CAPÍTULO II MARCO TEÓRICO
RELACIONES INTERPERSONALES
4.5. Prueba de Hipótesis
Summary
This section describes molecular biological methods, protein expression, purification, crystallisation and Isothermal Titration Calorimetry (ITC) of AGME and the AGME mutant Y140F.
2.4 Molecular biology
2.4.1 Sub-cloning of
hldDinto pEHISTEV
The hldD gene (UniProtKB/TrEMBL entry P67910) from E. coli K-12 W3110
comprising 933 bp, cloned into the pET-30Xa/LIC vector (Novagen) (see Appendix) (Morrison et al., 2005) was provided by our collaborators Martin Tanner and James Morrison from the University of British Columbia, Vancouver, Canada.
A design of forward and reverse primers was carried out to add the appropriate
restriction endonuclease cleavage sites. This is necessary to clone hldD into the
expression plasmid pEHISTEV (see Appendix) (Liu and Naismith, 2009).
An NcoI site was introduced at the start of hldD (forward primer 5’ –
GAGGGTCCCATGGTCATCGTTACC – 3’). Right at the end of the open reading
frame, after the stop codon, an XhoI site was incorporated (reverse primer 5’ –
GGAGAGCTCGAGCCTTATGCGTC – 3’). A Polymerase Chain Reaction (PCR)
was performed using 1μM of each oligonucleotide and 1.5 U of Pfu DNA polymerase (Promega) (Table 12).
Table 12. Details of the PCR reaction for the amplification ofhldD. The reaction was carried out in the GeneAmp® PCR
System 2400 thermal cycler (Applied Biosystems)
Reagent Amount/concentration of stock solution final concentration/ PCR programme
sterile H2O 38.5 μl amount
2 min, 95 ºC
Pfu buffer 5 μl 10x 1 x 30 sec, 95 ºC
(+MgSO4) 30x 30 sec, 55 ºC dNTP Mix 1 μl 10 mM 0.2 mM 2 min/kb, 72 ºC (dATP,dTTP, 10 min, 72 ºC dGTP,dCTP) forward primer 1 μl 50 μM 1μM reverse primer 1 μl 50 μM 1μM template DNA 3 μl 89 ng/μl 267 ng Pfu DNA 0.5 μl 3 U/μl 1.5 U
Polymerase
1
2
Figure 51. PCR product ofhldDfrom pET-30 Xa/LIC. Lane 1: 1 kbp ladder; lane 2: amplified 956 bp PCR product
The amplified hldD fragment was excised from the 1 % agarose gel according to the
protocol provided in the QIAquickTM Gel Extraction Kit (Qiagen). 50 μl sterile water
was used to elute the DNA from the spin column. Then a restriction digest of eluted
amplified hldD and the pEHISTEV plasmid (provided by Huanting Liu) using NcoI
andXhoI (New England BioLabs® Inc.) was performed in a water bath for 3.5 hours
at 37 ºC (Table 13).
Table 13. Reagents used in the restriction digest of amplified hldD and pEHISTEV
Reaction 1: Reaction 2:
2μl buffer D (10x) 2 μl buffer D (10x)
0.2μl acetylated BSA (10 μg/ml) 0.2 μl acetylated BSA (10 μg/ml)
15 μl amplified hldD 15 μl pEHISTEV 1.8 μl H2O 1.8 μl H2O 0.5 μl NcoI 0.5 μl NcoI 0.5 μl XhoI 0.5 μl XhoI
1500 bp
1000 bp
1500 bp
1000 bp
The double digested gene and vector as well were then solution cleaned, following the
protocol provided in the QIAquickTM Gel Extraction Kit (Qiagen) to remove the
restriction endonucleases and buffers. Ligating thehldDfragment into the pEHISTEV
vector, which contains a kanamycin resistance marker was the next step. Ligation was carried out overnight at 4 ºC with 3U of T4 DNA Ligase (Promega) using an insert to
vector ratio of 3 : 1. TAM1 and JM109 competentE. coli cells were then transformed
with the ligation mixture and plated onto agar plates containing 50 μg/ml kanamycin (Melford). Amplification reactions with the T7 forward and reverse primers were carried out for the identification of the colonies with the pEHISTEV plasmid and the
insertedhldDgene. Colonies were picked from a kanamycin containing agar plate and
suspended in 10 μl sterile water filled into PCR tubes. The samples were then boiled for 5 min at 100 ºC and centrifuged. After that 5μl of sample were taken out of each of the tubes and transferred to sterile ones. The amplification reactions were performed using 0.5 μM of each oligonucleotide and 1.36 U of GoTaq® DNA-Polymerase (Promega) (Table 14).
Table 14. Details of the PCR reactions for the amplification ofhldDcloned into pEHISTEV. Reactions were carried out in
the GeneAmp® PCR System 2400 thermal cycler (Applied Biosystems)
“Master Mix” for 25 reactions
Reagent Amount/concentration of stock solution final concentration/ PCR programme
sterile H2O 139.1 μl
GoTaq® DNA 1.9 μl 5 U/μl 1.36 U 2 min, 95 ºC
Polymerase 20 sec, 95 ºC
GoTaq® Green 70 μl 5x 1x 30x 50 sec, 46 ºC
Reaction Buffer 1 min, 72 ºC
dNTP Mix 7 μl 10 mM 0.2 mM 5 min, 72 ºC (dATP,dTTP,
dGTP,dCTP)
T7 forward primer 3.5 μl 50 μM 0.5 μM T7 reverse primer 3.5 μl 50 μM 0.5 μM
9 μl of “Master Mix” were added to each of the 22 PCR tubes
Of 22 colonies screened 3 were confirmed as containing the 1 kb hldD fragment
(“clones 1, 2 and 3”). Restriction analysis and DNA sequencing (University of
Dundee Sequencing service) were also carried out to identify the presence of thehldD
Table 15. Reagents used in the restriction digest
Reaction 1: Reaction 2: Reaction 3:
1μl buffer D (10x) 1 μl buffer D (10x) 1 μl buffer D (10x)
0.1μl acetylated BSA (10 μg/ml) 0.1 μl acetylated BSA (10 μg/ml) 0.1 μl acetylated BSA (10 μg/ml)
5 μl “clone 1” 5 μl “clone 2” 5 μl “clone 3” 1.9 μl H2O 1.9 μl H2O 1.9 μl H2O
1 μl NcoI 1 μl NcoI 1 μl NcoI
1 μl XhoI 1 μl XhoI 1 μl XhoI
1
2
3
4
Figure 52. Restriction analysis withNcoI andXhoI confirming the insertion ofhldDinto pEHISTEV.
Lane 1: “clone 1” : lane 2: “clone 2”; lane 3: “clone 3”; lane 4: 1 kbp DNA ladder
ThehldDgene was sequenced to make sure that no nucleotide substitutions had been
introduced. The hldD-pEHISTEV construct was purified from 10 ml overnight
cultures of the TAM1 or JM109 transformedE. colicells grown in Luria-Bertani (LB)
media (Formedium) containing 50 μg/ml kanamycin at 37 ºC. The plasmid DNA was then purified according to the QIAprep Spin Miniprep Kit Protocol using a microcentrifuge (Qiagen).