• No se han encontrado resultados

Pasando el marcador

In document Kryon 8- Pasando el marcador- L Carroll (página 59-72)

Real-time PCR (qPCR) is a commonly used technique that allows the relative quantification of the amount of cDNA template in a sample. It monitors the amount of PCR product formed during each cycle via detection of a fluorescent signal (Logan et al., 2009). The signal emitted increases in proportion to the amount produced. This is particularly evident during the exponential phase of the reaction (Glick & Pasternak, 2003). There are a number of different detection methods available for qPCR; these include TaqMan Probe Systems, SYBR Green I, Molecular Beacons and Hybridisation Probes (Tamarin, 1999). The in-house method of choice for qPCR detection was the TaqMan Probe System.

2.8.2.2 Taqman® System

This system involved the use of forward and reverse primers and a TaqMan probe (Applied Biosystems, Cheshire, UK) to amplify the gene of interest. The TaqMan probe is an oligonucleotide with a fluorescent (reporter) dye (FAM-6- carboxyfluorescein) on the 5’ base, and a quenching dye (TAMRA-6- carboxytetrametheyrhodamine) on the 3’ base (Lawyer et al., 1993). Energy is transferred from the reporter dye to the quenching dye by a process known as fluorescence resonance energy transfer (FRET). FRET is undetectable by the PCR machine, yet when the Taq polymerase copies a template onto which the probe is bound, its 5’ exonuclease activity cleaves the probe separating the reporter and quenching dyes, ending the FRET (Giulietti et al., 2001). The reporter dye is then able to emit fluorescence at a wavelength of 518 nm for detection of FAM, which the PCR machine can detect (see Figure 2.12). The amount of fluorescence increases in each cycle proportionally to the DNA amplification (Logan et al., 2009; see Figure 2.13). This accumulation of product is detected by monitoring the increase in fluorescence of the reporter dye plotted after normalisation to a reference dye, in this instance ROX (carboxy-X-rhodamine). The reference dye is used to correct for differences in reaction volumes between wells (Sails, 2009).

110

Figure 2.12. TaqMan detection method for qPCR. The TaqMan assay uses a probe oligonucleotide with a reporter fluorophore at the 5’ end (R), and a quencher dye at the 3’ end (Q). As the product is amplified, the 5’-to-3’ exonuclease activity cleaves the end of the probe, allowing fluorescence emission from the reporter dye to occur. This emission is then monitored by the PCR machine. Source: www.appliedbiosystems.com.

111

Figure 2.13. Example plot demonstrating the amplification of fluorescent product produced at each cycle of PCR. The amount of fluorescence increases in each cycle proportionally to the DNA amplification. The accumulation of product is then detected by monitoring the increase in fluorescence of the reporter dye plotted after normalisation to a reference dye. Source: www.bio-rad.com.

2.8.2.3 Preparation for Real-Time PCR

A master mix was prepared for each gene of interest, comprised of forward and reverse primers (see Table 2.5), Taqman probe and GoldStar enzyme (qPCR Core Kit RT-QP73-05; Eurogentec Ltd., Hampshire, UK), and according to the following protocol (per well): 1.25 µl 10x reaction buffer, 1.25 µl (2.5 mM) 50 mM magnesium chloride, 0.5 µl (100 mM) 5 mM dNTP, 0.038µl Sense primer, 0.038 µl anti-sense primer, 0.063 µl Taqman probe, 0.0625 µl (0.025 U/µl) of 5 U/µl Hot Goldstar enzyme and 8.29 µl Ultra-pure water, for a total reaction mixture of 11.5 µl per well.

The mix was aliquoted into a 96-well plate, and one µl of template cDNA sample was then added to each well for a total reaction volume of 12.5 µl. Non- template controls were included for all primers and probes. The plate was then sealed and centrifuged at 1000 rpm, for 15 sec (IEC Centra-7R Centrifuge, Damon, Global Medical Instrumentation Inc., Minnesota, USA).

112

Table 2.5.Details of specific primers used for real-time qPCR analysis. Primer Product (bp) Conc. (nM) Sequence (5’-3’) Β-actin s 101 300 GACAGGATGCAGAAGGAGATTACTG Β-actin as 300 GAGCCACCAATCCACACAGA B-actin P 225 CACCATGAAGATCAAGATCATTGCTCCTCCT Leptin s 100 900 AACCCTCATCAAGACCATTGTCA Leptin as 900 CCCGGGAATGAAGTCCAAA Leptin P 225 TGACATTTCACACACGCAGTCGGTATCC Adiponectin s 64 900 CCCCTGGCAGGAAAGGA Adiponectin as 900 CCTACGCTGAATGCTGAGTGAT Adiponectin P 225 AGCCCGGAGAAGCCGCTTACATG

The primers used for qPCR were β-actin, leptin and adiponectin (Eurogentec Ltd., Hampshire, UK). Abbreviations: as = antisense primer; P = probe; s = sense primer.

When quantifying the level of expression of a particular gene of interest, it is compared with that of a gene expressed at a concentration which is known to be stable; this is known as a ‘housekeeping’ gene. The selection of an appropriate housekeeping gene is critical, as it is used to assess the relative degrees of expression of the genes of interest. Common examples of housekeeping genes include β-actin, glyceraldehyde-3-phosphate (GAPDH), 18S rRNA and RNA polymerase IIa (RNAPolIIa). Studies examining gene expression in WAT have successfully used β- actin as the housekeeping gene (Gorzelniak et al., 2001; Eisele et al., 2005; Zhang et al., 2005), and this, therefore, was the gene of choice for the assays described here. A second housekeeping gene, RNAPolIIa was also tested. However, expression of this gene was variable within the tissue samples and therefore, its use as a housekeeping gene was abandoned.

2.8.3.4 Real-Time PCR Set-up

Reactions were performed using a real-time PCR machine (Mx3000P, Agilent Technologies, CA, USA). The plate was inserted into the heat block and amplifications were performed as follows:

113

1. 50˚C for 2 min (activation of Hot Goldstar enzyme) 2. 95°C for 10 min (denaturation)

3. 35-40 cycles (dependent on the level of expression of gene) i. 95˚C for 15 sec (denaturation)

ii. 60˚C for 60 sec (combined primer annealing and extension)

2.8.2.5 Analysis of qPCR Data

Once amplifications were complete, data were collected and analysed by software (MxPro-Mx3000P software, Agilent Technologies, Berkshire, UK), which also displayed amplification plots on a log scale. The threshold was adjusted to reduce background noise from the plot. Results were exported as Microsoft Excel files and gene expression analysed by relative quantification, by the 2-∆∆CT method (Livak & Schmittgen, 2001). Samples were normalised to values for the housekeeping gene, β-actin, and results expressed as fold changes of threshold cycle (CT) values relative to the controls which in this instance was the SFA-fed group:

∆CT = CT(PUFA) – CT(β-actin)

∆∆CT = Mean ∆CT(PUFA) – Mean ∆CT(SFA) Fold Change = 2-∆∆CT

114 PART B: Neurogenic Methods

In document Kryon 8- Pasando el marcador- L Carroll (página 59-72)