• No se han encontrado resultados

2. Marco teórico

2.4 Modelos de producción textual

A. Specimen preparation: 10pm transverse sections of the TA mid-belly from 1, 5 and 7day samples applied on super-frost premium plus-coated glass slides (BDH) were used, as described in section 6.2.1 of Materials and Methods in chapter VI. The sections were fixed in DEPC-treated PBS containing 4% paraformaldehyde pH 7.5 for 5 minutes at 4°C, washed with DEPC-treated PBS pH 7.4 and stored at -70°C until further processing.

B. Probe preparation: Primers were synthesized (Sigma-Genosys) using T7 and SP6 promoter sequences with part of the MGF 52bp sequence from exon 5 of IGF-I, for each primer. The sense (forward) primer used was SP6 + MGF part of sequence:

5TGATTTAGGTGACACTATAGAATCTAGATCCCAGCCCCTATCGACACA3’ and the antisense (reverse) primer used was T7 + MGF part of sequence:

5’ TGTAATACGACTCACTATAGGGAAGCTTCTTTCCTTCTCCTTTGCAGC 3’. RT-PCR was performed in order to amplify MGF flanked by T7 and SP6 promoter sequences. I pi of purified MGF plasmid already prepared as described in section 3.2.11, was amplified using the primers above in 2x50 pi reactions, as described in section 3.2.10 in Methods and Materials in chapter III. Amplification was carried out by 35 cycles of dénaturation at 94°C for 1 minute followed by annealing at 60°C for 1 minute and elongation at 72°C for 1 minute. Electrophoresis of 2pl PCR products on a 1.2% agarose gel was performed to check the size of the bands (figure 5.1). Following electrophoresis, PCR products were purified (Wizard PCR Preps DNA purification, Promega) and the concentration was determined by its absorbency at 260nm.

Chapter 5

M l 2 M

2 0 0 b p lOObp 8 0 b p

Figure 5.1. Electrophoresis on a 1.2% agarose gel o f MGF purified plasmid flanked by T7 and SP6 promoter sequences, fo llo w in g PCR am plification. A m plification was carried out with 35 cy cles o f dénaturation at 94° for 1 minute, annealing at 60°C for 1 minute and elongation at 72°C for 1 minute. The picture sh ow s PCR products at around llO bp, obtained using T7 and SP6 primers with part o f MGF sequence included: M =100bp; ladder; lane 1 and 2 PCR products.

C. RNA labelling with DIG-UTP by in vitro transcription with SP6 and T7 RNA polymerases: PCR-fragments with RNA polymerase promoters ligated at their 5’ terminus act as templates for transcription. DIG-11-UTP is incorporated by SP6, T7 at approximately every 20-25th nucleotide of the transcript. The standard labelling reactions for SP6 (sense) and T7 (antisense) digoxigenin-labelled RNA probes accordingly, were as follows: to a microfuge tube on ice the following were added: 200ng of PCR product, 2pi of lOxDlG RNA Labelling mix, 2pl of lOx transcription buffer (400mM Tris-HCl, pH 8.0; 60mM MgCl], lOOmM DTT, 20mM spermidin), sterile RNase-free water to a final volume of 18 pi and 2 pi RNA polymerase (SP6 or T7 respectively). Following a brief mix and centrifuge, the reactions were incubated for 2hours at 37°C. The reactions were stopped by adding 2 pi 0.2M EDTA-solution, pH 8.0 on ice. The protocol and reagents used were by Boehringer Mannheim.

Chapter 5

D. In-situ hybridisation standard procedure (by Boehringer Mannheim):

Pre-hybridisation:

• Sections were washed 2x5 minutes with DEPC-treated PBS, pH 7.4 and then washed further 2x5 minutes with DEPC-treated PBS containing

lOOmM glycine.

• Sections were treated for 15 minutes with DEPC-treated PBS containing 0.3% Triton-X-100 and then washed 2x5 minutes with DEPC-treated PBS. • Permeabilization of sections was performed for 30 minutes at 37°C with

TE buffer (lOOmM Tris-HCl, 50mM EDTA, pH 8.0) containing Ipg/ml RNase-free Proteinase K (Sigma).

• Sections were post-fixed for 5 minutes at 4°C with DEPC-treated PBS containing 4% PFA and washed 2x5 minutes with DEPC-treated PBS. • To acetylate sections, slides were placed in containers on a rocking

platform and incubated with O.IM triethanolamine (TEA) buffer (Sigma), pH 8.0 containing 0.25% (v/v) acetic anhydride for 2x5 minutes. Acetic anhydride (Sigma) is highly unstable so it was added just before incubation.

• Sections were incubated at 37°C for an hour with pre-hybridisation buffer (4xSSC (lxSSC= 150mM NaCl, 15mM sodium citrate, pH 7.2- Sigma) containing 50% v/v deionised formamide (Sigma)).

• Pre-hybridisation buffer was drained from the slides and hybridisation buffer was applied containing lOpg per 100ml of hybridisation solution of the DIG-labelled SP6 and T7 RNA probes. Sections were covered with covers lips (BDH) and incubated at 42°C overnight in a humid chamber.

Hybridisation buffer: 40% deionised formamide, 10% dextran sulfate, Ix Denhartd’s solution (0.02% Ficoll, 0.02% polyvinylpyrrolidone, lOmg.ml RNase-free bovine serum albumin), 4x SSC, lOmM DTT, 1 mg/ml yeast t- RNA and 1 mg/ml denatured salmon sperm DNA that is added shortly before hybridisation. All reagents were provided by Sigma.

Chapter 5

Post-hybridisation:

• Coverslips were removed by immersing the slides in 2xSSC for 5-10 minutes in different containers for the two RNA probes.

• Sections were washed in a shaking water bath at 37°C 2x15 minutes with 2xSSC and 2x15 minutes with IxSSC.

• To digest any single-stranded (unbound) RNA probe, sections were incubated for 30 minutes at 37°C in NTE buffer (500mM NaCl, lOmM Tris, ImM EDTA, pH 8.0) containing 20pg/ml RNase A (Sigma).

• Sections were washed 2x30 minutes in a shaking water bath at 37°C with O.lxSSC.

Immunological Detection:

• Sections were washed 2x10 minutes in a shaking platform with Buffer 1 (lOOmM Tris-HCl, pH7.5 and 150mMNaCl).

• Sections were incubated for 30 minutes with blocking solution (Buffer 1 containing 0.1% Triton X-100 and 2% normal sheep serum (Sigma)). • The Blocking solution was taken off and sections were incubated for 2

hours in a humid chamber with Buffer 1 containing 0.1% Triton X-100, 1% normal sheep serum and 1 in 500 dilution of sheep anti-DIG-alkaline phosphatase (Fab fragments) (Boehringer Mannheim).

• Sections were washed 2x10 minutes with Buffer 1 in a shaking platform. • They were incubated for 10 minutes with Buffer 2 (lOOmM Tris-HCl, pH

9.5, lOOmM NaCl and 50mM MgClz).

• Sections were covered with colour solution containing 10ml of Buffer 2, 45pi nitroblue tétrazolium (NBT), 35pl 5-bromo-4-chloro-3-indolyl- phosphate (BCIP or X-phosphate), both by Boehringer Mannheim and ImM levamisole (Sigma) and incubated for 6 hours (following optimisation) in a humid chamber in the dark.

Chapter 5

• The colour reaction was stopped by incubating the slides in Buffer 3 (lOmM Tris-HCl, pH8.1 and ImM EDTA) and then washed in distilled water. Sections were mounted with an aqueous mounting solution.

All solutions were prepared with DEPC-treated distilled water (0.1% DEPC, Sigma). Different glassware was used for pre- and post-hybridisation steps and baked at 180°C to avoid RNase contamination. Gloves were used throughout the procedure.

Controls that gave negative results were; 1) tissue mRNA was digested with RNase prior to in-situ hybridisation, 2) hybridisation was also performed with SP6 sense probe and 3) the anti-DIG antibody was omitted.

Chapter 5

5.3. R esults