• No se han encontrado resultados

5. ANÀLISI DE DADES

5.3. Pamela Palenciano (27/03/20)

Initial experiments focused on finding a suitable alternative to PCR that allowed rapid and accurate amplification of whole genomes without targeting specific genes. ɸ29 was the

preliminary focus, due to its ability to accurately amplify DNA into long transcripts. Further work was carried out to attempt to remove the need for primers, as there are inherent biases even in random primers. Experiments were carried out to assess the compatibility of reverse transcription enzymes with DNA amplifying enzymes to allow methods to be applied to RNA pathogens. An additional enzyme was investigated, which is able to both convert RNA and amplify DNA, potentially allowing a one-step process for all pathogen types.

Initial bacterial work was performed using Escherichia coli K12 substr. MG1655 which is well characterised strain, with a GC content of 50%. There is also a fully constructed reference genome available for this strain. To give a quick evaluation of genome coverage after amplification, a PCR was designed with ten gene targets spread evenly across the genome. Primers for this were selected using the NCBI primer designing tool. When looking at RNA conversion, RNA extracted from tissue culture grown HIV was used (describe in 2.1.3.2). To investigate the length of

transcripts created by the reverse transcription enzymes, a PCR was designed with varying lengths of amplified targets.

2.2.1. Use of ɸ29 MDA for Whole Genome Amplification Using

Random Primers

2.2.1.1. Preparation of None Amplification Controls

The material from two overnight agar culture plates was suspended in 1 ml of sterile PBS, spun at 6000xG for 5 minutes, the supernatant removed and the pellet resuspended in 400 µl sterile PBS. The DNA was then extracted using the Qiagen QIAamp DNA Mini Kit, using the protocol for extraction from blood, with reactions scaled up from 200 µl to the 400 µl input. Briefly 40 µl of proteinase K and 400 µl buffer AL was added to the suspended bacteria and the mixture vortexed. This was incubated for 10 minutes at 56oC before the addition of 400 µl 100% ethanol. 1240 µl of the product was then added to the spin column and centrifuged at 6000 x g for 1 min and the filtrate discarded; this was repeated for the remaining product. The column was then washed using 500 µl buffer AW1 and centrifuged at 6000 x g for 1 min, with the filtrate being discarded. The column was washed again by adding 500 µl buffer AW2, before an additional centrifugation at 20,000 x g for 3 minutes. The DNA was then eluted by addition of 50 µl of DNase

43 free water, incubation at room temperature for 2 minutes and eluted into a clean tube by

centrifuging the column at 6000 x g for 1 min.

2.2.1.2. Extraction for ɸ29 MDA amplification

Bacterial cells or viral particles were suspended in PBS, and 4 µl was used in the amplification reaction. Extraction was performed using alkaline method; briefly cell suspensions were added to 200 mM potassium hydroxide (Qiagen) and 50mM dithiothreitol (Qiagen) and incubated at 65oC for 10 minutes. The reaction was then neutralised using neutralisation buffer (Qiagen). The sample was then briefly vortex and placed on ice.

2.2.1.3. Amplification reaction for ɸ29 MDA

The ɸ29 MDA was performed using the Repli-g Single Cell Kit (Qiagen). A master mix was prepared in a total volume of 40 µl, with 29 µl reaction buffer, containing endonuclease resistant hexamer primers and 2 µl (40 U) of ɸ29polymerase (Qiagen, REPLI-g Single Cell Kit). The

denatured DNA was then added to the master mix and the sample was placed on the

thermocycler which ran on the following parameters, 300C for 16 hours, 650C for 3 minutes and then a 40C hold.

2.2.1.4. Quantification of Product

The ɸ29 MDA product was quantified using the Qubit broad range assay (Thermo Fisher Scientific). Briefly a working solution was made by preparing a 1:200 dilution of the Qubit reagent. Two standards were then made by adding 10 µl of standard to 190 µl working solution, and samples were prepared by adding 2 µl of sample to 198 µl working solution. The samples were vortexed and incubated at room temperature for 2 minutes. The tubes were then read using the Qubit 2.0 Fluorometer. The same tube was read three times for each sample (in accordance to the manufacturer’s instructions) and an average taken as the DNA concentration.

2.2.1.5. Visualisation of Amplification Product

5 µg of product was visualised using a 0.8% agarose gel stained with SYBR safe, this was ran for up to four hours at 50v to visualise the large product. The product was run alongside a 1kb plus DNA ladder (Life technologies).

2.2.1.6. Assessment of K-12 Genome Coverage

The PCR was performed using GeneAmp PCR System 9700 (Applied Bioscience). The reaction was performed using AmpliTaq Gold (Thermo Fisher Scientific) in a total volume of 25 µl. The reaction consisted of 2.5 µl PCR 10x gold buffer, 2 µl 25mM MgCl2, 0.5 µl DNTP mix (10nM), 0.125

44 µl DNA polymerase (1.25 Units) and 1.25 µl of 20 µM forward and reverses primer. To this master mix 5 µl of a 1:1000 dilution of ɸ29 MDA product was added. The cycling condition were as follows, 95oC 10 minutes, and 30 cycles 94oC 30 seconds, 59oC 30 seconds, 72oC 30 seconds, hold at 72oC 10 minutes, and a final hold at 4oC. The products were visualised using a 1.5% agarose gel stained with SYBR safe or the Bioanalyser (Agilent) 1000 DNA kit. Details of the primers can be found in Table 2-4

Gene Position F primer R primer

yafD 231122 TACCACCTGGGGAACCGTTA TCACTGACGTTCAGACCACG

nagC 699597 CGGCAGATTAGTGCGAAACG CGGACAGCGGCAAAATTCAT

fabG 1149893 AGTTATTGGCACTGCGACCA CGCCGTTCACATGCAAAGTT

abgB 1399834 GGGGGCGCGGATAAGATAAA TTACCCGCAACGTAGGCAAT

hisG 2088216 ACTTTACCCTGCGTCGTCTG GAATTGAACTGGCACCCAGC

eutB 2555340 TTGAGGTTCTGGTCAGCGTC GACGACGTGCAAAGTATCGC

speB 3080899 AAAGCAGGATCCAGGCAGTC ACTGGGTGATTACTGGCGTG

kefB 3476824 CTTCATGGTGTCTTCCGGCT CCTCGGGGTGCTTTATACCC

mnmG 3921767 GCAGATCTTCACCACTGGCT CCGAACGGTATCTCCACCAG

treR 4464322 ACGATCTCCGGATGGAGGAA ACCCGTCTGGATTCGTTGTC Table 2-4 Details of PCR ta rgets used i n i nitial assessment of amplification of the E. coli K12 genome, including gene

na me, gene position a nd primer s equences

2.2.2. Assessment RNA Conversion Enzymes

2.2.2.1. Concentration of HIV Using PEG-High Volume

100 ml of tissue culture supernatant from 8E5/LAV94 cells was divided into four 25 ml aliquots, and centrifuged at 6000xg to remove host cells. The supernatant was then added to 25 ml of Polyethylene glycol (PEG) 20,000 (Sigma-Aldrich) in 0.9% NaCl to a total of 20% (w/v) PEG, vortexed and incubated overnight at 4oC. The sample was centrifuged at 17860xg for 20 minutes. The pellet was resuspended in 5 ml sterile PBS, vortexed and combined into a single tube and incubated overnight at 4oC. The sample was once again centrifuged at 17860xg for 20 minutes. The sample was resuspended in 1ml sterile PBS. The 1ml was then concentrated as before and resuspended in 20 µl.

2.2.2.2. RNA Extraction

The concentrated virus was then extracted using either alkali extraction or column based extraction. For the alkali extraction the protocol described in 2.2.1.2 was followed but with the volume scaled up to a total reaction volume of 50 µl. Alternatively the concentrated virus was extracted using PureLink

®

Viral RNA/DNA Kit (Invitrogen), as described in the manual, with the

45 substitution of the carrier RNA with Linear Acrylamide (LPA) (Invitrogen). Briefly 25 µl Proteinase K, 200 µl lysis buffer and 5 µl LPA was added to the sample, gently vortexed and then incubated at 56oC for 15 minutes. After the addition of 250 µl 100% ethanol the sample was incubated for a further 5 minutes at room temperature. The sample was then added to the viral spin column and centrifuged for 1 minute at 6800xg, and the flow through was discarded. The sample was then washed twice with wash buffer before being eluted in 50 µl RNase free water. The RNA from both extractions was then quantified using Qubit RNA HS Assay Kit or Qubit RNA BR Assay Kit.

After quantification dilutions were prepared to contain 1000, 10, 0.1, 0.01, 0.001 and 0.0001 pg/µl concentrations using RNAse free water containing 2 U/µl RNaseOUT™ Recombinant

Ribonuclease Inhibitor (Thermo Fisher Scientific). These dilutions were then used for investigating the sensitivity of reverse transcription enzymes.

2.2.2.3. Addition of RNase and DNase

After viral concentration with PEG, and suspension in 50 µl of sterile PBS 10ng of RNase A (Thermo Fisher Scientific) along with 5 units of DNase I, (Thermo Fisher Scientific) was added. The sample was then briefly vortexed and incubated at 37oC for 20 minutes. After incubation 100 U RiboLock (Thermo Fisher Scientific) was added to the sample and 5µl 0.5M EDTA.

2.2.2.4. RNA Conversion using Superscript III

1 µl of RNA was added to 50 ng of random primers (Thermo Fisher Scientific) and 1 µl 10mM dNTPS mix (Thermo Fisher Scientific) and made up to 13 µl with sterile water. This was then incubated at 65oC for 5 minutes and put on ice for 2 minutes. To this 4 µl 5x first-strand buffer, 1 µl 0.1M DTT, 1 µl RNaseOUT and 1 µl SuperScript III (Thermo Fisher Scientific) was added. The sample was then incubated at 55oC for 60 minutes before inactivation at 70oC 15 minutes

2.2.2.5. RNA Conversion using Superscript IV

1 µl of RNA was added to the following reaction to 50 ng of random primers and 1 µl 10mM dNTP mix and made up to 13 µl with sterile water. This was then incubated at 65oC for 5 minutes before the addition of 4 µl 5 x SSIV buffer, 1 µl 0.1M DTT, 1 µl RNaseOUT and 1 µl SuperScript IV reverse transcriptase (Life technologies). The reaction was then for 10 minutes at 55oC and 10 minutes at 80oC.

46 Using envelope targeting primers95 one forward primer and five reverse primers in the

envelope gene were selected, listed in Table 2-5. PCRs were performed for each primer combination in the following mixture 5μl 10X PCR Buffer, 1.5 µl 50 mM MgCl, 1 µl 10mM dNTP mix, 1 µl 20 µM forward and reverse primers, 0.4 µl Taq (5U/ µl), 5 µl first strand cDNA, water to 50 µl total volume. The following cycling conditions were used 94oC 2 minutes, 30 cycles 94oC 30 seconds, 53oC 30 seconds, 72oC 30 seconds, hold at 72oC 10 minutes, and a final hold at 4oC

Primer Location Product length

Sequence(5’–3’)

Forward E70 335 GGGATCAAAGCCTAAAGCCATGTGTAA

Reverse E03 +218 2283 TAAGTCATTGGTCTTAAAGGTACCTG

E45 2113 1778 CCTGCCTAACTCTATTCAC

E65 1568 1233 AGTGCTTCCTGCTGCTCC

E125 1091 756 CAATTTCTGGGTCCCCTCCTGAGG

E145 757 422 CAGCAGTTGAGTTGATACTACTGG

Table 2-5 Details of primer name, amplicon size a nd genome position of primers used to a mplify HIV

2.2.2.7. PyroPhage

PyroPhage 3173 (Lucigen) is designed to have a one-step reaction for reverse transcription and PCR amplification. Two forms of the enzyme are available, a wild-type and an exonuclease knock out (exo-); both enzymes were tested using the specific primer combinations described in

Table 2-5.

Initially the enzyme was used to amplify the cDNA produced by SuperScript IV in 2.2.2.5 using the following reaction using either the wild type or exo- versions of the enzyme. 200 ng cDNA was added to 25 µl PyroPhage 3173 2X PCR Buffer, 1 µl 10mM dNTP mix, 1 µl 10 µM forward and reverse primer, 0.5 µl PyroPhage 3173 and water to a total of 50 µl. The cycling conditions were the same as used in the PCR in 2.2.2.6

The utility of the enzyme to perform both RNA conversion and DNA amplification in a single step was then investigated. The reaction was set up as follows 1 µg RNA, 25 µl PyroPhage 3173 2X PCR Buffer, 1 µl 10mM dNTP mix, 1 µl 10 µM forward and reverse primer, 0.5 µl PyroPhage 3173 and water to a total of 50 µl.

The following cycling conditions were used 94oC 2 minutes, 30 cycles 94oC 30 seconds, 53oC 30 seconds, 72oC 30 seconds, hold at 72oC 10 minutes, and a final hold at 4oC.

47

2.2.2.8. Reverse Transcription and MDA

The cDNA library produced using SuperScript III and IV in 2.2.2.4 and 2.2.2.5 were amplified using ɸ29 MDA. Briefly 10 µl of cDNA was added to 40 µl mastermix and amplified for 8 hours. After amplification, the ɸ29 MDA product was quantified and then diluted 1:1000 before addition to the PCR reactions using primers described in 2.2.2.6.

2.2.3. Whole Genome Amplification Using Nick Extension

Amplification

Experiments were undertaken to assess the possibility of producing whole genome

amplification by initiating the DNA replication at nicks in DNA. Nt. BstNBI (New England Biolabs) is an endonuclease that cleaves one strand of DNA at a specific site downstream of a 5 base

recognition site. The enzyme has previously been used for isothermal amplification from nicking by Moser et 78 using the amplification enzyme PyroPhage 3174 77.

2.2.3.1. Nicking Reaction with Nt. BstNBI

Initially bioinformatic predictions of the number of nicking events in the three bacteria were performed on the reference genome of, Escherichia coli K12 substr. MG1655, Actinomyces naeslundii (NCTC 10301) and C. difficile. This was performed by searching the reference sequence for the recognition sites on both strands of DNA. Using the following command