Capítulo II Del Poder Legislativo
Artículo 78. Durante los recesos del Congreso de la Unión habrá una Comisión Permanente
In this study, genomic DNA for EPSPS enzyme (in chapter one) and mRNA levels for all main enzymes in AAA and BCAA pathway (in chapters two and three) were determined.
MM. 2.2.1 EPSPS relative genomic copy number
This data, determined in chapter one, was used in the three chapters, as a reference mean value of EPSPS relative genomic copy number of GR population. Quantitative realtime PCR was performed to determine the EPSPS genomic copy number relative to AHAS in untreated GS and GR plants.
Genomic DNA was extracted from approximately 0.1 g of previously ground A. palmeri leaves. The plant material was homogenized in 375 μL of 2× lysis buffer (0.6 M NaCl, 0.1 M Tris-HCl (pH 8.0), 40 mM Ethylendiaminetetraacetic acid (EDTA) (pH 8.0), 4% sarcosyl, and 1% sodium dodecyl sulfate (SDS)) and 375 μL of 2 M urea. One volume (750 μL) of phenol/chloroform/isoamyl alcohol (25:24:1) was added to the mixture and mixed briefly. The homogenates were centrifuged at 20,000 g for 10 min at room temperature. To precipitate the DNA, 0.7 volume (525 μL) of cold
isopropanol was added to the supernatants, and the tubes were centrifuged at 20,000 g for 15 min at 4 °C. The DNA pellet was washed twice with 1 mL of 70% ethanol, air-dried, and resuspended in 25 μL of resuspension buffer (10 mM Tris-HCl (pH 8.0), containing 30 μg mL−1 RNase A). Samples were briefly incubated at 37 °C for 5 min to degrade contaminating RNAs.
The extracted DNA was quantified using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). OD 260 and 280 nm were read for every sample. The DNA quality was also checked using a 1% agarose gel. Ten-fold diluted DNA samples were loaded onto a 1% agarose gel and run at 75 mA for 35 min. The gels were visualized using a Gel Doc 2000 system (Bio-Rad Laboratories Inc., Hercules, CA, USA). DNA concentrations were adjusted to 5 ng μL−1. Quantitative real-time PCR was performed as in Gaines et al. (2010) with some modifications. The following primer sets were used: EPSPS forward (5′-atgttggacgctctcagaactcttggt-3′) and EPSPS reverse (5′-tgaatttcctccagcaacggcaa-3′); AHAS forward (5′ - gctgctgaaggctacgct-3′) and AHAS reverse (5′-gcgggactgagtcaagaagtg-3) specified in Gaines et al. (2010). To determine the efficiency of the primers, a standard curve using a 1 X, 1/5 X, 1/25 X, 1/125 X, and 1/500 X dilution series of genomic DNA from GR was conducted.
Real-time PCR amplifications were performed in an optical 96-well plate using an ABI PRISM 7900 HT Sequence Detection System (Applied Biosystems, Foster City, CA, USA). Each reaction was performed using 10 ng of genomic DNA in a total volume of 20 μL containing 1× SYBR Premix Ex Taq (Takara Bio Inc., Otsu, Shiga, Japan), 300 nM specific forward primer, and 300 nM specific reverse primer. The following thermal profile was used for all PCRs: 50 °C for 2 min, 95 °C for 1 min, and 40 cycles of (95 °C for 30 s and 60 °C for 1 min). To calculate the final Ct values, 10 biological replicates were performed, and each individual sample was run in triplicate. The average increase in EPSPS copy number relative to AHAS and the standard deviation were calculated for each sample. The increase in EPSPS copy number was expressed as 2∆Ct, where ∆Ct = (Ct, AHAS −Ct, EPSPS) (Gaines et al. 2010).
48
MM.2.2.2 Transcript levels
This parameter was determined in chapter two and three. A stay in Colorado State University (CSU) was carried out to obtain mRNA data for chapter two, and, with the procedure learned there and the primers designed, the determination was repeated for data of chapter three, to check the response of those enzymes to herbicide mixtures. This was the first time where mRNA levels of all the main enzymes of AAA and BCAA pathway were determined, in
A. palmeri, so all primers except EPSPS primer, were designed for the
experiment.
As A. palmeri was not sequenced, primers were designed using a near sequenced species of Amaranthaceous family, Amaranthus hypochondriacus. The data base of the genome of A. hypochondriacus was crossed with the one of Arabidopsis thaliana, which is sequenced and their genes were related with their function in The Arabidopsis Information Resource (TAIR) website. To cross genes of both species a variety of informatics tools were used. Notepad++® was used to manage the A. hypochondriacus genome, EMBOSS needle website to compare sequences, NCBI page to blast the nucleotides to proteins and to obtain the open reading frames (ORFs) A plasmid editor (APE®) software.
EPSPS primer was modified from Gaines et al. (2010). The protocol followed was the same for data in chapter two and three, although experiment in chapter two was developed in CSU and in chapter three in UPNA. RNA was extracted from leaf tissues using the Macherey-Nagel NucleoSpin® RNA Plant kit following manufacturer’s instructions. Total RNA concentration was measured with Gen 5.1.11 (Biotek Instruments, Inc., Winooski, VT, United States) and RNA quality was assessed using RNA gel electrophoresis. The gels were visualized using a Gel Doc 2000 system (BIORAD Laboratories Inc., Hercules, CA, USA).
cDNA (complementary deoxyribonucleic acid) extraction was performed using Biorad iScriptTM cDNA Synthesis Kit with 1 g of total RNA following manufacturer’s instructions. Each sample contained 4 L of 5x iScript reaction mix, 1 L of iScript reverse transcriptase and 15 L of nuclease-free water and RNA template, being this concentration calculated to obtain 1 g of
RNA per sample. The reaction protocol was 5 min at 25 ºC, 30 min at 42 ºC, 5 min at 85 ºC and hold at 4 ºC until their storage at -20 ºC.
GENE FORWARD REVERSE Annealing
temperature Efficiency
Aromatic amino acid biosynthetic pathway DAHPS cctcataggatgataagggc ctttgcatggcagcataacc 55 ºC 96 % DHQS gcattgttggctagggatcc aacctcggccttgttttcac 61 ºC 91 % DQSD ggtgtactcaagcaaggagc tgtggactcttactatggcc 57 ºC 84 % SK gattctgaagcacaaagcagc cagttgttttcccagagccc 55 ºC 91 % EPSPS aatgctaaaggaggccttcc tcaatctccacgtctccaag 61 ºC 93 % CS cttgatagaaggaggcctgg gtttctttcctaggagtagtg 57 ºC 90 % CM gaatacattatggcaagtatgt gtcataagtcgctccttgtc 52ºC 97 % AS tttggagggaaggttgtgcg ctggtgagctttttccatgc 57 ºC 88 %
Branched chain amino acid biosynthetic pathway AHAS cttcctcgacatgaacaagg attagtagcacctggacccg 57 ºC 84 % AHAIR atggctcagattgagatcttg ccacggcttcaatcacactc 52 ºC 90 % DHAD taccatggcatcagctatcg ggtgttgacgagctgtaagg 55 ºC 96 % TA gtgaagatgatcttcgtcggc tcacaatcagacttgaaagatg 52 ºC 99 %
Normalization gene
Beta
tubulin gatgccaagaacatgatgtg tccacaaagtaggaagagttc
55 ºC 90 %
Table MM 1 Primers of genes from aromatic amino acid (AAA) pathway enzyems: D-arabino-
heptulosonate 7-phosphate synthase (DAHPS), dehydroquinate synthase (DHQS), 3- dehydroquinate dehydratase/shikimate dehydrogenase (DQ/SD), shikimate kinase (SK), 5- enolpyruvylshikimate 3-phosphate synthase (EPSPS), chorismate synthase (CS), chorismate mutase (CM) and anthranilate synthase (AS), branched-chain amino acid (BCAA) pathway: Acetohydroxy acid synthase (AHAS), acetohydroxyacid isomerreductase (AHAIR), dihydroxyacid dehydratase (DHAD) and BCAA transaminase (TA) and normalization gene selected for this study. For each primer is shown the anealing temperature and the efficiency.
Quantitative RT-PCR (qRT-PCR) was performed using a Thermocycler Biorad CFX Connect TM Real-Time System (Biorad Laboratories Inc., Hercules, CA, USA). The reaction kit used for qPCR was PerfeCTa SYBR® Green SuperMix (Quantabio, Beverly, MA, United States). Each reaction was performed using 1 L of cDNA template, 10 L of Perfecta SYBR green supermix (2x), 1 L of a solution with forward and reverse primers (10 Mol for
50
primer forward and another 10 Mol for primer reverse) in nuclease-free water and 8 L of nuclease-free water. The following thermal profile was used for all PCRs: denaturation at 95ºC for 2 min, 40 cycles of 95 ºC for 15 s and 52–61ºC for annealing and extension for 20 s. Optimal annealing temperature for each primer was determined using gradient PCR. All primers and annealing temperatures are listed in table MM.1. EPSPS primer was modified from Gaines et al. (2010). Melting curve analysis was conducted to verify amplification of single PCR products.
Gene expression was monitored in five biological replicates. Relative transcript level was calculated as in previous protocols: EGOICPGOI control- CPGOItreated/EREFCPREF control-CPREF treated (Pfaffl 2001), where GOI = gene of interest,
REF = reference gene (beta tubulin was used as normalization gene), and CP = crossing point, the cycle at which fluorescence from amplification exceeded the background fluorescence. In chapter two, values of all treatments in both populations were calculated respect to GS mean control, but in chapter three it was decided to calculate the GR values respect to their own control.