Chromatin preparation from tissues
The exact amount of tissue depends upon protein abundance, antibody affinity and the efficiency of cross-linking. Protease inhibitors were included in all solutions used including PBS. PMSF 10µl / ml (100mM PMSF in ethanol, use at 1:100, aprotinin 1 µl /
ml (10 mg / ml aprotinin in 0.01 M HEPES pH 8.0, use at 1: 1000 and leupeptin 11 µl / ml (10mg / ml leupeptin in water, use at 1:1000).
Cross-linking
Frozen tissue was chopped into small pieces, and 1ml of PBS was added to 100 mg tissue. Formaldehyde was added to a final concentration of 1.5 %, the tissue was then rotated at room temperature for 15 mins. The cross-linking reaction was stopped by adding glycine to a final concentration of 0.125M. Samples were again rotated at room tempreture for 5 mins. Samples were centrifuged at 2000rpm at 4oC for 5 mins. Media was discarded and samples were washed with 1ml ice cold PBS before centrifuging for 5 mins at 2000rpm at 4oC.
Note: tissue can be snap frozen at this stage in liquid nitrogen or dry ice and stored at -80
o
C and avoid multiple freeze-thaws.
Tissue disaggregation
Tissues were resuspended in1ml of cell lysis buffer (5mM PIPES pH 8.0, 85 mM KCl, 0.5% NP40 ) plus the protease inhibitors followed by incubation on ice for 10 mins. In parallel cells were dounced while on ice with a B dounce 15 times to aid nuclei release. Cells were centrifuged at 5,000rpm for 5 mins at 4oC to precipitate the nuclei, the supernatant was removed and the pellet resuspended in nucleic lysis buffer (50 mM Tris- Cl pH 8.1, 10 mM EDTA, 1% SDS) plus protease inhibitors. Samples were incubated on ice for 10 mins.
Note: Tissue can be frozen at -80 oC at this stage.
Sonication
Lysates were sonicated in a water bath sonicator for 8 mins to shear DNA to an average fragment size of 500-1000bp. This was followed by sonication of lysates with a probe sonicator at level 1 for 30 seconds on and 10 seconds off for a total sonication time of 3 mins (i.e. X6). This procedure was done while keeping samples on ice. The fragment sizes were analysed on 1.5% agarose gel by using 10µl of lysate.
Determination of DNA concentration (the input samples)
To obtain total chromatin concentrations in each sample lysate, 10µl of lysate was added to 40µl H2O and 2µl of RNAse A (0.5 mg/ml). This was incubated at 65oC for 5hrs to
reverse the cross link and then the DNA was purified using QIAquick PCR purification kit (Qiagen). The O.D of samples was taken before samples were stored at -20oC.
Preclear chromatin
10µl of blocked staph A cells was added to each sample followed by 15 mins incubation at 4oC on a rotating platform. Samples were microcentrifuged at 13,000rpm at 4oC for 5 mins then the supernatant was transferred to a new tube. 1µl of antibody was added to the supernatant and incubated on the rotating platform at 4oC O/N. Controls were included, consisting of 1Xdialysis buffer and antibody as an indicator of any contamination, and no antibody sample containing cell lysate and H20. The following day 10µl of blocked staph
A cells was added to collect the antibody and incubated in rotating platform at 4oC for 15 mins, followed by centrifugation at 13,000rpm for 5 mins. Pellets were washed twice with 1.4ml of 1Xdialysis buffer (2mM EDTA, 50mM Tris-Cl pH 8.0, 0.2% Sarkosyl) and four times with 1.4ml of IP wash buffer (100 mM Tris-Cl pH 8.0, 500 mM LiCl, 1% NP40, 1 % Deoxycholic acid). Each pellet was dissolved in 200µlbuffer and then an additional 200µl of buffer was used to wash the pipette tip before adding the remaining 1ml of buffer to each sample. After each wash samples were incubated on a rotating platform for 3 mins, and then centrifuged at 14,000rpm for 3 mins at room temperature. Buffer was removed as much as possible without aspirating the staph A cells. After the washing step the antibody / protein / DNA complexes were eluted by using 150µl of IP elution buffer (50 mM NaHCO3, 1 % SDS) and then rotate for 15 mins. The samples were microcentrifuged at
14,000rpm for 3 mins and the supernatants were transferred to clean tubes and the previous step was repeated and both elusions were combined in one tube. To remove any traces of staph A cells the samples were microcentrifuged at 14,000rpm for 5 mins and the supernatant was transferred to a fresh tube. Finally, to reverse the crosslinks to supernatant 1µl of RNAse A (10mg/ml), 5µM of NaCl to final concentration of 0.3M was added and samples were incunated at 65oC in a water bath for 5hrs. This was followed by purification of the DNA using QIAquick PCR purification kit (Qiagen) and the DNA was eluted in a total volume of 30µl of dH2O.
Analysis by RT-PCR
The binding level of the antibody to gene promoters was measured by RT-PCR.
This was achieved by running a PCR reaction containing an equal amount of IP samples and input samples in different wells (1.5µl), specific primers for each gene promoter (10µM), 12.5µl Maxima™SYBR Green/ROX qPCR Master Mix (2X) (Fermentas, UK) in a total volume of 25µl. Data from ChIP-PCR were normalised using the Percent Input Method. This method involved analysing ChIP-PCR data relative to input as this includes normalisation for both background levels and input chromatin going into the ChIP. Instruction for calculations was followed as described in the Invitrogen home page (Paisley, UK).
Antibody used in ChIPs assay
All antibodies were obtained from Abcam (Abcam, Cambridge, UK). Antibodies are as follow: H3 K9, H3 K27, GR and Me-cytosine.
Primers used in ChIPs assay
All primers were designed using Beacon software to amplify a region across the promoter region of each gene just upstream of the TSS. Primers were obtained from Invitrogen (Paisley, UK) and optimised by performing gradient PCR. The PCR products from the gradient PCR were then checked by agarose gel electrophoresis for the presence of single band and the right size amplicon.
Table 2.7 Primers used in ChIP assay.
Gene Forward primer 5’- 3’ Reverse primer 5’- 3’ Annealing Temp oC
Dnmt1 GTGGGTGCCCTGAAAG GTTCGTGCTGATCTTG 60
EZH2 GACCGTTACCAACCCGAGTT CTGCCTTCGATGTCCCACTG 57