2.3.1 Sample collection
Soils were collected in July 2009 from fields in the three main potato producing regions of New Zealand, two from Canterbury (research field, Lincoln and commercial field,
Southbridge), one from Auckland (research field, Pukekohe) and one from Manawatu
(research field). Details of the four soils collected are presented in Table 2.1. Soil was stored at 8°C in plastic bins prior to experiments. Tubers were also collected from the Lincoln and Southbridge sites, as well as potato plants from a Christchurch home garden, for isolations. Soil pH (Table 2.1) was determined by suspending 10 g of air-dried soil in 25 mL of
Nanopure® water (10 min on an orbital shaker at 225 rpm, room temperature) then left to
stand overnight before pH was measured (pH Benchtop Meter 2210, Hanna® Instruments).
Table 2.1 Details of soil sample collected for isolation of microorganisms Soil
location pH Local classification Soil taxonomy+ Field cultivation history
Lincoln 6.15 Whakanui silt loam Aquic Haplustepts 3×Potato>Oat
Southbridge 5.25 Waimakariri sandy loam Typic Ustorthents Pumpkin>Potato
Pukekohe 6.28 Patumahoe mottled clay loam Typic Haplohumuls 6×Potato
Manawatu 5.70 Kairanga silt loam Humic Endoaquepts 2×Potato>Pasture
+Classified according to the USDA Soil Survey Staff (2010).
2.3.2 Selective Isolations of candidate microorganisms
Selected microbes were obtained from soil samples and plant tissues as detailed in the following sections.
2.3.2.1 Soil dilutions
Soil samples were mixed thoroughly, then 10 g sub-samples were each combined with 90 mL sterile water agar (0.01% agar) and shaken for 5 min on an arm shaker (500 osc/min) to create
a 0.1 g mL-1 soil suspension. To recover endospore-forming bacteria (of which Bacillus spp.
are members), 5 mL aliquots of soil suspensions were transferred to sterile 18 mL capacity universal bottles and placed in an 80°C water bath for 20 min (Priest, 1989). Aliquots (50 µL) of heat-treated samples were spread onto nutrient agar (Appendix A.1.2) and incubated (25°C, darkness) until discrete colonies formed. Colonies were purified by repeated sub-culturing.
Suspended soil samples were also each serially diluted to 1×10-5 g/mL in water agar. Aliquots
(200 µL) of 1×10-4 and 1×10-5 dilutions were spread onto Kings Medium ‘B’ (Appendix
A.1.3) and Trichoderma selective medium (TSM, Appendix A.1.4) in Petri plates, and
incubated at 25°C in darkness until discrete colonies formed. Colonies on Kings Medium ‘B’ fluorescing under UV light (366 nm) were sub-cultured to purify fluorescent Pseudomonads
(Braun-Kiewnick and Sands, 2001). Fungal colonies on TSM with Trichoderma spp.
morphology (Barnett and Hunter, 1998, p. 92) were sub-cultured onto Petri plates containing potato dextrose agar (PDA, Appendix A.1.1). These plates were sealed with plastic film
(GLAD®) and left on a benchtop at ambient temperature and light conditions to sporulate.
Isolates were purified by plating diluted spore suspensions (from sporulating colonies,
suspended and diluted in sterile tap water) onto PDA and sub-culturing single-spore colonies. 2.3.2.2 Potato plant tissues
Isolations were carried out from potato tubers and plants collected from field sites (Lincoln, Southbridge and a Christchurch home garden) and from the microbe ‘baiting trial’ (section
2.3.2.3). Roots, below-ground stems, stolons and tubers were first washed free of excess soil in tap water. A portion of each tissue was transferred to an 18 mL capacity universal bottle with 10 mL of sterile tap water, and placed in an 80°C water bath for 20 min. Both heat- treated and non-treated tissues were divided into two, with one half receiving surface
sterilisation (1 min in 2% sodium hypochlorite solution then rinsed twice in sterile water). All tissue samples were each separately macerated in a few drops of sterile water and portions of
non-heat treated macerated tissue were transferred to TSM for selection of Trichoderma spp.
(as in 2.3.2.1). A sterile loop was used to spread macerated tissue fluid from each heat-treated sample onto nutrient agar, and from each non-heat treated sample onto Kings Medium ‘B’, with endospore-forming bacteria and fluorescent Pseudomonads selected and purified as detailed in section 2.3.2.1.
2.3.2.3 ‘Baiting’ isolates from soil
An experiment was established to ‘bait’ organisms from collected soils. Soils were mixed 1:1 (v/v) with quartz sand and 4 L planter bags filled with this plant growth medium. Certified seed potato tubers (cv. ‘Ilam Hardy’) were planted one per bag, and bags arranged in a greenhouse in a randomised block experimental design and watered as required. At
experiment set-up, selective isolations as detailed above were made from each collected soil (detailed in Table 2.1). Three harvests were conducted on the resulting potato plants, at 29, 39 and 58 days after planting. At each harvest, one plant was taken per soil type and excess soil shaken free from roots, which were then rinsed with tap water. Isolations (as detailed above) were made from roots, stems and stolons/tuber initials of each plant, both untreated and surface sterilised. Up to four isolates for each tissue sample were sub-cultured and purified from each selective medium.
2.3.2.4 Long-term storage of isolates
Bacterial stock cultures were created by culturing isolates in Luria Bertani Broth (LB,
Appendix A.1.6, 5 mL in 18 mL capacity universal bottles, each loop-inoculated from a pure agar culture, incubated overnight at 25°C in an orbital shaker at 180 rpm), and then
combining 500 µL of culture with the same volume of a sterile 50% glycerol solution in a
cryotube. Trichoderma sp. isolates were maintained on minimal agar (Appendix A.1.7) slopes
at 4°C, each inoculated with a plug of mycelium from the growing edge of a pure colony on
agar, and incubated at 25°C for 2 days prior to refrigeration. Trichoderma sp. isolates were
also stored as conidia in 25% glycerol by harvesting spores in sterile water from pure colonies grown on PDA for 10 days, and combining 500 µL of the spore suspension with 500 µL of sterile 50% glycerol solution in a cryotube. All cultures in cryotubes were stored at -80°C.
2.3.2.5 Additional Trichoderma sp. isolates
The total number of Trichoderma sp. isolates recovered from samples was low (Table 2.2), so
their numbers were supplemented with 104 previously isolated Trichoderma spp. isolates
from the Pukekohe field soil sample site (Bio-Protection Culture Collection, Lincoln
University). These Trichoderma spp. were isolated from potato plant rhizosophere soil
dilutions, from a mixed crop rotation (potato-onion-oats-brassica-potato) of five growing seasons.
2.3.3 Dual plate assays
Each isolate from the soil dilutions and bait trial was tested in vitro for interactions with two
R. solani isolates pathogenic to potato, R73-13b (Anastimosis Group (AG) 3, Bio-Protection
Culture Collection, Lincoln (Sneh et al., 2004)) and Rs043-2 (AG 2-1, received from Dr
Farhat Shah, Plant and Food Research Ltd., Lincoln). The AGs were determined by ITS
sequence analysis performed by Plant and Food Research Ltd., Lincoln. Rhizoctonia solani
isolates were maintained as refrigerated cultures on minimal agar, as detailed in section 2.3.2.4. Bacterial isolates were each inoculated from -80°C stock cultures onto nutrient agar and incubated for 2 days (25°C, darkness), then point inoculated four times around the margin of a Petri plate containing ¼ strength PDA (Appendix A.1.5). Plates were incubated for 24 h (25°C, darkness). Full strength PDA plates were inoculated with agar plugs from refrigerated R. solani or Trichoderma sp. cultures and incubated (25°C, darkness) for 5 days prior to dual
plate assay initiation. For bacterial assays, agar plugs (7 mm diam.) from R. solani hyphal
colony margins were placed (mycelia side to agar) at the plate centre, as in Figure 2.1. Agar plugs (7 mm diam.) of fungal test isolates from the growing margins of a mycelial colonies
were placed (mycelia side to agar) 70 mm from an R. solani mycelia plug as detailed in
Figure 2.1. Duplicate plates were inoculated for each interaction, and plates were sealed with
plastic film (GLAD®) and incubated (25°C, darkness). Dual plate interactions were scored
between 3 to 7 days after inoculation, once colony interactions were observed. The
interactions between R. solani and test isolate colonies were characterised using the method
described by Ghaffar (1969), into four categories; A, the microbe colonies intermingle but remain clearly distinguishable (due to morphological differences); B, the growing margins of
the colonies meet, and R. solani is inhibited and becomes overgrown by the test microbe; C,
the colony margins of both organisms come close and then both stop growing; D, the growth of one of the organisms is inhibited at a distance, leaving a clear inhibition zone. Where inhibition zones are observed, the distance between organisms was recorded. Examples of the four dual agar plate interaction types are shown in Figure 2.2.
)LJXUH 'LDJUDP RILQRFXODWLRQ SRVLWLRQVIRU GXDO DJDUSODWHDVVD\RI5KL]RFWRQLD
VRODQLDJDLQVWDEDFWHULDO DQG EIXQJDO LVRODWHV
)LJXUH ([DPSOHV RIWKHIRXU GXDO DJDUSODWHLQWHUDFWLRQ FDWHJRULHV$%&DQG'DV
Since in vitro production of antibiotics and other inhibitory compounds by bacteria correlates
(within limits) with in vivo suppression of plant pathogenic Rhizoconia spp. (Homma, 1996),
an in vitro suppression scale was created so that the bacterial dual plate interaction data could be statistically analysed for the soil dilution and bait trial isolation samples (for which far more fluorescent Pseudomonads and endospore-forming bacteria were isolated than Trichoderma spp. (Table 2.2)). The 0 to 5 in vitro suppression scale was based on the assigned interaction categories: Interactions of type A = score 0, B = score 2, C = score 1, D with inhibition zone < 1 mm = score 3, D with inhibition zone > 1 but < 3 mm = score 4 and D with inhibition zone > 3 mm = score 5. An average dual plate score was generated for each R. solani isolate/test bacterium interaction, and these data were subjected to unbalanced analysis of variance, with soil location, harvest time, plant tissue type, surface sterilisation,
selective procedure and R. solani isolate as factors.
2.3.4 Identification of bacteria
DNA was extracted from each bacterial isolate cultured on nutrient agar and amplified using
the REDExtract-N-AmpTM Plant PCR kit (Sigma-Aldrich®) as per manufacturer’s
instructions. Primers targeted the variable portion of the 16S rRNA gene (F27 5'
AGAGTTTGATCCTGGCTCAG 3', R1494 5' CTACGGTTACCTTGTTACGAC 3'). PCR parameters were: 94°C for 3 min followed by 30 cycles of; 94°C for 1 min; 57°C for 1 min; 72°C for 2 min then 10 min at 72°C. PCR was performed using an Icycler (Bio-Rad
Laboratories, Inc.) and products were visualised by agarose gel (1%, 1 x TAE) electrophoresis. Sequencing was performed using Big Dye Terminator v3.1 (Applied
Biosystems™) and PCR cleanup with CleanSEQ® (Agencourt Bioscience Co.). An ABI Prism
3130xl Genetic Analyzer (Applied Biosystems™) was used to generate sequences. Sequences were analysed using Sequencher 4.9 (Gene Codes Co.) software and identifications made
using EzTaxon2.1 (Chun et al., 2007).