• No se han encontrado resultados

Principales resultados de la aplicación del procedimiento

CAPÍTULO 3. INTEGRACIÓN DE LOS PROCESOS DE DISTRIBUCIÓN Y

3.1 Principales resultados de la aplicación del procedimiento

Primers were designed against the relevant gene target to allow the cloning of PCR products in frame with any C-terminal tags. Restriction sites or overhang sequences for TOPO-cloning were also incorporated, as appropriate. All primers were pur- chased from Sigma-Aldrich, UK.

Name Sequence 5’ to 3’ T m ( C) topoforward GTGGAACTCCATGGGTGGAGATTCGCAGG 80 toporeverse CTATTAACCGTCAGAGCTCACAGACTCAATGA 71.7 pdgfrforward TAAGCACATATGATGTCGTACTACCATCACCATC ACCATCAC 75.5 pdgfrreverse TCCGATGCTCGAGGCTATTAACCGTCAGAGCTC ACAGACTCAAT 80.9

Table 2.3: Primers used in this study, T m represents the melting temperature

2.3.2 Preparation and storage of plasmid DNA

Plasmid DNA was isolated using GeneJET MiniPrep kit (Thermo Fisher Scientifc, UK) as per manufacturer’s protocol. The DNA was recovered in 50 µL dH2O and

stored at -20 C.

2.3.3 Polymerase chain reaction (PCR)

The amplification of the PDGF R-TM gene was performed on ice with 5 µL of 5Phusion HF bu↵er, 1 µL 10 mM dNTP mix, 2.5 µM of each primer, 1 µL template DNA (0.5 ng), 0.5 µL of Phusion DNA Polymerase (1 units/50 µL) and dH2O to a final volume of 50µL.

After gently mixing the reaction, all liquid was collected at the bottom of the PCR tube through a quick spin in a microcentrifuge. The tubes were then transferred

from ice to a Biometra T3 thermocycler and a PCR was initiated according to the conditions illustrated in Table 2.4.

Step Temperature ( C) Time (s)

Initial Denaturation 98 30 25-35 Cycles 98 10 Tannealing 30 72 20 per kb Final Extension 72 600 Hold 4

Table 2.4: Thermal cycling scheme for a typical PCR,Tannealing was 3–5 C below

theT m of the relevant primers

2.3.4 Agarose gel electrophoresis

Agarose gels were prepared by dissolving 1–2% high-melting point agarose (Sigma- Aldrich) in 50 mL of 1Tris-acetate-EDTA (TAE) bu↵er in a 250 mL conical flask and heating in a microwave oven until dissolved (2 minutes). The solution was subsequently cooled and 5 µL of Biotium GelRed Nucleic Acid Stain (10,000 in water) was added and gently shaken to mix evenly. This was immediately poured into a gel cast and left to solidify. DNA samples were prepared by adding 1 µL of 6⇥DNA loading dye (Fermentas) per 5 µL of DNA sample. The samples were then loaded on to a gel which had been submerged in a gel tank containing 1⇥TAE bu↵er. In order to quantify the size of the DNA samples, a lane with 10 µL of FastRulerTMMiddle Range DNA ladder was added. Electrophoresis was performed

at 150 V for 30 minutes or more, as required. The DNA was visualised using BioDoc-Itr Imaging System equipped with a camera to take photographs of the gels with the DNA illuminated.

2.3.5 Purification of DNA from PCR and restriction digests

Purification of the DNA samples from polymerases and endonucleases after PCR and restriction digests was performed through adsorption to a silica matrix using

quired, the QIAquick Gel Extraction Kit (QIAGEN) was used which also achieves purification through the adsorption of DNA on a silica matrix. Both kits were used as per manufacturer’s instruction and DNA was eluted in 30µL of water.

2.3.6 Restriction endonuclease digestion of DNA

Restriction digests were carried out in an appropriate bu↵er system using restriction enzymes (NEB, UK) as per the manufacturer’s instructions. Typically, reactions were incubated for 2–3 hours at a temperature of 37 C. DNA was subsequently purified as detailed in section 2.3.5.

2.3.7 Ligation of chimeric DNA fragments

After gel extraction and/or purification, the linearised vector strands and insert DNA fragments were ligated using T4 DNA Polymerase (NEB, UK) as per manufacturer’s protocol. This was typically done for 2 hours at room temperature or overnight at 4 C at a vector to insert ratio of 1 : 3.

In particularly troublesome ligation reactions, calf-intestinal alkaline phosphatase (CIP) (NEB, UK) was used, as per manufacturer’s instructions, to dephosphorylate the 5’-ends of linearised vector DNA to prevent recircularisation.

The ligation mixture was then used to directly transform the relevant strain of E. coli as per the description in section 2.5.3. Colonies were picked at random using a sterile pipette tip and cultured overnight at 37 C in 10 mL of LB in the presence of appropriate antibiotics. The plasmid DNA was then extracted (section 2.3.5) and digested using restriction enzymes (section 2.3.5). It was then analysed on an agarose gel (section 2.3.4) to establish the presence of an insert at the appropriate molecular weight.

2.3.8 Colony PCR

In order to affirm the presence of insert DNA in the plasmid constructs, a colony PCR was performed. This was done by picking a random selection of 30 colonies and resuspending each of the them in 50 µL of PCR mixture described in section 2.3.3. The PCR was run according to the relevant thermal profile and the reactions were subsequently run on agarose gels. Where there was evidence of the insert being present, the colony was grown overnight in rich media after which the plasmid was extracted and sent for sequencing.

2.3.9 Concentration of DNA fragments

The concentration of DNA fragments was measured using Thermo Scientific Nan- oDrop Lite spectrophotometer.

2.3.10 DNA sequencing of plasmid constructs For all cloned genes, it was important to ensure that

– start and stop codons were present,

– there were no PCR errors in the form of point mutations etc.,

– the gene along with any tags or restriction sites that were added was correctly oriented and in frame.

In order to do so, 20 µL of⇠100 ng/µL of DNA was sent for sequencing to GATC Biotech Ltd., UK. All sequencing experiments were performed using a T7 primer. Se- quencing results were manually checked using Serial Cloner 2.6 for Mac OS X.

Documento similar