For the detection of mutations in the rhodopsin gene (chapter 3) intronic primers were synthesized flanking each of the five exons. For exons 1 and 4 another two pairs of exonic primers were synthesized to allow amplification of two overlapping fragments for each exon in order to give smaller fragment sizes for heteroduplex analysis. The following are the sequences of these primers (F=forward primer, R=reverse primer) ; and nucleotide positions (Nathans
exon 1.1 (F) TTCGCAGCATTCTTGGGTGG (241-260) and Hogness , 1984;
exon 1.1 (R) GCTAGGTTGAGCAGGATGTA (533-514) addendum!
exon 1.2 (F) CATGTTTCTGCTGATCGTGC (423-442) exon 1.2 (R) ACTCTCCCAGACCCCTCCAT (717-698) exon 2 (F) TTCCTAGCTACCCTCTCCCT (2351-2370) exon 2 (R) GCTTCTTCCCTTCTGCTCAGTG (2636-2615) exon 3 (F) TTGGCTGTTCCCAAGTCCCT (3759-3778) exon 3 (R) TCCAGACCATGGCTCCTCCA (4073-4054) exon 4 .1(F) TCACGGCTCTGAGGGTCCAG (4003-4022) exon 4.1 (R) GAAGATGTAGAATGCCACGC (4226-4207) exon 4.2 (F) ACGCCAGCGTGGCATTCTACAT (4201-4222) exon 4.2 (R) GAGTAGCTTGTCCTTGGCAG (4404-4385) exon 5 (F) AGTTCCAAGCACACTGTGGG (5112-5131) exon 5 (R) GGATGGGAGACGCCTATAGT (5322-5303)
Annealing was generally performed at 1 or 2 "C less than the lower melting temperature of either of the two primers. Melting temperature (Tm) was dependent on the nucleotide sequence of the primer and was calculated as described by the following equation:
Tm=4(A4-T)4-2(C-l-G)
However, for practical reasons, other annealing temperatures which were known to give satisfactory results, were sometimes used.
PCR amplifications were performed on 200 ng of patient DNA in 50 fi\ volumes of IxTaq
reaction buffer (10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgC12, and 0.1% non-ionic detergent), 0.2 mM of each dNTP, 25 pico moles of each primer, and 0.5 unit of Taq polymerase. The reaction mixtures were overlayed with one drop of mineral oil to prevent evaporation. Thirty cycles of PCR amplification at 94®C for 1 min (dénaturation) and 63°C for 3 min (annealing and extension), was followed by dénaturation for two minutes at 94°C.
Addendum to section 2.2.1 :
b
0 1 2 3 4 5 6 7Kb exonsi 2 3 4a
3' Introns 1 2 3 4 4.1 F 4.1R 1.2F 1.1R 1.2R 2F 2R 3p 3R 4.2F 4.2R 1783bp ^205bp ,16bp 833PP [295] [655,2438] [2607,3812] [2978,4094] [4334,5167] [5276]a: Diagram of the rhodopsin gene structure showing the relative size of each exon (shaded boxes 1-5), introns 1-4, and 3' UTR according to the sequence of roJHN clone (Nathans and Hogness, 1984).
b: Enlargement of exons shown in a. Numbered arrows refer to primers described in section 2.2.1. Sizes of exons and introns are shown beneath. Numbers in brackets show the nucleotide position of start codon, 5' and 3' splice sites of introns 1-4, and stop codon according to roJHN sequence (Nathans and Hogness, 1984).
Reactions w ere then left to reanneal at room tem pf^ture for 2-3 hours to allow heteroduplex form ation. PCR reactions w ere perform ed on an Om nigene therm al cycler m anufactured by H ybaid. 10/xl o f P C R product were mixed with 2-3 /d o f lOx ficoll-orange G loading buffer and electrophoresed on a 2.5% agarose-Nusieve (4:1) gel to check for proper am plification and to detect relatively large rearrangem ents (in the range o f few hundreds bp o f P C R am plifiable products). T he above protocol was also used to amplify DNA fragm ents from the PR K C G gene (chapter 7) using prim ers designed from the cDNA sequence.
2.2.2 Hydrolink gel preparation:
H ydrolink gels w ere made from 35ml o f H ydrolink solution, 4ml o f lOx T B E buffer solution, 500/xl o f 10% (w /v) amm onium persulphate, and 35/xl T E M E D . A fter po u rin g , the gel was left to set for Ih r at room tem perature. M DE (M utation D etection Enhancem ent) is a m odified form o f H ydrolink gel m atrix. An M D E gel is prepared and run in 0.6x T B E buffer, but is otherw ise sim ilar to H ydrolink.
2.2.3 Heteroduplex detection:
A round 0.5-1 /xg (estimated relative to a known amount o f X DNA on the gel) o f each PCR product was mixed with 0.1 volum e o f sucrose-orange G loading buffer, then loaded on a H ydrolink gel. T he gels w ere run in Ix TBE buffer at 90 volts for 16-20hr at room tem perature. A fter the ru n , gels w ere stained with ethidium brom ide and photographed on a UV transillum inator (fig 3.5; 3.9b; 3.10a).
2.3 DNA SEQUENCING
R hodopsin fragm ents from individuals showing a heteroduplex on H ydrolink gels w ere ream plified using external prim ers to the prim ers used for heteroduplex analysis and sequenced with the original (nested) PCR prim ers. PCR products w ere digested with p roteinase K (1 m g/ml) at 37"C for 30m in, then phenol-chloroform extracted. 50/il o f this D N A solution was purified through a CHROM A SPIN -30 CO LU M N (from C L O N T E C H ) to rem ove excess dN TPs and DNA oligos o f less than 30bp. The dideoxy term ination m ethod (Sanger et a t., 1977) was used to direct sequence these PCR products using the S E Q U E N A SE kit (from USB) as described below . T he PCR fragm ents o f the deletion and insertion alleles (see sections 3 .4 .1 and 3 .4 .2 ) w ere excised from 1 % low m elting point agarose (LM P) since they w ere d ifferen t in size relative to th e norm al allele o f the rhodopsin gene. DNA from these gel fragm ents w as phenol-
Materials and methods
chloroform extracted, 0.1 volume of 3M Na-acetate added, and the DNA precipitated using 2.5 volume of absolute ethanol. The subsequent steps for direct sequencing were the same as above. However, the result was not satisfactory for the insertion fragment. Hence the excised fragment was cloned using TA-cloning kit (see section 2.5) and subsequently sequenced.
For direct genomic sequencing, 20 pmoles of primer
was
end labelled (see section 2.4)with 20 /iCi of y-P^^-ATP (specific activity 3000 Ci/mmole). Two pmoles of the above end labelled primer were added to 9 ^1 of template DNA ( — 400 ng of the above purified PCR template, or 1-2 /ig of cloned DNA; see section 2.5), denatured at 94®C for 3 min and kept on ice. 2/il of sequenase buffer (200 mM Tris.HCl, 100 mM MgC12 and 250 mM NaCl), 1/xl of DTT (Dithiothreitol) and 2/xl of diluted sequenase enzyme (according to the manufacturer’s protocol) were added while on ice. Meanwhile 3/xl of each dideoxy termination mixture (d.dATP, d.dCTP, d.dGTP, d.dTTP) were warmed up to 37"C in four separate reaction tubes. To each of these, 3.5 jul of the above mixture was added, and tubes were incubated for 5min at 37"C for the extention-termination reaction to take place. 5/d of formamide loading buffer were then added to stop the reaction. The four reaction mixtures were then denatured, ice
chilled, loaded on a 6% denaturing (using 5M urea) polyacrylamide gel, and electrophoresed
in IxTBE buffer at a constant power of 60 watts (for 20X60 cm sequencing gel apparatus from BioRad). After electrophoresing for the required length of time, gels were fixed in a 10% Methanol-10% acetic acid solution, vacuum dried, and autoradiographed overnight using Kodak or Fuji X-ray films. When required, gels were autoradiographed at -80"C with an intensifying screen to enhance the signal.
2.4 5 ’END LABELLING OF PRIMERS:
This reaction was performed in a 30 /xl volume containing 10 mM Tris-acetate, 10 mM
magnesium acetate, 50 mM potassium acetate (0.1 volume of One-Phor-All buffer Plus from
Pharmacia), 9 units of poly-nucleotide kinase, 30/iCi y-P^^-ATP (specific activity 6000 Ci/mmole; from Amersham), and the required amount of primer. This was 20 pmole for the sequencing reaction, and 2 pmole/PCR reaction for microsatellite labelling. For multiplex PCR reactions 2 pmole of each primer were labelled in the same reaction. The reaction was then incubated at 37°C for 30 min.