PRONUNCIAMIENTOS DEL IIA

mellifera colonies in Ireland

2.10.1 Preparation of RNase free buffers and equipment

All glassware and all pestles and mortars were baked at 220°C for 12 hours prior to use to reduce contamination by RNases. Diethyl pyrocarbonate (DEPC) is a strong inhibitor of RNases and was used at a concentration of 0.1% (v/v) to treat water, which was left stirring overnight followed by incubation at 37°C for a minimum of 4 hours prior to sterilization by autoclaving. This DEPC-treated water was used in the preparation of all buffers needed for RNA extraction. All bottle lids, O-rings and magnetic stirrers were soaked overnight in DEPC water and autoclaved before use. All chemicals were weighed without the use of a spatula. Gloves were worn at all times and changed regularly. Pipette tips and tubes were taken from freshly

and all pipettes, eppendorf racks etc that were used were cleaned with RNase Zap (Ambion) before use.

2.8.2 RNA extraction for A. mellifera samples

2.8.2(a) Sample Set 1 and 2 (Spring 2014 and Summer 2014)

Approximately 30 bees were placed in a nuclease free pestle and mortar and crushed into a fine powder using liquid nitrogen. To this, 5 mL TRI®-Reagent was added, mixed thoroughly, and left to defrost at room temperature. Four mls of the homogenate was collected and placed in sterile 1.5 mL eppendorf tubes and centrifuged at 12,000 g for 10 minutes. The pellets were discarded and the supernatants collected in a new tube.

Chloroform (200 µL-molecular grade) was added and mixed vigorously by vortexing. The solution was allowed to stand at room temperature for 10 minutes and centrifuged at 12,000 g for 10 minutes at 4°C. The top clear layer was collected and placed in a new tube and 500 µL of 2-propanol (molecular grade) was added. The tube was inverted several times, left to stand for 10 minutes and centrifuged at 12,000 g for 10 minutes at 4°C. The supernatant was discarded and the resulting pellet was washed in 75% (v/v) ethanol (50 µL, molecular grade) and centrifuged at 12,000 g for 10 minutes at 4°C.

Supernatant was removed completely and the resulting pellet was air-dried and re-suspended in RNase-free water, aliquoted and stored at -70°C or used immediately.

2.8.2(b) Sample Set 3 (Autumn 2014)

A larger samples size of approximately 60 bees was taken for the third sample set in Autumn 2014 to increase the chance of detecting the less prevalent viruses. Bees were crushed in sterile pestle and mortars as before, in the presence of liquid nitrogen, and homogenised in 10 mM Tris-400 mM NaCl buffer (pH 7.5). Samples were spun at 5000 g for 15mins, after which an aliquot of 400μl was removed to a nuclease free eppendorf and mixed with

400μl of lysis buffer from NucleoSpin^® RNA extraction kit (Macherey-Nagel).

Samples were passed through a sterile 23g needle approximately 20 times to ensure complete homogenization of the sample, in order to prevent blockage of the Nucleospin filter during the first spin step of the RNA extraction kit method. The remaining steps of the RNA extraction were then carried out according to manufacturer’s instructions, taking care to keep all equipment sterile and regularly changing gloves to avoid contamination. RNA was suspended in nuclease free water once isolated and either carried forward for immediate cDNA synthesis or frozen at -70⁰C until future use.

2.9.3 RNA gel electrophoresis method and preparation

Prior to use, the gel rig and tank were washed with 0.5% (w/v) SDS, rinsed with DEPC-treated water followed by ethanol and allowed to air dry. A 1% (w/v) agarose gel was prepared (1g agarose, 10 ml 10X FA buffer (200 mM 3-[N-morpholino]propanesulfonic acid (MOPS), 50 mM sodium acetate, 10 mM EDTA, pH 7) and DEPC water to make 100 mL). The mixture was heated until dissolved and allowed to cool to hand-hot. One point eight millilitres of 37% (v/v) formaldehyde plus 1 µL of a 10-mg/mL ethidium bromide solution was added prior to pouring the gel. Prior to running, the gel was equilibrated in 1X FA running buffer for at least 30 minutes. RNA (4 µL) was added to 4 µL of 5X RNA gel loading dye; stock: 500 mM EDTA (80 µL, pH 8), 37% (v/v) formaldehyde (720 µL), glycerol (2 mL), formamide (3.084 mL), 10X FA buffer (4 mL) and 16 µL saturated aqueous bromophenol blue solution), were heated to 65°C for 5 minutes and chilled on ice. Samples were loaded into the wells of the gel and run at 6 V/cm in 1X FA buffer. The gel was visualised using UV light (Figure 2.8).

Virus Primer Sequence Amplicon length (bp)

Reference

DWV 5’ - GGTCCGCGGCTAAGATTGTA - ‘3 420 (Cox-foster et., 2007)

5’ - CGGCTGTTTGATGGAAGAAGTT - ‘3

CBPV 5'-TCAGACACCGAATCTGATTATTG-3' 570 (Blanchard et., 2008)

5'-ACTACTAGAAACTCGTCGCTTCG-3'

ABPV 5’ - CATATTGGCGAGCCACTATG - ‘3 398 (Cox-foster et., 2007) 5’ - CCACTTCCACACAACTATCG - ‘3

IAPV 5’ - CGATGAACAACGGAAGGTTT - ‘3 767 (Cox-foster et., 2007) 5’ - ATCGGCTAAGGGGTTTGTTT - ‘3

Table 2.4: Primers used for the uniplex PCR reactions to detect for the four honeybee viruses in all of the samples.

Figure 2.8: RNA gel image under UV light.

RNA gel showing electrophoresis results of four lanes of total RNA extracted from four A. mellifera samples to check for the quality of RNA.

1000bp 600bp 400bp 200bp

Lane no. 1 2 3 4 5

2.9.4 cDNA synthesis from total extracted RNA

cDNA was synthesised using the Superscript III First-Strand Synthesis System for RT-PCR kit from Invitrogen (CA, USA). RNA concentration was determined and all samples contained equal amounts of RNA prior to cDNA synthesis. RNA was added to an RNase and DNase-free tube and RNase-free water was added to bring the volume up to 8 µL. To this, 1 µL of 10 mM dNTP mix (provided) and 1 µL of 50 µM oligo (dT) (provided) were added.

The solution was incubated at 65°C for 5 minutes, and placed on ice for at least 1 minute. A master mix was prepared (Per reaction: 2 µL 10X RT buffer (supplied), 4 µL 25 mM MgCl₂, 2 µL 0.1 M DTT, 1µL RNaseOUT (supplied) according to the number of reactions needed. Master mix (9 µL) was added to each of the RNA/primer mixes, mixed gently, incubated at 42°C for 2 minutes and held on ice. One microlitre of SuperScript III RT (200 U/µL, supplied) was added to each reaction tube and incubated as follows: 42°C for 50 minutes, 70°C for 5 minutes and held on ice. One microlitre of RNaseH (supplied) was added to each tube and further incubated at 37°C for 20 minutes. cDNA was aliquoted and stored at -20°C.

2.9.5 PCR protocol and product visualization for the four bee viruses

PCR amplification was carried out using four separate reactions for each sample, for each of the four viruses: Deformed Wing Virus (DWV), Acute Bee Paralysis Virus (ABPV), Chronic Bee Paralysis Virus (CBPV), and Isreali Acute Paralysis Virus (IAPV). The Primers were dissolved in molecular grade water to give a stock solution of 100 µM initially, which was diluted to a working solution of 10 µM (See table 2.4 for primer sequences). Five microliters of cDNA was added to MyTaq (Bioline) PCR master mix, 10μl nuclease free H₂0, 1μl 10μM Forward primer, 1μl 10μM reverse primer and 0.2μl Mytaq Taq polymerase (Bioline) in a 200μl nuclease free PCR tube and mixed. PCR reaction was carried out in a Techne Flexigene thermocycler by initial denaturation at 95^oC 5 minutes, followed by 35 cycles of 95^oC for 30 seconds, annealing at 51^oC for 30 seconds, extension at 72^oC for 30 seconds, followed by a final 5 minute extension at 72^oC. The positive control used

ANSES Sophia Antipolis laboratory, and a negative control, which contained water instead of cDNA. A positive band was only considered to be a true positive if the positive standard also showed as positive and if the negative sample remained blank.