• No se han encontrado resultados

Orientaciones para la enseñanza

In document ES 3° AÑO Geografía (página 55-71)

The amplification of the 2.6kb fragment was the first step of the optimisation process. HIV-1 RNA was extracted using the Biomerieux easyMAG automated extractor using 1ml of plasma as the input in a generic on-board lysis protocol, with a final elution of 25µl. cDNA synthesis was trialled using both gene-specific and Oligo dT priming during reverse transcription (RT) with Superscript III Reverse Transcription reagents (Life Technologies). A total of 3µl RNA, 500µM dNTPs, and

2.5µM of either Oligo dT or primer UNINEF 7’ 5’-

GCACTCAAGGCAAGCTTTATTGAGGCTT-3’ were combined and heated at 65°C for 5 minutes. Subsequently, PCR reactions were removed from the thermal cycler, and a mastermix of 2µl RT Buffer, 25mM MgCl2, 0.1M DTT, 1µl RNaseOUT, 2µl Superscript III and 3µl nuclease-free H2O added for a combined reaction volume of 20µl. Reverse transcription was performed at 50°C 2 hours, 85°C 5 minutes, followed by addition of 1µl RNase H, and then 37°C 20 minutes, 70°C 15 minutes. These conditions (except for priming with Oligo dT) were identical to the conditions detailed in Nadai et al.

To amplify the cDNA, the Expand Long Template PCR Kit (Roche Diagnostics, Sussex, UK) was used. The 50µl first-round PCR reaction mixture comprised 5µl

102

10x PCR Buffer, 350µM dNTPs, 0.4µM each of forward primer msf12b 5’-

AAATCTCTAGCAGTGGCGCCCGAACAG and reverse primer RT347R 5’-

GAATCTCTCTGTTTTCTGCCAGTTC, 5U enzyme, 29.3µl nuclease-free H2O and 10µl cDNA. Cycling conditions were 94°C 2 minutes, followed by 10 cycles of 94° 10 s, 60°C 30 s, 68°C 3 m, then 20 cycles of 94°C 10s, 55°C 30s, 68°C 3 m; the final extension was 68° C 10 minutes. The second round of PCR used forward primer f2nst 5’-GCGGAGGCTAGAAGGAGAGAGATGG and reverse primer proRT 5’-TTTCCCCACTAACTTCTGTATGTCATTGACA. 5µl of first-round PCR product was used as the reaction template, and the volume of nuclease-free H2O was 34.3µl. All other reaction components and conditions remained the same. The PCR was performed without the physical wax barrier used in the Nadai et al. paper. This approach failed to yield an amplified product with both gene-specific and Oligo dT approaches.

Subsequently, the PCR protocol was attempted using a physical wax barrier (AmpliWax PCR Gem 50, Life Technologies) as described in the Nadai et al. paper. Briefly, 350µM dNTPs, 0.4µM of each primer (msf12b and RT3473R in the first round and f2nst and proRT in the nested round) and 20µl of nuclease-free H2O were combined and placed in a thin-walled PCR reaction tube with a wax bead. PCR reactions were heated to 85°C for 5 minutes, and then placed on ice to re- solidify the wax and create a physical barrier that would prevent premature primer hybridisation during the enzyme activation stage. Following this, 5µl 10x PCR Buffer, 5U of enzyme, 9.3µl of nuclease-free H2O (14.3 µl in the nested round) and either 10 (first round) or 5 (nested round) µl template was combined and added to the PCR reaction. The cycling conditions were identical to those detailed above. Unfortunately, the addition of the wax barrier also failed to yield any amplified PCR product when using both gene-specific and Oligo dT priming.

At this stage, three subtype B clinical specimens were extracted in parallel using the easyMAG system and Viroseq manual extractions, and tested using an already- validated HIV-1 pol PCR. Only the Viroseq extracts amplified, and so the easyMAG extraction protocol was discarded. All subsequent testing was performed using Viroseq extractions.

A new RT approach using random hexamers (Qiagen) with Promega reagents (London, UK) was adopted. The reaction mixture comprised 4µl 5xRT Buffer, 1µl 25mM dNTPs, 1.25µl random hexamers, 400U RNAseIn, 50U MMLV RT, 1.75µl nuclease-free H2O and 10µl RNA. The RNA, dNTPs and random hexamers were

103

combined and heated to 65°C for 30 seconds, followed by 42°C for five minutes. Following this, the remaining reagents were added, and reverse transcription was performed at 42°C 60 minutes, followed by 99°C for 5 minutes. The subsequent PCR amplification was performed with the wax barrier as detailed above. This approach resulted in the successful amplification of the 2.6kb fragment of three subtype B clinical specimens (Figure 4_1a).

Although the fragment amplification was successful, the gel showed smears of DNA in 2/3 specimens, indicating an unoptimised methodology. To optimise the reaction, the annealing temperature was increased by 2°C, to 57°C, in the second round of cycles in the nested PCR, and amplification was repeated using the same three clinical specimens. This resulted in both smears of DNA and evidence of mispriming (smaller, incorrectly-sized products) (Figure 4_1b), and so the annealing temperature was returned to 55°C, and a further subtype B specimen was amplified in triplicate. When this showed clean bands in 2/3 replicates (Figure 4_1c), the decision was made to delay final optimisation of each fragment until successful amplification was achieved across the entire HIV genome.

Figure 4_1. Amplification of the 2.6kb fragment spanning gag-pol (HXB2 769 - 3477) from the Nadai et al. protocol for near full-length sequencing of HIV-1 from plasma. a) Amplification of the 2.6kb fragment using three clinical HIV-1 subtype B stored plasma specimens. Lane 1 contained Hyperladder I, lanes 3, 5 and 7 contained one replicate each of a clinical HIV-1 subtype B specimen. Lane 9 contained the negative control. Although the DNA bands were of the correct size, DNA smears were present, indicating an unoptimised methodology. b) Optimisation of the second round PCR annealing temperature. The same clinical specimens as in Figure 4_1a were amplified using an annealing temperature of 57°C in the second round of cycles in the nested PCR. Lane 1 showed Hyperladder I, and lanes 3, 5 and 7 contained one replicate each of a clinical HIV-1 subtype B specimen. Lane 9 contained the negative control. Increasing the annealing temperature in this step did not optimise the method, as DNA smears were still present, and mispriming occurred in the second specimen. c) Triplicate amplification of a single subtype B specimen at the original annealing temperature of 55°C. Hyperladder I is in lane 1; lanes 2 - 4 show triplicate replicates of a single specimen. Although 1 replicate failed to amplify, the other two replicates showed clean DNA bands.

104

In document ES 3° AÑO Geografía (página 55-71)

Outline

Documento similar