S-transferase (GST), maltose binding protein (MBP), thioredoxin or a hexa-histidine tag can easily be inserted into the Nde I and BamH I site without affecting the spacing between ribosome binding site and initiation codon.

The strong T7 promoter allows high level protein expression in E. coli cells containing the

λDE3 lysogen. However, under certain circumstances, high level expression may be detrimental

and lead to insoluble or improperly folded protein. In addition, due to the missing lac operator,

transcription control is less stringent compared to other vectors, which may be problematic for cytotoxic proteins. More stringent control can be achieved using hosts carrying pLysS or pLysE genes (pET System Tutorial, Merck Biosciences, Darmstadt, Germany).

Various cell free expression vectors were created during the PhD offering the choice between

different purification tags such as (i) GST (pCFE-GST-3C, pCFE-GST-TEV or pCFE-GST-

TEV2), (ii) MBP (pCFE-HMal-TEV), (iii) thioredoxin (pCFE-TrxH-TEV) or (iv) a hexa-

histidine tag (pCFE-HTEV). Plasmid maps of each vector are given in Appendix B. The pCFE- vectors with GST as purification tag further offer the choice between two different proteases (HMBP-3Cpro and rTEV) for the removal of the purification tag. pCFE-GST-TEV and pCFE- GST-TEV2 differ in the length of the spacer between GST and the rTEV cleavage site. The

longer spacer of pCFE-GST-TEV2 might be favourable if bulky proteins are fused to GST. MBP, thioredoxin and the hexa-histidine tag allow purification through standard IMAC purification protocols. In addition, the well established solubilising properties of MBP allow the expression of target proteins with limited solubility. rTEV is the protease of choice as it only leaves a two amino acid (pCFE-GST-TEV, pCFE-GST-TEV2 and pCFE-HMal-TEV) or three amino acid artefact (pCFE-HTEV and pCFE-TrxH-TEV) at the N-terminus of the target protein (see plasmid maps, Appendix B). rTEV has further advantages over HMBP-3Cpro as will be discussed in Chapter 2.12.1.

Sequencing showed that all cell free expression vectors listed in Table 2.1 had the correct sequence. The vectors pCFE-GST-TEV (Chapter 2.11.4.), pCFE-HMal-TEV (data not shown),

and pCFE-TrxH-TEV (Chapter 2.8.2.) were used for protein expression in E. coli cells and

showed good expression results. The expression levels are comparable to other vectors (pET32a, HpMal-c2P). In the case of pCFE-HMal-TEV with a human rhinovirus 14 3C protease insert, the over-expressed fusion protein accounted for approximately 30% of the total cell proteins as judged by SDS-PAGE (personal communication with Dr. J. Claridge). In vitro expression was tested by Dr. Andrew Kralicek with pCFE-GST-3C, pCFE-HMal-TEV and pCFE-TrxH-TEV.

Protein expression is observed only for pCFE-TrxH-TEV and only with aPKCζ inserts. pCFE-

TrxH-TEV constructs with inserts from Par-4 show no expression indicating a dependence of

protein expression from the insert. The expressed aPKCζ proteins were, however, mostly

insoluble (personal communication with H. Venugopal). It is not clear why other pCFE-vectors (pCFE-GST-3C and pCFE-HMal-TEV) or pCFE-TrxH-TEV vectors with Par-4 inserts, e.g. Par-4(1-290)G40G in pCFE-TrxH-TEV (Chapter 2.8.2.), show no expression. These vectors show good expression in E. coli cells indicating a functional operon.

Taken together, a new set of expression vectors was created allowing stable over-expression of heterologous recombinant proteins. Various expression tags are combined with cleavage sites for highly specific proteases allowing the removal of the expression tag. Due to the same multi cloning site in all vectors transfer of inserts between different vectors is simplified. Hence, different purification strategies can be selected depending on the kind of expression vector allowing an adaptation of the purification process to the properties of the target protein.

2.4. Preparation of Par-4 expression vectors