E. Implicaciones de la articulación de un concepto de propiedad según la Constitución y no según el Código Civil
63. La referida tipificación de la propiedad como estructura dual, en cuyo interior conviven función social y utilidad individual, no sólo representa un giro
Cells were pelleted by centrifugation at 1000 x g and total protein extracted in cell lysis buffer containing 15 mM Hepes (pH 7.5), 250 mM NaCl, 0.5% NP-40, 10% Glycerol, and IX complete protease Inhibitor. The cell lysate was then sonicated for 10 min on high and centrifuged at 10,000 x g to remove cellular debris. The resulting supernatant was quantified using Bradford (Thermoscientific, Pierce). Approximately 30 pg of protein mixed with 2X sample buffer were loaded and ran on 10% SDS-PAGE with IX running buffer (50 mM Tris, 0.38 M Glycine, 0.1% w/v SDS) at 25 mA. After electrophoresis, the proteins were transferred (wet) onto nitrocellulose membrane (Amersham, BioSciences) in IX transfer buffer at 200 V for 1.5 hr. Antibodies used for protein detection in this study included TDP-43 (Buratti et al, 2001), Tubulin (Sigma) MADD (Abeam), anti-Page | 51
MDH1 (Abeam), anti-NAPlLl (Abeam) and anti-STAG2 (Cellular signalling technologies). Detection was conducted according to standard western blotting procedure using either secondary anti-rabbit or anti-mouse HRP conjugated antibodies and ECL (Amersham) for developing blots.
2.2.7. Electrophoretic-mobility sh ift Assays (EMSA)
A region of intronic MADD sequence, approximately 64 bp upstream of exon 31 (skipped exon) containing a stretch of TG-repeats (5’-GTGTGCTGTGT-3’) was chosen for band shift analysis following the observation that the minigene splicing profile was similar to that of the endogenous transcript. The DNA oligo was synthesised by Sigma, Life Science and radio-labelled using [y-32P] ATP and T4 polynucleotide kinase (New England Biolabs). Briefly, 5pl of DNA (100 ng/ pl) oligo, IX PNK buffer, 1 pl (10U/ pl) and 1 pl [y-32P] ATP (1000 pCi/ pl) were incubated for 1 hour at 37°C. The labelled oligo was then precipitated in three volumes ethanol and 3M NaAc at pH 5.2 for an hour on dry ice and subsequently washed with 70% ethanol. Following centrifugation, the air-dried pellet was re-suspended in 50 pl dH20 and 1 pl used in the binding reaction.
For the STAG2 3-exon minigene EMSA analysis, the cloned region was first divided into five separate fragments by PCR amplification with primers that contained a T7 promoter sequence (highlighted in bold on primer sequence) on the forward strand for each pair.
Primers used in the amplification of each fragment were as follows; STAG2 Fragment 1:
forward
5'-TACGTAATACGACTCACTATAGGCACGCAGGTAACATGGATGTTA-3’ and
reverse 5'-ATGGCATGCTGA-3’, Fragment 2: forward
5'-T ACG5'-T AA5'-T ACG AC5'-T C AC5'-T A5'-T AGGG5'-T A AG5'-TG AG AG5'-TGCC5'-T5'-T A5'-T5'-T-'3 and reverse
5'-A AG CT A AT AC A AT A-3’, Fragment 3: forward
5’-TACGTAATACGACTCACTATAGGTCTAACTGGTTTTCTTCCCTCAA-3’ and
reverse 5-GTGTACCAGGCATG-3’, Fragment 4: forward
5'-T ACG5'-T AA5'-T ACGAC5'-TC AC5'-TA5'-T AGGC5'-T G5'-TC ACG5'-TAG5'-TAGGCA5'-T5'-T G5'-TG5'-TGAG5'-TGA GTGCGCGCA-3’ and reverse 5'-GTGTACCAGGCATGCGCGCACT-3’, fragment 5:
forward 5'-T ACGT AAT ACG ACT C ACT AT AGG ATT AGGTACT G A AT G AATG A-3 ’ and reverse 5*- GAATTAAAGGTCAG-3’. PCR products obtained were then gel purified and used as templates for in vitro T7 (Stratagene) RNA transcription and labelling with [y- 32P] UTP (800Ci/mol) (Perkin Elmer). Transcribed RNA was treated with DNAse I (Roche) according to the manufacturer’s guidelines and purified on Nick columns (Amersham Pharmacia Biotech) according to the manufacturer’s instructions. The labelled RNAs were then ethanol precipitated as described previously and re-suspended in RNAse- free water.
Binding reactions containing labelled DNA oligos {MADD) or labelled RNA probes (STAG2) together with purified recombinant TDP-43 protein (300 ng) were performed in
IX binding buffer (10 mM NaCh, 10 mM Tris pH 8.0, 2 mM MgCh, 5% Glycerol and 1 mM DTT) for 10-20 min at room temperature prior to electrophoresis on a 6%
Polyacrylamide native gel at 100 V for 1.5 hours in 0.5X Tris borate/EDTA (TBE) buffer at 4°C. In the case of STAG2 EMSA analyses where transcribed RNA was used in the binding assay, RNAse inhibitor (Roche) was also added to the reaction. A pre-run of the gel (approximately 10-20 min) was performed before samples were loaded. Following electrophoresis, the gels were then dried on 3 MM Whatmann paper and exposed on a Cyclone™ Phosphor screen (Packard). In addition, cold competition binding analyses against a known positive binder (UG6) of TDP-43 were performed using 20-fold molar excess amounts of un-labelled MADD oligo, and un-labelled in vitro transcribed RNA for STAG2. Cold competitors were added 5 min prior to addition of labelled oligos or RNAs
and band shifts were analysed by electrophoresis under conditions described above.
Page | 53
2.2.7.I. Recombinant GST-TDP-43 purification
Purified recombinant TDP-43 expressed in BL21 bacterial cells was obtained using Glutathione S-Sepharose 4B beads (Pharmacia) elution. Briefly, 5 ml of previously transformed BL21 cells were inoculated into 100 ml LB with Ampicillin and left to grow for approximately 4 hours in a shaker. The culture was then induced with 1M IPTG (Isopropyl p-D-l-thiogalactopyranoside) and left to grow for another 4 hours. The cells were then harvested by pelleting at 4,000 rpm for 20 min and pellet re-suspended in lysis buffer (IX PBS and 0.01% Triton X-100) and sonicated. The supernatant following centrifugation was mixed with 0.5 ml of resin or slurry and incubated on shaker at 4°C for 1 hr 30 min. Resin washes were performed in lysis buffer and subsequent elution in reduced L-Glutathione (Sigma) according to the manufacturer’s guidelines.
22.7.2. RNA In-vitro transcription
Fragments used as templates for in vitro transcription were obtained by PCR amplification with primers containing T7 promoter sequence at the 5’ end to facilitate T7 polymerase transcription as described in section 4.2.7 above. Gel extracted PCR fragments were quantified and used as templates in the in vitro transcription reaction as follows: 1 pg of DNA, 4 pl of transcription buffer (Stratagene) NTP mix (15 mM each of ATP, CTP, GTP and 1.5 mM UTP), 100 mM DTT (Dithithreitol) and 0.5 pl T7 (50 U/pl) RNA polymerase were mixed briefly in a microfuge before adding 2 pl of [alpha-32P] UTP (1000 pCi/pl) (Perkin Elmer) in a final volume of 20.5 pl and incubated at 37°C for 2 hr. A DNAse I (Roche) digestion of DNA template was performed for 20 min prior to Nick Column purification and ethanol precipitation of transcribed RNA. In cases where ‘cold’ (un- labelled) RNA was transcribed, 5 mM UTP was added to the reaction instead of the radioactive isotope.
2.2.8. Mutagenesis and deletion constructs
Mutagenesis of the MADD intronic sequence (5’-GTGTGCTGTGT-3’) was performed using the Quik-change® Site-Directed mutagenesis kit according to the manufacturer’s guidelines. Two complimentary mutagenesis primers; MADD MUT Fwd: 5’-gggtggggctgtagctgggagaACAtAcCgCgaggggcaggggtggagcctgtgggc-3’ and MADD MUT Rev: 5 ’-gcccacaggctccacccctgcccctcGcGgT aTGTtctcccagctacagccccaccc-3 (mutated nucleotides in capital letters) were used in the mutagenesis PCR and mutated sequences confirmed by sanger sequencing. Similarly for STAG2, deletion of fragments three and five which were shown to bind to TDP-43 in the EMSA analysis was achieved by a deletion PCR using cycling conditions outlined in the Quik-change® manufacturer’s guidelines.
Primers used for the deletion PCRs consisted of STAG2 delta n3 forward 5’-
CT ATTGT ATT AGCTT CATC ATTTTCCATT-3 ’ and reverse
5'-A 5'-AT GG 5'-A5'-A 5'-A5'-AT G5'-AT G 5'-A 5'-AGCT 5'-A5'-AT 5'-AC 5'-A 5'-AT 5'-AG-3 ’ and ST5'-AG2 delta n5 forward 5'- TGAGTGAGTGCGCGCATGCCTGGTACACCATCATTTTCCATTATACTTGAATAT
AG-3’ reverse
5'-CTATATTCAAAGTATAATGGAAAATGATGGTGTACCAGGCATGCGCGCACTCA CTCA-3’. Subsequently, Dpnl digestion at 37°C was performed for all PCR products prior to transformation in DH5a E-Coli cells.
2.3. Im m unoflourescence in the TDP-43 cellular aggregation m odel
Construction of the TDP43-12XQ/N aggregation model has been described in detail in Budini et al. (2014). For immunofluorescence, cells were seeded onto 22x22 mm, glass cover slips in 35 mm dishes induced with tetracycline for 72 hr, fixed with 4% PFA, blocked with 2% BSA/PBS and incubated with primary antibodies. The primary antibodies used were anti-Flag (Sigma, F I804) and anti-TDP-43 (Protein Tech, 10782-2-AP).
Secondary antibodies: anti-mouse-AlexaFluor 594 (cat. A21203), anti-rabbit-AlexaFluor
Page | 55
488 (cat. A21200) and T0-PR03 dye (cat. T3605) were all purchased from Life Technologies. Cells were analyzed on a Zeiss LSM510 Metaconfocal microscope.
2.4. General procedures 2.4.1. Cell Culture M aintenance
All cell lines were plated in 10 cm culture dishes at concentrations of 6.0 x 105 and maintained in DMEM (Gibco) supplemented with 10% heat inactivated FBS, 1%
Pen/Strep in a 37°C with 5% CO2 atmosphere. Cells were passaged every 3 days at 80- 100% confluence. Experimental culture plates were seeded at concentrations of 5 x 105 in 35 mm dishes or six-well culture plates.
2.4.2. Agarose Gel Electrophoresis
Analysis of PCR products and DNA was performed on either 1 -2% Agarose gels stained with EtBr (0.5pg/ml) in IX TBE Buffer at 100 V. To estimate sizes a DNA ladder marker (Invitrogen) was loaded with each gel run alongside samples.The duration of the run was dependent on the type of analysis and length of fragments. DNA was visualised in a UV transilluminator and either printed or stored digitally.
2.4.2.1. Gel extraction
Gel extraction was performed following generation of inserts with PCR for sub-cloning purposes or in preparation for RNA transcription. DNA samples were electrophoresed in 1% Agarose stained with EtBr at 100 V. Following visualization with UV, the desired bands were excised from the gel and purified using the Eurogold gel extraction kit (Euroclone). Briefly, 600 pl of binding buffer (1 g/ml) was added to gel slices in a 1.5 ml microfuge tube and incubated at 55°C for 10 min with vortexing every 2 min. The mixture with the dissolved gel was then loaded onto the column and centrifuged at maximum speed for 1 min. Flow-through was discarded and column washed 2X with 700 pl wash buffer, with the flow-through discarded each time. Elution of DNA was performed using 30 pl
elution buffer and column centrifuged at maximum speed for 2 min. Recovered DNA was quantified by approximating the minimum amount of EtBr intercalated DNA multiplied by the number or pl loaded onto the gel.
2.4.3. Cloning 2.4.3.1. Competent cells
Competent DH5a Escherischia Coli (E.coli) cells were prepared according to the Calcium Chloride (CaCh) method described in Sambrook, Fritsch and Manniatis (1989). Briefly, a single colony of bacteria was inoculated in 5 ml Luria Broth (LB) and incubated in a 37°C shaker overnight. A 1/100 dilution, i.e. 1 ml of the of the overnight culture was inoculated in 100 ml LB using aseptic technique and left to grow for 2-3 hr in a 37°C shaker until mid-log phase i.e. optical density of LB at 600 nm was between 0.5 and 0.8. Optical density was determined using a spectrophotometer. The 100 ml LB containing bacteria was then poured into two separate 50 ml tubes and pelleted at 3,000 x g for 10 min at room temperature. The pellet was then re-suspended using 1 ml ice cold 100 mM CaCL and an extra 30 ml added before a second spin at 3,000 rpm for 10 min at 4°C. The pellet produced was re-suspended again in 1 ml CaCh and 50% glycerol and stored at -80°C in 200 pl aliquots.
2.4.3.2. Klenow-Kinase Reactions
Klenow-kinase reactions were used to prepare PCR products for blunt-ended ligation into the pUC vector. The Klenow fragment, a proteolytic product of E. Coli DNA Polyemerase I was used for removal of nucleotide overhangs introduced by the Taq Polymerase following PCR, whereas T4 Polynucleotide kinase was used to phosphorylate the 5’ends of the PCR products. First, PCR products were denatured at 98°C for 2 min, then 5 mM MgCh and Klenow fragment (2.5 U), 1 pl (5 mM) dNTPs were added and the mixture incubated at 37°C for precisely 15 min. Subsequently, a mixture containing EDTA (0.2 mM), ATP (1 Page | 57
mM), T4 polynucleotide kinase (10 U), and kinase buffer were added to the previous mixture, which was then incubated for a further 30 min at 37°C. Heat inactivation of enzymes was conducted at 65°C for 20 min.
2.4.3.3. Ligation reactions
Generation of recombinant plasmids was performed using T4 DNA ligase (Roche) in a ligation reaction as follows: 1 pl of vector (20 ng), X (calculated amount of insert), IX ligase buffer (Roche), 1 U of T4 DNA ligase and dH20 in a final volume of 30 pl incubated at 25°C or room temperature. In most cases, 15 pl of the ligation reaction was used to transform cells. The vector to insert ratio was calculated as 5:1 (insert/vector). T4 DNA ligase was used for both sticky and blunt end ligations. In some cases, vectors were treated with Calf-intestinal alkaline phosphatise (CIP) to reduce the number of false positives due to plasmid recirculation.
2.4.3.4. Bacteria transformation
Previously frozen competent cells were thawed quickly and placed on ice. Plasmid DNA was added to 60 pl of competent cells in a 1.5 ml microfuge tube and incubated on ice for 1 hr. Following the incubation, cells were heat shocked at 42°C for 90 sec and snap cooled on ice for another 90 sec. Antibiotic-free LB medium (60 pl) was subsequently added to the cells and incubated in a 37°C shaker for 30 min-1 hr. Subsequently, 200 pl of transfromed cells were plated in pre-warmed selective agar plates containing Ampicillin (50 pg/ml) and incubated overnight at 37°C.
2.4.3.5. Small-scale and large-scale plasmid preparations
In general, small (mini-prep) preparations were used to purify small volumes of up to 20 pg of high-copy plasmid DNA in volumes ranging between 50-100 pl, whereas higher concentrations and large volumes of plasmid DNA were purified using to large-scale
preparation methods. Mini-preps, were performed using the he Wizard® Plus SV miniprep kit according to the manufacturer’s guidelines (Promega) whereas large-scale (midi-preps) preparations were performed using the JETSTAR Plasmid Midi Kit (Genomed). For the midipreps inoculation of bacteria cells was performed in 50 ml LB with antibiotic. Purified plasmids obtained from the above preparations were either used in a restriction endocnuclease digest (to verify presence of insert) or in transient transfections (Midipreps) of cells.
2.4.3.6. Restriction enzymatic analysis
In this study, restriction digests were used for recombinant plasmid analysis. In each case the appropriate enzyme and its specific buffer were selected. The incubation temperatures for each enzyme as given by the manufacturer were adhered to including the use of additives such as BSA. In all cases 100 ng of plasmid DNA was digested and in a 20 pl reaction volume. Enzymes were obtained from New England Biolabs.
2.4.4. General Reugenis and Chemicals
-PBS: 137 mM NaCl, 2.7 mM KC1, 10 mM Na2HP04, 1.8 mM KH2PO4, pH 7.4 -10X TBE: 108 g/1 Tris , 55 g/1 Boric Acid, 9.5g/l EDTA
-5X Loading dye: lOOg Sucrose, 48g Urea, lOOmL TBE, 1% Bromophenol blue in 200 mL final volume
-10X Transfer buffer: 30g Tris, 144g Glycine, ; 1X= 1/10 Dilution + 20 mL Methanol in 1 L final volume
-4X SDS Protein loading buffer: 0.2 M Tris pH 6.8, 40% Glycerol, 0.8% Beta- mercaptoethanol, 0.4% Bromophenol blue, 8% SDS in a final volume of 10 mL
-20X SSC (pH 7): 175.3 g NaCl, 88.2 g Tris Sodium Citrate in final volume of 1 L
-10X MOPS: 0.2 M MOPS (3-(N-morpholino)propanesulfonic acid), 0.01 M EDTA pH 8.0, 0.05 M Sodium Acetate (NaAc).
Page | 59
-Colloidal: 600 mL dH20, 100 g NH4SO4, 70 mL Phosphoric Acid, 1.2 g Coomassie Brilliant blue G-250 in a final volume of 1 L.
3. RESULTS
3.1. Analyses and validation o f TDP-43 dependent differential protein expression using 2-Dim ensional gel electrophoreses.
High throughput analyses of cellular processes have gained considerable momentum in the advent of the ‘omics’ era, enabling a more global view of changes within cells under various conditions. An example of such a method that offers a global analytical view of changes in protein expression under different conditions is 2-Dimensional (2-DE) gel electrophoresis. In this study, 2-DE was utilised to determine global protein expression changes that were dependent on the levels of expression of TDP-43, including its RNA binding capacity. The exact set-up of the experiments for 2-DE analyses has been described in section 2.1 of materials and methods. The cells used for this analysis consisted of previously constructed HEK 293 stable cell lines (described in introduction section 1.6.1), which could inducibly express wild-type or mutant transgenic TDP-43. Four triplicate groups of cells representing different cellular conditions were analysed. Group (A) HEK 293 Flp-In T-Rex cells expressing physiological levels of TDP-43 (siLuciferase treatment), group (B) HEK 293 Flp-In T-Rex cells depleted of endogenous TDP-43 (siTDP-43 treatment), Group (C) HEK 293 Flp-In-T-Rex cells depleted of endogenous TDP-43 with simultaneous tetracycline-induced expression of wild type FLAG-TDP-43, and lastly, group (D) HEK 293 Flpln-T Rex cells depleted of endogenous TDP-43 with simultaneous tetracycline-induced expression of mutant (F4L: 4 Phenylalanines mutated) FLAG-TDP-43, that is unable to bind RNA. The western blot confirmation of the various levels TDP-43 can be seen in Figure 3-1.
Page (61
T DP -4 3 d e p l e t e d cells W ild - t y p e T DP-43 o v e r e x p r e s s i o n M u t a n t T DP-43 o v e r e x p r e s s i o n
HEK293 Flp-lnT-rex cells HEK293 Flp-lnT-rex FLAG-TDP43 WT cells
HEK293 Flp-lnT-rex FLAG-TDP43 F4L cells
m m m FLAG-TDP43 w t ___ FLAG-TDP-43
end. TDP-43 m m end. TDP-43 m m end. TDP-43
Tubulin --- --- Tubulin — — Tubulin
si LUC + siLUC + siLUC +
siTDP43 - + siTDP43 - + siTDP43 +
Tet + + Tet + Tet +
Controlt
F ig u re 3-1: W estern blot analyses o f the various levels o f TDP-43 in HEK-293 stable cell lines used in both 2-DE and splice-sensitive m icroarrays. A ntibody against TDP-43 was used to detect both the endogenous and transgenic TDP-43 expression whereas tubulin was used as a loading control. In addition, for a uniform background, tetracycline was added to cells treated with control (siluciferase) and siTDP-43.
Similarly, tetracycline inducible cell lines expressing wild-type and mutant TDP-43 were also treated with siTDP-43.
A dditionally, tetracycline w as added to all four g ro u p s o f cells and the in d u cib le cells lines
w ere also treated with siT D P -43 for uniform ity. Proteins extracted from th e se four g ro u p s
o f cells, w e re initially separated based on their isoelectric points, follo w ed by m o le c u la r
w eight separation using 10% S D S -P A G E . For ease o f reference, these fo u r groups cells
will be referred to as A , B, C and D in su b seq u e n t descriptions. A nalysis o f differential
spot intensity resulting from the various cellular c o nditions w as ana lyse d and n o rm alised
autom atically using algorithm s from the R E D F IN softw a re from L U D E SI
(h ttp ://w w w .lu d esi.c o m ) . Briefly, the n o rm alisations w e re p erfo rm ed b y m a tc h in g pairs o f
spots (m atch ratio norm alisatio n m e thod) betw e en a b ase im age/gel (e.g. control luciferase
gel) and study gel after w hich the sp o t-v o lu m e ratio w as calculated. Individual spot
volum es for each gel are then m ultiplied by the spot vo lu m e ratio (also k n o w n as the
norm alisation factor). Alternatively, the softw a re calculates the ratio b etw e en the sum o f
the volum es o f all spots in the base gel and the study gel; each spot v o lu m e is then
multiplied by this ratio volum e. R epresentative im ages o f the gels o b tained from the 2 -D E
analysis are show n b e lo w (F igure 3-2). Specifically, differences in spot intensities w ere
co m p a re d betw een the three groups (B, C, and D) and the control (A), and the m ost
variable spots selected and sent for m ass spec trom e tric analysis. Peptides w ere identified
using n a n o L C -E S I- M S /M S by the P roteom e Factory (A G , Berlin, G e rm any).
a) Control (siLUC) b)siTDP
I*
c) TDP W T o /e
* 1404 300 * -ksO
<b . . . P 666 140 « '1m 413 ' O
4210
i a323C O N O
308
b) TDP MUT (F4L) M u t
0 » * • * * .
r ?
• •
F ig u re 3-2: (a-d) Representative 2-DE gel images o f the relative conditions o f TDP-43 levels that w ere analysed. Red circles represent the most variable spots selected by the softw are and their identification number. The spot marked CON represents an overlapping spot to the 323, which was analysed to ensure that there were no overlapping between the two spots.
3.1.1. Spot validation: Comparative analyses o f transcripts and spot intensities
Comparative analyses of differential intensity amongst spots under the various cellular conditions described previously, identified the most variable spots compared to the control (group A) to be 140, 1404, 300, 308, 323, 413, 421 and 666. Mass spectrometry analysis identified hits (peptides) within each protein spot that corresponded to either one or more genes (Table 2-1) and which were subsequently selected for validation based on their perceived relevance to TDP-43 related processes, mascot score and proximity to observed molecular weights and isoelectric points. This included genes involved in RNA metabolism or cellular survival/apoptotic processes. Interestingly, within the spots sent for mass spectrometric analysis, peptides matching TDP-43 were identified in spot 323, which validated the 2-DE analysis with regards to differential intensities, as this spot was shown to undergo an increase in staining intensity in group C gels which contained protein from cells overexpressing wild-type TDP-43.
To begin with, genes that were likely representative of matched peptides, U2AF1 and MDH1 in spot 308, HSPA9 and CCT8 in spot 413 and EEF2 in spot 421 (Table 2-1), were
chosen for subsequent follow-up analyses. Splicing factor U2 small nuclear RNA auxiliary factor 1 ( U2AFI) is a component of the spliceosome and was thus relevant for this study since TDP-43 is involved in splicing and RNA metabolism processes. Similarly, the eukaryotic elongation factor 2 (EEF2), is known to be involved in translation of RNA. The genes malate dehydrogenase 1 (MDH1), T-complex protein 1 subunit theta (CCT8) and mitochondria heat shock protein 75 (HSPA9) were chosen for validation on the basis of their involvement in cellular metabolism and or protein folding (chaperones) under cellular stress conditions.
S p o t N o. P ro te in for subsequent secondary validation analyses. ALB-Album in, U2AF1-U2 auxiliary factor 1, M D H l-M alate dehydrogenase 1, TDP-43-TAR-DNA binding protein, HSPA9-Heat shock 70 kDa protein 9, C C T8- Chaperonin containing TCP 1 subunit theta, EEF2-Eukaryotic elongation factor, U Q C R C l-U biqiunol cytochrome reductase com plex core protein 1, U D P-G lcN ac/U A Pl- Udp-N -A cetylglucosam ine Pyrophosphorylase 1, CCT2-C haperonin containing TCP 1 subunit beta, N .S-N o significant peptides matched N.C- N ot calculated.
differential spot intensities (protein expression differences) w ithin the three spots (lo w e r
panel h istogram s-F igure 3-3).
As can be o bserved in Figure 3-3, the genes U 2A FI, MDH1 and E EF 2 e x hibited transcript
expression changes that correlated with the difference in spot intensity o b serv ed for spots
expression changes that correlated with the difference in spot intensity o b serv ed for spots