2.6.1 Preparation of RNA from bacterial cultures and AGS cell co-culture
Broth culture and tissue culture samples were grown as described in sections
2.4.5 and 2.4.7. The RNA Mini kit is optimized to extract RNA from no more
than 2.5x108 cells. 1ml of H. pylori culture of an OD600 of 1 contains
approximately 1x109 cells. Thus the volume of culture containing 2.5x108 cells
was calculated and 2 x volumes of RNA protect™ Bacteria Reagent (Qiagen,
UK) were added to this volume of culture, then vortexed for 5 seconds. The
stabilized broth culture was left to incubate at room temperature for 5 minutes
then centrifuged at 5000g for 10 minutes. The supernatant was then decanted
and any residual supernatant was removed by gently dabbing the inverted tube
onto a paper towel. Cell pellets were stored at – κ0˚C to minimise degradation of RNA. Total RNA was prepared using the RNeasy® Mini Kit (QIAGEN,
2-78 β00 l DPEC treated TE buffer containing 15mg/ml lysozyme. This mixture was then added to the pellet and vortexed for 10 seconds and incubated for 10
minutes, vortexing for 10 seconds every 2 minutes during incubation. The
subsequent RNA extraction was performed according to the manufacturer’s protocol. RNA was eluted in γ0 l of RNase-free water was added directly to the spin column membrane, and centrifuged for 1 min at 10000 rpm to elute the
RNA. This elution step was repeated with the original eluate to obtain a higher
final concentration of RNA. The resulting RNA samples were stored at -κ0 ˚C in order to minimise RNA degradation. The resulting RNA samples were
stored at -κ0 ˚C to minimise RNA degradation.
2.6.2 Preparation of RNA from gastric biopsies
At endoscopy, gastric biopsies for RNA extraction were transferred
immediately to β50 l of RNA later stabilization reagent (Qiagen, UK) and stored at -κ0˚C according to the manufacturer’s recommended protocol. Biopsies that had been briefly thawed on ice were transferred to 600 l of Buffer RLT and -mercaptoethanol (Qiagen, UK), and homogenized for 20-40 seconds using a T8 ultra Turrax rotor-stator homogeniser (IKA, Werke & Co.,
Freiburg, Germany). The homogenized samples were added to QIAshredder
columns (Qiagen, UK) and centrifuged for 2 minutes at maximum speed. The
lysate was spun for 3 minutes at full speed, and the supernatant transferred to a
new microfuge tube. Total RNA was prepared using the RNeasy® Mini Kit
(Qiagen, UK) according the manufacturers protocol. RNA was eluted in γ0 l of RNase-free water was added directly to the spin column membrane, and
2-79 centrifuged for 1 min at 10000 rpm to elute the RNA. This elution step was
repeated with the original eluate to obtain a higher final concentration of RNA.
The resulting RNA samples were stored at -κ0˚C in order to minimise RNA degradation.
2.6.3 Quantitation of total RNA
Once the total RNA was extracted from the biopsy and the broth culture
samples, the yield of total RNA obtained was assessed using the Nanodrop
spectrophotometer (Nanodrop ND-1000, Nanodrop Technologies Inc.,
Wilmington, USA). The concentration of total RNA (expressed as ng/ l) and both the 260:280 and 260:230 ratios were measured and recorded.
2.6.4 DNA-free treatment of RNA
γ l of 10x DNaseI buffer (Ambion, Ltd) and 1 l rDNaseI (Ambion, Ltd) was added to the RNA (which was adjusted to a concentration of γγ.γng/ l in the total DNA-free reaction mix with RNase free water), and incubated at γ7˚C for γ0 minutes. γ l of the resuspended DNase Inactivation Reagent (Ambion, Ltd) was then added, mixed well, and incubated at room temperature for 2 minutes
vortexing the mixture 3 times during the incubation period to redisperse the
DNase Inactivation Reagent. The mixture was then centrifuged at 10,000 x g
for 1.5 minutes to pellet the DNase Inactivation Reagent. The supernatant
containing the DNA-free treated RNA was transferred to a fresh tube and
2-80
2.6.5 cDNA synthesis
RNA was transcribed using a QIAGEN Omniscript™ reverse transcriptase kit.
Reactions were carried out in a total volume of β0 l, consisting of β l Buffer RT, β l of dNTP mix, β l of pd(N)6 5’-Phosphate, Sodium salt random hexamer primer (Amersham, UK), 1 l of RNase inhibitor (10U/ ), 6 l of water, 1 l of Omniscript reverse transcriptase and 6 l of RNA at a concentration of γγng/ l. Reverse transcription was performed at γ7 ˚C for 1 hour. Negative controls for each RNA sample were prepared in the same
manner but excluded reverse transcriptase.
2.6.6 Quantitative real-time PCR
Primers were specific to H. pylori and checked using a Basic Local Alignment
Search Tool (BLAST) search (www.ncbi.nlm.nih.gov/BLAST/) and can be found in Table 2.7. Any predicted secondary structures and dimer formation of
the primers were assessed using premier biosoft’s Netprimer algorithmμ (http://www.premierbiosoft.com/netprimer/index.html). Real time PCR was
performed using the Rotor-Gene 3000 real-time PCR system (Corbett
Research, Australia), using the Quantitect™ SYBR Green PCR kit (QIAGEN, UK). Amplification was carried out in a reaction volume of β5 l and was set up according to the manufacturer’s recommendations using β l of template cDNA diluted to γγ.γng/ l for biopsy sample (section β.6.β) and 1.7 ng/ l for broth culture samples (section 2.6.1). Cycling conditions are outlined below in
2-81 Table 2.8. No template controls (NTCs) were included in each run, and melt
curve analyses were performed to ensure primer specificity and the absence of
contamination. Negative cDNA samples, produced in the absence of reverse
transcriptase from each RNA sample were tested in parallel to ensure that
products were not amplified from contaminating genomic DNA. Samples were
run in triplicate and the results were analysed using the Pfaffl method of
analysis (Pfaffl, 2001). Efficiencies of each PCR were calculated by serial
dilution as described in the appropriate results chapters.
Table 2.7 Real-time PCR primers
Primer Name P S Reference
C1226 CTGCTTGAATGCGCCAAAC Cover et al 1994 A3436 ATGGAAATACAACAAACACAC Cover et al 1994 16s rRNA F CGATGAAGCTTCTAGCTTGC Narayanan 2005 16s rRNA R ATAGGACATAGGCTGATCTC Narayanan 2005
Table 2.8 Real-time PCR conditions
Step Number of cycles Temperature Length of time
1. 1 C 2 min 2. 1 C 15 min 3. Cycling 35 C 30 sec C 60 sec C 30 sec C 15 sec C 20 sec 4. Melt 1 C C C
Wait for 45 sec on 1st step, then wait for 5 seconds for each step
2-82