E. coli clones used for pnpA and mar clone libraries were preserved in 100 μL LB
broth with 1 mL/L ampicillin and 50 μL glycerol:water solution (50:50) and stored at -80˚C. Certain E. coli clones were used as a source of plasmid (pDrive cloning Vector (3.85 kb), Qiagen, UK) inserted with either a fragment of the gene pnpA or
mar. Fresh selective plates (LB agar with ampicillin, X-gal and IPTG added as described for cloning) were streaked with preserved E. coli clones. After overnight incubation at 37 ˚C a single colony was selected to inoculate a starter culture of 3 mL LB medium with ampicillin (1 mL/L). After 8 hours incubation at 37 ˚C with
79 vigorous shaking (300 rpm) the culture was diluted 1/500 into selective LB medium as for high-copy plasmids (25 mL LB medium was inoculated with 50 μL of starter culture). After 14 hours of incubation at 37 ˚C with vigorous agitation (300 rpm) bacterial cells were harvested by centrifugation at 6,000 x g for 15 minutes at 4 ˚C. The cell pellet was frozen and stored at -20 ˚C for plasmid purification which was performed with Qiagen HiSpeed Plasmid Midi Purification Kit (Qiagen, UK) according to manufacturer’s protocol. Plasmid DNA pellet in 50 μL of TE buffer (pH 8.0) was obtained. Plasmid concentration was determined by NanoDrop measurement. The aliquot with plasmid concentration at 500 ng/μL was diluted to about 100 ng/μL. Plasmid containing a fragment of the pnpA gene was digested with the restriction enzyme BamHI (10 U) (Invitrogen, UK) with a restriction site 5’-
G/GATCC, in a 10 μL reaction which consisted of 0.5 μL of BamHI, 1μL of
10XBuffer, 2 μL of plasmid (100 ng/μL) and water to 10 μL. The cycle conditions were as follows; digest for 4 hours at 37˚C, enzyme inactivation at 95 ˚C for 15 minutes. Digested plasmid was purified using the PCR purification kit (Qiagen, UK). The concentration of plasmid was confirmed by NanoDrop and appropriate dilutions were performed to obtain a plasmid concentration within the range of 0.002-800 pg/μL for the calibration curve in QPCR. Standard plasmid containing fragments of the mar gene was obtained in the same way as described for the pnpA gene. QPCR reactions were performed in triplicate for negative control, standards and experimental samples. The final volume of reaction was 20 μL and it consisted of 10 μL 2XSYBR green (Applied Biosystems, UK), 1 μL of forward and reverse primers for pnpA or mar amplification (20 μM) (Table 2.3), 0.2 μL BSA (40 mg/mL), 1 μL of template (either standard or sample), and water added to 20 μL. The QPCR was performed with a Real Time PCR platforms (Applied Biosystems, ABI 7900HT). The cycle conditions were as follows; 95 ˚C for 10 minutes, followed by 40 cycles of 95 ˚C for 15 seconds, 60 ˚C for 1 minute and 95 ˚C for 15 seconds. For normalization of number of copies of both functional genes, the 16S rRNA gene was amplified with primers included in Table 2.3, from DNA extracted from the isolated PNP degrader Pseudomonas syringae AKHD2. A known concentration of amplified and purified gene fragment was used for QPCR standard preparation. QPCR for the 16S rRNA gene was performed as described for functional genes. Number of copies of pnpA, mar and 16S rRNA gene were calculated as detailed by Whelan et al.
80 were sequenced by the Genomics Centre at the University of Warwick, School of Life Sciences, Wellesbourne Campus to make sure that the DNA sequence amplified was the same as the one recorded in the clone library sample it was taken from.
2.3.16. 454 sequencing for pnpA and mar gene
DNA extracts (aliquots of 25 μL) extracted from triplicate samples of freshly collected river water and from river water which had degraded high PNP concentration in the dark, were submitted to Research and Testing Laboratory (RTL, Texas, U.S.A). Samples were amplified for pyrosequencing using a forward and reverse fusion primer. The forward primer was constructed with (5’-3’) the Roche A linker (CCATCTCATCCCTGCGTGTCTCCGACTCAG), an 8-10 bp barcode, and the forward primer pnp349F for pnpA and mar349BF for mar gene fragment amplification (Table 2.3). The reverse fusion primer was constructed with (5’-3’) a
biotin molecule, the Roche B linker
(CCTATCCCCTGTGTGCCTTGGCAGTCTCAG), and the primer pnp635R for
pnpA and mar715AR for mar gene fragment amplification (Table 2.3). Amplifications were performed in 25 μL reactions with Qiagen HotStart Taq master mix (Qiagen Inc, Valencia, California), 1 μL of each 5 μM primer, and 1 μL of template. Reactions were performed on ABI Veriti thermocyclers (Applied Biosytems, Carlsbad, California) under the following thermal profile; 95 ˚C for 5 minutes, then 35 cycles of 94 ˚C for 30 seconds, 54 ˚C for 40 seconds, 72 ˚C for 1 minute, followed by one cycle of 72 ˚C for 10 minutes and a 4 ˚C hold.
Amplification products were visualized with eGels (Life Technologies, Grand Island, New York). Products were then pooled equimolar and each pool was cleaned with Diffinity RapidTip (Diffinity Genomics, West Henrietta, New York), and size selected using Agencourt AMPure XP (BeckmanCoulter, Indianapolis, Indiana) following Roche 454 protocols (454 Life Sciences, Branford, Connecticut). Size selected pools were then quantified and 150 ng of DNA were hybridized to Dynabeads M-270 (Life Technologies) to create single stranded DNA following Roche 454 protocols (454 Life Sciences). Single stranded DNA was diluted and used in emPCR reactions, which were performed and subsequently enriched. Sequencing
81 following established manufacture protocols (454 Life Sciences) using Roche 454 FLX instrument with Titanium reagents, titanium procedures performed at the Research and Testing Laboratory (Lubbock, TX) (RTL, 2012).