Segmentación:

One possibility that could lead to the absence of the putative MCO protein in the S-

PM2-resistant strain was a mutation in the gene sequence. To test this hypothesis, the

type strain. To do this, a 5256-bp PCR product covering the region of the putative

MCO gene was amplified fromSynechococcussp. WH7803 and WH7803RS-PM2

using the ‘Expand Long Template PCR System’ (Roche) with the following primers:

ORF0948F 7, 5’-ATGGTTAATGGCGACGAAGC-3’; ORF0948R+13, 5’-

TGGCGTTCAGCAATCAGAAG-3’. PCRs were carried out in a total volume of 50

µl, containing 0.35 mM dNTPs, 0.35 µM primers, 100 ng of DNA, 0.75 µl of Expand

Long Template Enzyme mix, and 5 µl of Expand Long Template buffer 1.

Amplification conditions were as follows: 94°C for 2 min, 30 cycles of 94°C for 20

sec, 65°C for 30 sec, 68°C for 4 min + 20 sec/cycle, with a final extension of 7 min at

68°C.

When different amounts of input template DNA (200, 10 and 5 ng) were used, single

PCR products with the expected size of 5256-bp were revealed (Figure 5.5A). A well-

defined PCR product was generated from 100 ng of input DNA template (Figure

5.5B), which was then purified and used as the DNA template in sequencing. Based

on the known sequence of ORF0948 inSynechococcussp. WH7803, 10 sequencing

primers were designed (Table 5.1). The primer, 0948R3638C (bolded in Table 5.1),

was used to sequence the gap between the primers 0948F2720 and 0948F3267.

In addition, PCR primers (upstream0948F848, 5’-AGCATCGCCAACCAGCTCAC-

3’; upstream0948R+422, 5’-ACCGCCTCAACACCACCAGA-3’) targeting a 1270-

bp region (including an 848-bp upstream region with respect to the transcription start

point of the ORF0948) were also designed to examine if there were any alternations in

the promoter regions of ORF0948 in wild-type and mutant strains. PCRs were carried

primers, 10 ng of DNA, 1 unit of

buffer (Fermentas). Amplification conditions were as follows: 94°C for 2 min, 30

cycles of 94°C for 45 sec,

10 min at 72°C. The resulting PCR products (Figure 5.6) were sequenced using the

primers of upstream0948F848 and

Figure 5.5 Gel image of PCR products generated by the PCR primer targeting the putative MCO gene.

DNAs fromSynechococcus

PCRs. Lane 1DNA ladder of λDNA template, Lane 3 10 ng of WH7803RS of WH7803RS-PM2 DNA as template, Lane 6

Lane 7 100 ng of WH7803 DNA as template, Lane 8 and 9 100 ng of WH7803RS template, Lane 10 a negative control.

1 2 3 4 5 6 bp 6557 4361 2321 1 2 3

primers, 10 ng of DNA, 1 unit ofTaqpolymerase (Fermentas), and 5 µl 10×

Amplification conditions were as follows: 94°C for 2 min, 30

cycles of 94°C for 45 sec, 65°C for 45 sec, 72°C for 1 min, with a final extension

The resulting PCR products (Figure 5.6) were sequenced using the

upstream0948F848 and upstream0948R+422.

Gel image of PCR products generated by the PCR primer targeting the putative MCO

Synechococcussp. WH7803 and WH7803RS-PM2 were used as templates to perform DNA ladder of λDNA HindIII digest in bp, Lane 2 200 ng of WH7803RS

template, Lane 3 10 ng of WH7803RS-PM2 DNA as template, Lane 4 a negative con

PM2 DNA as template, Lane 6 GeneRuler™1kb DNA ladder from Fermentas Lane 7 100 ng of WH7803 DNA as template, Lane 8 and 9 100 ng of WH7803RS

template, Lane 10 a negative control.

1 2 3 4 5 6 1 7 8 9 10 bp 10000 8000 6000 5000 bp 6557 4361 4 bp 2000 1500 1000

polymerase (Fermentas), and 5 µl 10×Taq

Amplification conditions were as follows: 94°C for 2 min, 30

°C for 45 sec, 72°C for 1 min, with a final extension of

The resulting PCR products (Figure 5.6) were sequenced using the

Gel image of PCR products generated by the PCR primer targeting the putative MCO

PM2 were used as templates to perform in bp, Lane 2 200 ng of WH7803RS-PM2 DNA as PM2 DNA as template, Lane 4 a negative control, Lane 5 5 ng

GeneRuler™1kb DNA ladder from Fermentas in bp, Lane 7 100 ng of WH7803 DNA as template, Lane 8 and 9 100 ng of WH7803RS-PM2 DNA as

Figure 5.6 Gel image of PCR products generated by the PCR primer targeting the upstream region of the putative MCO gene.

DNAs fromSynechococcussp. WH7803 and WH7803RS-PM2 were used as templates to perform PCRs. Lane 1 WH7803RS-PM2 DNA as template, Lane 2 WH7803 DNA as template, Lane 3 a negative control, Lane 4 GeneRuler™1kb DNA ladder in bp from Fermentas.

Table 5.1 Primers used for sequencing the ORF0948 in Synechococcus sp. WH7803RS-PM2

Primers 5’-3’ 0948F498 CCGCAGACTTGCTAACTACA 0948F1078 CGCATTAGCTCCGATCCAGT 0948F1644 AGCGGCTTCATTGGTTAGCA 0948F2190 TTCAGATGGCAACCGCACAA 0948F2720 CAATTCGTCAGCGTCAGTTC 0948F3267 TCGCATGCTGTACCAGGATT 0948F3622 CTCAGGACCTCCAGATTGAC 0948F4000 GCTGCACTGTCACTCATGTT 0948F4850 TTGCCTATTCCACGCTCTAC 0948R3638C AATCTGGAGGTCCTGAGAGT 0948R5111C GCATCCAACTGATTGGAGAC

When the sequencing results of the ORF0948 ofSynechococcussp. WH7803RS-PM2

were assembled and aligned with that ofSynechococcussp. WH7803, a 100% identity

was revealed (Figure 5.7A). This demonstrated that the putative MCO gene sequences

were the same in S-PM2-resistant and wild-type strains. In addition, the 848-bp

upstream regions of the ORF0948 also showed 100% identity (Figure 5.7B). These

B

Figure 5.7 Sequence alignments of the putative MCO gene and its 848-bp upstream region in S- PM2-resistant strain and Synechococcus sp. WH7803.

AThe putative MCO gene.BThe 848-bp upstream region. A 5256-bp PCR product covering the putative MCO-coding region were amplified and subjected to DNA sequencing. A 1270-bp region including a 848-bp upstream segment with respect to the transcription start point of the ORF0948 was amplified and were subjected to DNA sequencing.

5.3.4 Reverse transcriptase (RT)-PCR analysis of the putative MCO