• No se han encontrado resultados

CAPÍTULO IV: DISEÑO METODOLÓGICO

4.8 ORGANIZACIÓN Y CODIFICACION DE LA INFORMACIÓN:

Media, bacterial strains, and growth conditions. A. brasilense Sp7 (ATCC 29145), a

wild type for chemotaxis,was used throughout this study. Bacterial strains and plasmids are listed in Table 2.1. The A. brasilense cells were grown at28°C in a minimal medium (MMAB) (43) supplemented with thecarbon source of choice at a final concentration of 10 mM. Foraerobic growth, the cells were incubated at 200 rpm on a rotaryshaker. For anaerobic growth, cells were incubated in a GasPakanaerobic system (Becton Dickinson Microbiology Systems, Cockeysville,Md.). The growth medium was supplemented with the antibioticskanamycin (30 µg/ml) and tetracycline (10 µg/ml)for A. brasilense. Ampicillin (100 µg/ml) was used withE. coli.

Growth of the wild-type strain Sp7 and the tlp1 mutant (seebelow) was compared by following the optical density at 600nm (OD600) over time of cultures in MMAB

minimal medium containingeither malate, fumarate, succinate, or fructose as the sole carbon source at two different concentrations, 5 and 10 mM (finalconcentration).

Identification of a new chemotaxis transducer. Twenty-four sequences of transducer-

like proteins and MCPs fromthe α-proteobacteria Caulobacter crescentus, Rhodobacter

capsulatus,Rhodobacter sphaeroides, Rhizobium leguminosarum, Rhizobiummeliloti, Agrobacterium tumefaciens, and the γ-proteobacteriumE. coli were aligned with

CLUSTAL_X (40). A 16-residue highlyconserved domain (HCD) sequence

(NLLALNAGVEAARAG) was identifiedin the C-terminal region, and a degenerate oligonucleotide (HCDprobe) (5'-

Table 2.1 Strains and plasmids used in this study

Strain or plasmid Properties Reference or source

Strains

E. coli

DH5α General cloning strain Gibco-BRL

S17-1 thi endA recA hsdR with RP4-2Tc::Mu- Km::Tn7 (34)

Integrated in chromosome A. brasilense

Sp7 Wild-type strain; ATCC 29145 (37)

SG323 tlp1 mutant; Kmr This work

Plasmids

pSG312 pUC18 with a 1.6-kb EcoRI/SalI fragment This work from pHCD12

pSG316 pUC18 with a 2.9-kb EcoRI/BstBI fragment This work

from pHCD12

pSG318 pSG312 with the Kmr cassette from pHP45Ω-Km This work blunt inserted in the StuI site (plus direction);

Kmr Apr

pSG319 pSUP202 with EcoRI linearized pSG318 inserted This work at the EcoRI site; Tcr Kmr Apr

pHCD12 pLAFR1 clone from genome bank of A. brasilense This work Sp7, containing tlp1, Tcr

pHP45 -Km Apr Kmr (16)

pRK2013 Helper plasmid, carries tra genes; Kmr (17)

pSUP202 Mobilizable plasmid, suicide vector for (34)

A. brasilense; Cmr Tcr Apr

AACCTGCTGGCCCTGAACGCCGGCGTCGAGGCCGCCCGCGCCGGC) was synthesized (Sigma Genosys, The Woodlands, Tex.) and labeledwith digoxigenin-11- ddUTP with the DIG Oligonucleotide 3'Endlabeling kit (Roche Applied Science, Indianapolis, Ind.). TheA. brasilense Sp7 genomic library in the pLAFR1 cosmid (44)

was screened with the HCD probe by colony hybridization accordingto the

manufacturer's protocols (Roche Applied Science). Oneof the cosmids yielding a positive hybridization with the probewas named pHCD12 (Table 2.1). The pHCD12 cosmid was digested withseveral enzymes and rehybridized with the probe to identifysmaller

restriction fragments suitable for sequencing. A 1.6-kbEcoRI/SalI fragment and a 2.9-kb BstBI/EcoRI fragment that stillhybridized with the HCD probe were subcloned into pUC18 digestedwith the same enzymes, resulting in plasmids pSG312 and pSG316, respectively (Table 2.1). Direct sequencing and primer walkingfrom pHCD12, pSG312, and pSG316 were used in automated DNA sequencing(ABI Prism) to obtain the DNA sequence of the region encompassingthe tlp1 gene and flanking regions.

Recombinant DNA techniques. Preparation of cosmid, plasmid, and genomic DNA,

transformations,restriction endonuclease digestions, DNA extraction from agarosegels, ligation reactions; PCR and Southern hybridization, andDNA transformation into E. coli were carried out by standardprotocols (33) and the manufacturers' instructions. The enzymesfor DNA manipulation and PCR amplification were purchased fromRoche Applied Science, New England Biolabs (Beverly, Mass.)and Epicentre (Madison, Wis.). To construct a tlp1 insertionmutant, an aphII cassette (encoding Kmr and two

polished with the Klenow fragment of DNA polymeraseI (New England Biolabs). The cassette was blunt-end ligatedat an StuI site within the tlp1 gene cloned into pSG312, resultingin plasmid pSG318. The pSG318 construct contains the kanamycincassette in the same orientation of transcription as the tlp1gene (Table 2.1). pSG318 was linearized by digestion with EcoRIand ligated into the pSUP202 suicide vector, also digested with EcoRI, yielding pSG319 (Table 2.1). The pSG319 plasmid was introducedinto A.

brasilense by triparental mating with the pRK2013 vectoras a helper, as described

previously (20). Recombinants werescreened for the loss of the recombinant plasmid and for doublehomologous recombination by replica plating on the appropriateantibiotics (Kmr and Tets). The correct allelic replacementin putative mutants was verified by PCR and Southern hybridization,with DNA fragments from the tlp1 gene, the suicide vector, andthe Kmr cassette as probes. One of the tlp1 mutants (SG323)was chosen for further characterization.

Computational DNA and protein sequence analysis. Computational gene finding was

carried out using the FramePlotprogram, which is designed to predict protein-coding regionsin bacterial DNA with a high G+C content (21). The start codonof the tlp1 gene was verified with the GeneMarkS program (11).Similarity searches against the

nonredundant database at theNational Center for Biotechnology Information (Bethesda, Md.)were carried out with the BLASTP and PSI-BLAST programs (6).Domain

architecture of the predicted Tlp1 protein was obtainedby searching against the SMART domain database (24). Multiple-sequencealignment of the conserved N-terminal

A bootstrapped neighbor-joining tree was generated from themultiple alignment with the MEGA phylogenetic package (22).

Behavioral assays. The swarm plate and temporal gradient assays for chemotaxisand the

miniplug assay for redox taxis and chemotaxis in A.brasilense were performed

essentially as previously described(1). For swarm plate assays, the same number of cells of thewild type and the mutant were inoculated by using a 5-µlaliquot of cells in

exponential phase adjusted to the same OD600value. The final concentration of the

chemical to be testedas a chemoeffector was 10 mM. Taxis on swarm plates under anaerobicconditions was assessed with nitrate as a terminal electronacceptor, succinate or fructose as an electron donor, and thesole carbon source in the MMAB medium (43) lacking ammoniumions. The plates were incubated under anaerobic conditions ina GasPak anaerobic system (Becton Dickinson) and were inoculatedwith cells previously grown anaerobically with nitrate as aterminal electron acceptor in minimal liquid medium. The finalconcentration of nitrate was 10 mM. The optimum concentrationsof the carbon sources added as electron donors to observe asharp chemotaxis ring in this assay were determined in preliminaryexperiments and corresponded to 5 mM for succinate and 10 mMfor fructose.

The spatial gradient assay for aerotaxis was used as previouslydescribed, with modifications (1). Cells were washed three timesand resuspended in chemotaxis buffer (10 mM phosphate buffer[pH 7.0], 1 mM EDTA). Nine microliters of cells was mixed with1 µl of the appropriate carbon source to give a finalconcentration of 2.5 mM and introduced into an optically flatcapillary tube. The positions of the aerotactic bands

formedby the wild type and the tlp1 mutant in the capillary tube werecompared by measuring the relative distance of each aerotacticband from the meniscus. The temporal gradient assay for aerotaxiswas used to measure the time until adaptation to oxygen removaland was performed as described by Zhulin et al. (52). Responsetimes were measured in triplicate in three independent experiments.

Measurement of respiration. Respiration (oxygen consumption) in bacterial

suspensions ofthe wild type (Sp7) and the tlp1 mutant was measured as previously described (1).

Preparation of wheat seeds and plant root colonization assays. Seeds of wheat

(Triticum aestivum cv. Jagger) were providedby R. L. Bowden (U.S. Department of Agriculture-AgriculturalResearch Service, Manhattan, Kans.). Seeds were surface- sterilizedas described by Ramos et al. (29) and germinated by incubationin the dark for 3 days on nutrient agar plates (8 g of Bactonutrient broth/liter and 15 g of agar/liter) at 23°C. A.brasilense cells (Sp7 and the tlp1 mutant) were harvested atmid-logarithmic- growth phase (OD600, 0.4), washed three timesin sterile chemotaxis buffer, and

concentrated to 108 cells/ml.The density of the cell suspensions was verified by serial

dilutionand plating onto MMAB plates. For each strain, 107 cells wereadded to 26- by 150-mm glass tubes containing 15 ml of moltenFarhaeus semisoft agar (4% [wt/vol] agar) (50). After the agarhad solidified, one sterile germinated seedling was aseptically transferred into each tube. The seedlings were grown at 23°C,with a photoperiod of 16 h of light and 8 h of dark. Ten daysafter inoculation, the seedlings were washed briefly in

sterilechemotaxis buffer to remove excess agar still adhering to theroots, blotted briefly on sterile Whatman 3MM filter paper,and weighed. Equal-sized roots from five plants were individuallycrushed in 50 ml of sterile chemotaxis buffer with a Waringblender. Serial dilutions were plated on MMAB medium supplementedwith kanamycin (25 µg/ml) and incubated for 4 days at28°C to count colonies of the tlp1 mutant.

In situ detection of bacteria on the root surface. To monitor the pattern of colonization

of the surface of sterilewheat roots, we introduced a stable plasmid, pJBA21TC, that constitutively expresses gusA from the Paph promoter (45) fromE. coli into the wild-type

strain Sp7 and the tlp1 mutant ofA. brasilense by triparental matings, as described

previously(44). There was no difference in the growth of A. brasilenseSp7 and tlp1 cells carrying the pJBA21TC plasmid. This plasmidcontains the parDE genes and was

reported to be very stableunder nonselective conditions (45). Similarly, we found that this plasmid was stable in A. brasilense for at least 100 generationsunder nonselective conditions. Sterile wheat seedlings wereprepared and inoculated as described above. The ß-glucuronidaseactivity was measured 10 days after inoculation on seedlingswith equal- sized roots by the procedure described by Ramos etal. (29), except that the final

concentration of 5-bromo-4-chloro-3-indoxyl-ß-D-glucuronideused was 100 µg/ml. The root systems of at least fiveplants were visually inspected and photographed.

Statistical analysis of data. A two-tailed t test, assuming unequal variances and with a

0.01confidence level, was used to determine if the differences betweenthe mutant and the wild type in the spatial gradient assay foraerotaxis and in the spatial gradient assay

for chemotaxis andanaerobic nitrate taxis were statistically significant. A ttest, with similar parameters, was also performed to comparethe respiration rates of the wild type and the tlp1 mutant.Data obtained for these two strains in the quantitative colonizationof wheat were compared by analysis of variance.

Nucleotide sequence accession number. The nucleotide sequences determined in this

study have beendeposited in the GenBank database under the accession number AY584240.

RESULTS

Identification of the tlp1 gene, sequence analysis, and mutant construction. The

genome of A. brasilense has not yet been sequenced. Therefore,the genomic library of A.

brasilense Sp7 (20) was screened bycolony hybridization with a degenerate probe to the HCD of thechemoreceptors (23, 51). This screen resulted in the identificationof several candidate cosmids, including pHCD12. Sequencing andanalysis of the pHCD12 insert revealed a 1,995-bp open readingframe encoding a putative chemoreceptor-like protein that wenamed Tlp1. Eleven base pairs upstream of the predicted startcodon of the tlp1 gene was a predicted ribosomal binding site,as identified by the GeneMark program (11). A gene coding fora cytochrome c was identified immediately downstream and inthe opposite orientation of tlp1. An open reading frame codingfor a hypothetical protein was detected upstream and in theopposite orientation of the tlp1 gene (Fig. 2.1A).

The inferred Tlp1 protein has a predicted molecular mass of70 kDa. It has a membrane topology typical of classical transmembranechemoreceptors (Fig. 2.1B). Two

Fig. 2.1. Physical map of the 4,113-bp DNA region encompassing the tlp1 gene (A) and

predicted domain architecture of Tlp1 (B). (A) The arrows indicate the direction of transcription. The triangle above the tlp1 gene indicates the insertion of the Kmr cassette.

(B) Domains in the predicted Tlp1 protein, as defined by the SMART database (24): HAMP domain (7) ; MA, methyl-accepting chemotaxis-like domain (23). Black rectangles depict transmembrane regions.

transmembrane regions demarcatethe N-terminal periplasmic domain of Tlp1, and the C- terminalregion consists of a HAMP (histidine kinases, adenylyl cyclases,methyl binding proteins, and phosphatases) domain (7) and asignaling module containing the HCD and two methylation regionstypical of chemoreceptors (23). Similarity searches using the BLASTP program (6) revealed that the Tlp1 C-terminal signalingmodule is homologous to those of chemoreceptors from closelyrelated α-proteobacteria, namely

Magnetospirillum magnetotacticum,Rhodospirillum rubrum, Rhodopseudomonas palustris, and Bradyrhizobiumjaponicum (data not shown). PSI-BLAST searches with

the N-terminalperiplasmic region of Tlp1 followed by multiple alignment ofrelated sequences showed that it comprises a novel domain ofunknown function (Fig. 2.2). This domain was found exclusivelyin the extracellular regions of two classes of receptor proteinsfrom various distantly related bacterial species: chemotaxistransducers and sensor histidine kinases (Fig. 2.3).

Computational analysis did not suggest any specific sensoryfunction for Tlp1. There are no known conserved motifs for bindingprosthetic groups. Interestingly, there is a conserved set ofaromatic amino acids (Phe102, Tyr152, and Tyr156) (Fig. 2.2) thatis usually present in the contact sites where two proteins interact(25).

We constructed a mutant defective in the tlp1 gene (SG323) andcharacterized its motile behavior by a variety of qualitativeand quantitative assays. The average

swimming speed and reversalfrequency of the mutant were essentially the same as that of the wild type. Growth of the mutant in rich and minimal mediacontaining various

chemicals as a sole carbon source (see Materialand Methods) was indistinguishable from that of the wild type.

Fig. 2.2. A protein domain family exemplified by the N-terminal periplasmic region of

Tlp1 from A. brasilense. Multiple alignment of homologous amino acid sequences was constructed with the CLUSTAL_X program (40). The start and end positions (domain boundaries) are shown to the right of each sequence. A consensus for multiple alignment (85% threshold) determined by using the CONSENSUS script (www.bork.embl-

heidelberg.de/Alignment/consensus.html) is shown at the bottom. Identical residues are highlighted in black, and chemically similar residues are highlighted in gray. Each sequence in the alignment is identified by its GenBank protein identification number (except for the Tlp1 protein, for which the GenBank accession number of the

corresponding DNA region is given) and by the abbreviated name of the organism. Abbreviations: HK, histidine kinase; Abra, A. brasilense; Atum, A. tumefaciens; Bjap, B.

japonicum; Bsub, B. subtilis; Cthe, Clostridium thermocellum; Ddes, Desulfovibrio desulfuricans; Gmet, G. metallireducens; Gsul, Geobacter sulfurreducens; Mmag, M. magnetotacticum, Mag, Magnetococcus sp.; Pflu, P. fluorescens; Psyr, Pseudomonas syringae; Rsol, Ralstonia solanacearum; Bfug, Burkholderia fungorum; Sone, Shewanella oneidensis; Syn, Synechococcus; Telo, Thermosynechococcus elongatus;

Vcho, Vibrio cholerae; Vpar, Vibrio parahaemolyticus; Vvul, Vibrio vulnificus; Wsuc,

Wolinella succinogenes; Xaxo, Xanthomonas axonopodis; Xcam, Xanthomonas campestris.

Fig. 2.3. Neighbor-joining tree showing the phylogenetic relationships within the protein

domain family exemplified by the N-terminal periplasmic region of Tlp1 from A.

brasilense. The tree was constructed from the multiple alignment shown in Fig. 2.2 with

the MEGA phylogenetic package (22). Thick lines mark branches with significant ( 60%) bootstrap support (1,000 replicates). GenBank accession numbers and species abbreviations are the same as defined in the legend to Fig. 2.2.

The tlp1 mutant is impaired in chemotaxis to rapidly oxidizable substrates.

Chemotaxis to various carbon sources known to be attractantsfor A. brasilense was tested on swarm plates (1). Selected resultsare shown in Fig. 2.4. We found that chemotaxis to amino acidsand certain sugars (galactose and ribose) was indistinguishablein the mutant and the wild type. However, the mutant was significantlyimpaired in chemotaxis to organic acids, glycerol, and maltose.The results of the swarm plate assay also indicated that thetlp1 mutant might be impaired in chemotaxis to fructose, butthe difference was not statistically significant.

In swarm plates, bacteria metabolize the carbon source and movealong its gradient. Therefore, in this assay, the size of thechemotactic ring is affected by both chemotaxis and metabolism.We have shown that there was no difference in growth betweenthe mutant and wild-type cells on organic acids, sugars, andglycerol. Therefore, we infer that the diminished diametersof the chemotactic rings in these experiments are due to a defectin chemotaxis.

It is important to stress that chemotaxis was not abolishedin the tlp1 mutant and that the mutant only displayed a reducedability to move along gradients of oxidizable substrates (Fig.2.4). The difference in the behavior of the wild type and thetlp1 mutant

was most significant in the presence of substratesthat were previously identified as the strongest chemoattractantsfor A. brasilense, such as sugars and organic acids (1). We have confirmed the chemotaxis phenotype by two additional behavioralassays: a

miniplug method and a quantitative temporal gradientassay (Table 2.2). Cell metabolism is not required for the formationof the gradient of the chemoeffector tested in either assay.We found that the tlp1 mutant was significantly impaired intaxis to chemicals that

Fig. 2.4. The tlp1 mutant is deficient in chemotaxis. Chemotaxis of the A. brasilense

wild-type strain (Sp7) and the tlp1 mutant was compared by the swarm plate assay. Swarm diameters were measured after incubation at 28°C for 48 h. (A) Representative swarm plate with fumarate as the sole carbon source. (B) The average swarm diameters are expressed as the percentage relative to that of wild-type strain (defined as 100%). Error bars represent standard deviations from the mean calculated from at least six repetitions. Differences in the swarming diameters of the wild type and the tlp1 mutant were found to be statistically significant with the following chemoeffectors: maltose, glycerol, succinate, citrate, fumarate, malate, and pyruvate.

Table 2.2. Chemotaxis of A. brasilense wild type and tlp1 mutant in spatial (miniplug)

and temporal gradient assays

Threshold in miniplug Mean response time + SD Assay (µM) temporal assayb

Attractanta Sp7 tlp1 Sp7 tlp1 Fructose 0.1 1 72+5 66+5 Fumarate 1 10 78+4 43+3 Malate 1 100 71+10 46+7 Succinate 1 100 67+8 47+5 Glycerol 10 100 37+7 32+5 Aspartate 100 100 28+7 21+6

a Cells were grown with the chemical to be tested as an attractant and prepared as

described in Materials and Methods.

are strong attractants for A. brasilense,whereas no significant difference could be detected in the responseof the wild type and the tlp1 mutant to weaker chemoeffectors, such as amino acids. Data from both the temporal gradient assayand the miniplug method also suggested that the tlp1 mutantwas deficient in chemotaxis to fructose, a strong attractantfor A. brasilense. Altogether, these results suggest that thetlp1 mutant is

deficient in chemotaxis to rapidly oxidizablesubstrates that have been previously shown to elicit energytaxis in A. brasilense (1).

The tlp1 mutant is impaired in taxis to electron acceptors. Aerotaxis is the strongest

motility response in A. brasilense(8, 52) and is part of the overall energy taxis in this organism(1). We measured aerotaxis in the tlp1 mutant and the wild typeby the capillary