• No se han encontrado resultados

Teorías sobre los determinantes del salario

6. Marco teórico

6.2 Teorías sobre los determinantes del salario

of tissue in (a) head, (b) abdomen, (c) wing appendages and (d) walking appendages and mouthparts. X-axis shows the Tribolium strain used.

A

in the developing eye (Fig. 10). Consistent with the rescue of the pupal Apox KD phenotype by Nc1 or Nc2 dsRNA co-injection, the pupal Apox KD eye phenotype was also completely abolished in Apox+Nc1 and Apox+Nc2 KD animals (Fig. 10c and d).

Further, the quantitative analysis of eye size revealed no difference of eye size between Apox+Nc1 KD animals (95) and control injected animals, suggesting a weakening effect of Nc1 KD on the Apox KD eye size-reducing effect (Fig. 10e). Animals hatching from double injection of Apox+Nc2 dsRNA exhibited a very similar increase in average eye size like Nc2 single KD animals: 101+/-2.6 compared to control injected animals (Fig. 10e). This result revealed that while the Nc2 KD ameliorated the effects of Apox KD, the reverse was not the case, which indicated that Apox was not antagonizing PCD by directly affecting the expression or activity of Nc2 during normal development.

3.11. Effect of combinatorial knockdown of Apox and initiator caspases on adult photoreceptor survival

Further informative differences between the adult eye phenotypes emerged by confocal image analysis in the transgenic strain 3XP3-EGFP Tribolium animals injected with Nc2+EGFP, Apox+EGFP and Apox+Nc2. (Fig. 11). As in the case of adult animals phenotypic for the Apox KD (Fig. 11), Apox+EGFP double KD animals exhibited a reduced field of facets without detectable photoreceptors (not shown). In Nc2+Apo double KD adults, however, a large eye area with intact photoreceptor clusters per ommatidium was detectable (Fig. 11c and g), consistent with a rescue of photoreceptor apoptosis by the reduction of caspase activity.

Interestingly, the distance between the photoreceptor clusters of neighboring ommatidia was more pronounced than in untreated animals (compare Fig. 11 e and g). The same was true

for the adult eye of Nc2+EGFP KD animals (Fig. 14h). The consistently wider interommatidial space in both KD experiments that targeted the Nc2 homolog suggested that this additional phenotype was most likely due to the differentiation of surplus accessory cells a consequence of the suppression of PCD.

4. Discussion

4.1. Apox suppresses programmed cell death during Tribolium development

In this study I show that the postembryonic knockdown of the zinc finger transcription factor gene Apox leads to blackening in external tissues of the pupal body. This effect could be due to cell death via caspase-dependent or caspase-independent mechanisms. The effect of Apox KD on pupal development was rescued by simultaneous downregulation of the initiator caspases Nc1 or Nc2, which facilitate the execution of the PCD pathway. This finding provided the key evidence that Apox antagonizes PCD to suppress cell death in specific pupal tissues.

The suppression of PCD by Apox during postembryonic and embryonic development is spatially regulated. During the development of the Tribolium pupa, Apox prevents cell death in tissues including head epidermis, wing and walking appendages, mouthparts and terminal abdomen. During larval development, Apox appears to suppress cell death in head, thoracic and abdominal segments. I speculate that these Apox KD-sensitive tissues undergo extensive cell proliferation and differentiation during metamorphosis in Tribolium.

Consistent with this, previous studies in other holometabolous insect species have shown that cell proliferation and PCD play important roles during morphogenesis. Previous investigation of wing development has shown that, during pre-pupal development, wing disc of

holometabolous insects rapidly differentiate and proliferate (Fristrom and Fristrom 1993; Fujiwara and Hojyo 1997). Studies in the pupal wing development of Lepidoptera have shown that PCD occurs in the pupal wing periphery shaping the outline of the adult wing in moths and butterflies (Dohrmann and Nijhout 1988; Kodama et al. 1995).

In Drosophila, hormonal signals trigger the destruction of obsolete larval tissue at late larval stage (Jiang, Baehrecke et al. 1997). The abdominal epidermis forms from small groups of cells called histoblasts, which are present in the larval midgut. During abdominal morphogenesis, dynamic tissue rearrangements take place, which lead to apoptosis of 10-20% of histoblasts (Bischoff and Cseresnyes 2009). 12 h after the onset of metamorphosis, another wave of hormonal activation causes destruction of larval salivary glands (Jiang, Baehrecke et al. 1997). Along with apoptosis, extensive cell proliferation, cell elongation and differentiation take place in the wing imaginal cells, leg imaginal cells and the larval epidermis during insect metamorphosis (Fristrom 1972).

Interestingly, the steroid hormone 20-hydroxyecdysone (ecdysone) is responsible for regulating differentiation, tissue remodeling and programmed cell death in order to completely transform the larvae into a mobile adult (Baehrecke 2000). Ecdysteroid and juvenile hormone are the effector hormones which control transition from larva to pupa and subsequently the adult in holometabolous insects (Bollenbacher, Smith et al. 1981; Jindra, Malone et al. 1996; Riddiford 1996). It is therefore reasonable to assume that some of the ecdysteroid signal dependent PCD events in Drosophila are evolutionarily related to patterning events in the Tribolium pupa.

The sequence analysis of Apox revealed a putative SET domain along with five zinc finger domains (Fig. 4), identifying Apox as a member of the Prdm family of proteins (Keller and Maniatis 1991). This suggests that Apox acts through chromatin modification during transcriptional regulation. Apox might recruit histone methyltransferase (HMT) through the zinc finger domains. HMTs methylate arginine or lysine residues of histone H3, inducing repression of chromatin. This leads to a model in which apoptosis in specific tissues of the pupal body is prevented by Apox through transcriptional repression.

Further informative is the fact that the Nc2 KD mediated increase in eye size was not affected in the double KD experiments that simultaneously targeted Apox. This finding implies that Apox does not directly affect caspase transcription or activity during normal development. In combination, the data suggest that Apox represses pro-apoptotic target genes which modulate caspase activity.

4.3 The role of Apox and programmed cell death during Tribolium adult eye development

Two kinds of patterning defects were observed in the developing pupal eye of Tribolium due to Apox KD. In one case, ommatidia formed an irregular pattern compared to WT. In the other case, the differentiating photoreceptor clusters dislocated into the gena and the antenna. This is consistent with the expression of Apox in the early developing retina and later in the head cuticle. These findings together suggest that in the Apox KD pupal eye of Tribolium, mispatterning is due to increase in cell death in the developing retina and the surrounding head epidermis. All these strongly phenotypic animals show pupal lethality due to overall increase in cell death.

In the developing adult eye, Apox KD leads to photoreceptor cell death during late differentiation after the eye facets have been formed. The clear retina in the Apox KD adults further indicates the occurrence of PCD in the pigment cells. These findings are consistent with the expression Apox in the early developing retina. This suggests that Apox promotes normal eye development by suppressing pigment and photoreceptor cell death in Tribolium.

This study reveals important functions of PCD during adult eye development in Tribolium. The KD data show that anti-apoptotic genes like Apox and pro-apoptotic genes like Nc1 and Nc2 regulate the final eye size and photoreceptor cell number in Tribolium. These functions are also required for the correct formation of a regular pattern of ommatidia in the compound eye.

Previous studies have shown that inter-ommatidial cells are eliminated in the developing Drosophila retina one day after pupation (Miller and Cagan 1998). Subsequently, ommatidia are removed from the edge of the eye by activation of pro-apoptotic genes hid, grim and reaper through Wg signaling (Lin, Rogulja et al. 2004). The function of programmed cell death and proper patterning of the eye is well understood in Drosophila. I propose that PCD occurs during the following processes during normal eye development in Tribolium. The first one is removal of surplus interommatidial cells across the eye. After the photoreceptor cells have been specified and differentiated, one round of apoptosis may take place to remove extra cone cells and pigment cells. At mid pupation (36-48 h APF), another round of programmed cell death may take place to remove incomplete ommatidia from the periphery of the eye. The latter is essential for proper patterning of the eye margin. It appears that these functions of apoptosis in Tribolium eye development are conserved in Drosophila. Further studies on the retinal structure and cell death pathways in Tribolium will shed light on functions of PCD in the adult eye development in this

important insect model. Interestingly, in zebrafish and mouse the disruption of Prdm1 family members leads to photoreceptor cell death (Wilm and Solnica-Krezel 2005; Briknarova, Zhou et al. 2008). It will be important to study in more detail how these functionalities are evolutionarily related.

APPENDIX A: BUFFERS AND SOLUTIONS Table 1: Stock solution

Reagent pH Mw Volume Grams add Notes

1M Tris- HCl pH 8 121.14g/mol 500ml For 500ml = 121.14/2= 60.5g in 400ml ddH2O Adjust the pH with 1M HCl and then make up the volume to 500ml. 0.5M EDTA pH 7.0-8.0 372.44g/mol 500ml For 500ml= (372.44 X 0.5) /2=93.11g Adjust the pH with 10N NaOH and it will dissolve only at pH 8. Then make up the volume to 500ml. 5M NaCl

N/A 58.44g/mol 500ml For 500ml= (58.44X 5mol/L)/ 2 = 146.1g Heat in the microwave for the salt to dissolve. 50X TAE

N/A N/A 1L Tris base

242g Glacial acetic acid 57.1ml 0.5M EDTA 100ml After dissolving the Tris base make up the volume to 1L.

4M LiCl N/A 42.39g/mol 50ml For 50ml = (42.39g/mol X 5mol/L)/ 20 =10.60g Dissolve 10.6g in 25ml ddH2O. Make up the volume and store in 100ml bottle. Autoclave and store at RT.

TritonX stock solution to 9ml ddH2O Do not autoclave. 10% Tween 20

N/A N/A 10ml Add 1ml

stock solution to 9ml ddH2O Keep at RT. Do not autoclave. 20% Tween

N/A N/A 10ml Add 2ml

stock solution to 8ml ddH2O Keep at RT. Do not autoclave. 1M MgCl2

N/A 203.30g/mol 100ml For 100ml = (203.30g/mol X 1mol/L) / 10 = 20.33g Do not autoclave. 10% SDS

N/A N/A 500ml For 500ml =

50g

Store at RT. Do not autoclave.

Table 2- TE (1X, 500ml)

Reagent Stock Volume added

10mM Tris-Cl 1M 5ml

1mM EDTA 0.5M 1ml

APPENDIX B: IN SITU HYBRIDIZATION BUFFERS Table 1: SSC stock solution 20X, 1L, pH=7

Reagent Amount added

NaCl 175g(3M final)

Trisodium citrate dehydrate 88g(3M final)

ddH2O Adjust to 1 liter , Autoclave

Table 2: HybA-RNA buffer, 40ml

Buffer name Reagent Amount added

HybA-RNA I (for pupal heads) Dextran sulphate 2g

SSC 20X 8ml

Denhardt’s stock 20X 800ul Baker’s yeast RNA stock

10mg/ml

1ml

Formamide 20ml

Tween 20 % 400ul

Salmon sperm DNA 10mg/ml

2ml

DEPC treated H2O 7.8ml HybA-RNA II (for embryos) Same as HybA-RNA I

except do not add Dextran sulphate

Note: Dissolve dextran sulphate in SSC and H2O for 30min at 37oC and then add all the other

Table 3: HybB-RNA Buffer 40ml

Reagent Amount added

SSC stock 20X 6ml Formamide 15ml Tween 20% 300ul DEPC H2O 18.7ml Table 4: 70% glycerol 50ml

Reagent Amount added

Glycerol 100% 35ml

PBS 1X 15ml

Note: Mix thoroughly by flipping. Table 5: PBS 1X, 50ml

Reagent Amount added

PBS 10X stock 5ml

ddH2O 45ml

Table 6: PBT 1X, 50ml

Reagent Amount added

PBS 1X 50ml

Triton X 0.1% 45ml

Note: PBS, PBT and H2O are DEPC treated using 1:1000 dilution. Add DEPC and shake on the shaker overnight and then autoclave.

Table 7: Fixation solution for Tcas thick Tissue (pupal heads)

Reagent Amount added

Formaldehyde stock 2ml 0.5M EDTA pH=8 0.8ml PBT,1X, DEPC treated 5.2ml 0.1% Triton X 80ul DEPC H2O 1.92

Table 8: Fixation solution for Tcas embryos

Reagent Amount added

PBS 1X DEPC treated 2ml Formaldehyde stock 300ul

APPENDIX C: REAGENTS AND KITS Table 1: Reagents

Reagent Product number Vendor

Ampicillin solution A5354 Sigma Aldrich

JM 109 competent cells E. coli

L2001 Promega

Ribonuclease R6513 Sigma

PCR nucleotide mix,10X C1141 Promega

Taq DNA polymerase FB600045 Fisher Scientific

Go Taq Hotstart 9P1M512 Promega

1Kb DNA ladder 9P1G571 Promega

RNAase Inhibitor N2111 Promega

10X PBS BP3994 Fisher Scientific

Triton X-100 H5142 Promega

Tween-20 H5152 Promega

Ethanol 200 proof 2710 Decon Labs Inc

Methanol A412-4 Fisher Scientific

Heptane BP1115-500 Fisher BioReagents

Formaldehyde F79-1 Fisher Scientific

Formamide BP227500 Fisher BioReagents

DIG RNA labeling mix 1127073910 Roche Diagnostics Anti-digoxigenin AP Fab

fragment

11093274910 Roche Diagnostics

Baker Yeast RNA AM7118 Ambion

Salmon Sperm DNA A2159,0005 AppliChem

DIG wash and Block Buffer set

11585762001 Roche Diagnostics

NBT S380C Promega

BCIP S381C Promega

Glycerol BP229-1 Fisher Bioreagents

50X Denhardt’s solution 750018 Invitrogen

Table 2: Kits

Kit Product number Vendor

MegaScript T7 High yield Transcription kit

AM1333 Ambion

MiniElute PCR Purification kit(50)

28004 Qiagen

APPENDIX D: PRIMERS Primer name Sequence

Tcas_nonamezf_A1 ATTGATAAGCTGGATGTCTACG Tcas_nonamezf_B1 TGCGTCATTCGGTGGTAG Tcas_nonamezf_A2: TATTCGGCACCGTTTCGG Tcas_nonamezf_T7_B2 TAATACGACTCACTATAGGGAAGGCTTTGTTGCATACTCCAC Tcas_Nc2_A1 TTAAAACAGTGGTTAAGAAATTCTCG Tcas_Nc2_B1 TATTGCATAATTAGTTTCGATCACG Tcas_Nc2_A1T7 TGTAATACGACTCACTATAGGGCAAACAGTGGT Tcas_Nc2_B1T7 TGTAATACGACTCACTATAGGGCTTGCATAATTAG Tcas_Nc1_A1 CAGTTTTACGACACTGAAAGGTACA Tcas_Nc1_B1 CTTTACTGAAGGGTGGCAGATG Tcas_Nc1_A1T7 TGTAATACGACTCACTATAGGGGTTTTACGAC Tcas_Nc1_B1T7 TGTAATACGACTCACTATAGGGTTACTGAAGG

REFERENCES

1. Altincicek, B., E. Knorr, et al. (2008). "Beetle immunity: Identification of immune- inducible genes from the model insect Tribolium castaneum." Dev Comp Immunol 32(5): 585-595.

2. Baehrecke, E. H. (2000). "Steroid regulation of programmed cell death during Drosophila development." Cell Death Differ 7(11): 1057-1062.

3. Baker, N. E. (2001). "Cell proliferation, survival, and death in the Drosophila eye." Semin Cell Dev Biol 12(6): 499-507.

4. Baker, N. E. and S. Y. Yu (2001). "The EGF receptor defines domains of cell cycle progression and survival to regulate cell number in the developing Drosophila eye." Cell 104(5): 699-708.

5. Beeman, R. W., J. J. Stuart, et al. (1993). "Structure and function of the homeotic gene complex (HOM-C) in the beetle, Tribolium castaneum." Bioessays 15(7): 439-444. 6. Beeman, R. W., J. J. Stuart, et al. (1989). "Genetic analysis of the homeotic gene

complex (HOM-C) in the beetle Tribolium castaneum." Dev Biol 133(1): 196-209. 7. Bischoff, M. and Z. Cseresnyes (2009). "Cell rearrangements, cell divisions and cell

death in migrating epithelial sheet in the abdomen of Drosophila." Development 136(14): 2403-2411.

8. Bollenbacher, W. E., S. L. Smith, et al. (1981). "Ecdysteroid titer during larval--pupal-- adult development of the tobacco hornworm, Manduca sexta." Gen Comp Endocrinol

9. Briknarova, K., X. Zhou, et al. (2008). "Structural studies of the SET domain from RIZ1 tumor suppressor." Biochem Biophys Res Commun 366(3): 807-813.

10. Brown, S. J., R. E. Denell, et al. (2003). "Beetling around the genome." Genet Res 82(3): 155 161.

11. Brown, S. J., J. P. Mahaffey, et al. (1999). "Using RNAi to investigate orthologous homeotic gene function during development of distantly related insects." Evol Dev 1(1): 11-15.

12. Bucher, G., J. Scholten, et al. (2002). "Parental RNAi in Tribolium (Coleoptera)." Curr Biol 12(3): R85-86.

13. Cagan, R. L. and D. F. Ready (1989). "Notch is required for successive cell decisions in the developing Drosophila retina." Genes Dev 3(8): 1099-1112.

14. Chen, P., W. Nordstrom, et al. (1996). "grim, a novel cell death gene in Drosophila." Genes Dev 10(14): 1773-1782.

15. Chen, P., A. Rodriguez, et al. (1998). "Dredd, a novel effector of the apoptosis activators reaper, grim, and hid in Drosophila." Dev Biol 201(2): 202-216.

16. Colussi, P. A., L. M. Quinn, et al. (2000). "Debcl, a proapoptotic Bcl-2 homologue, is a component of the Drosophila melanogaster cell death machinery." J Cell Biol 148(4): 703-714.

17. Dohrmann CE, Nihjout HF (1988) Development of the wing margin in Precis coenia (Lepidoptera: Nymphalidae) J Res Lepidoptera 27:151–159

18. Dorstyn, L., P. A. Colussi, et al. (1999). "DRONC, an ecdysone-inducible Drosophila caspase." Proc Natl Acad Sci U S A 96(8): 4307-4312.

19. Dorstyn, L., S. H. Read, et al. (1999). "DECAY, a novel Drosophila caspase related to mammalian caspase-3 and caspase-7." J Biol Chem 274(43): 30778-30783.

20. Ellis, H. M. and H. R. Horvitz (1986). "Genetic control of programmed cell death in the nematode C. elegans." Cell 44(6): 817-829.

21. Fraser, A. G. and G. I. Evan (1997). "Identification of a Drosophila melanogaster ICE/CED-3 related protease, drICE." EMBO J 16(10): 2805-2813.

22. Friedrich, M. and S. Benzer (2000). "Divergent decapentaplegic expression patterns in compound eye development and the evolution of insect metamorphosis." J Exp Zool

288(1): 39 55.

23. Friedrich, M.,Ramold, I.,Melzer, R.R., 1996. The early stages of ommatidial development in flour beetle Tribolium castaneum (Coloeptera,Tenebrionidae).Dev.Genes Evol. 206, 136-146

24. Fristrom, J. W. 1972. The biochemistry of imaginal disc development. In H. Ursprung and R. Nothiger (eds.), The Biology of Imaginal Discs. Springer-Verlag, Berlin, pp. 109– 154.

25. Fristrom D, Fristrom JW (1993) The metamorphic development of the adult epidermis. In: Bate M, Martinez Arias A (eds) The development of Drosophila melanagaster, vol II. CSHL Press, pp 843–897

26. Fujiwara H, Hojyo T (1997) Developmental profiles of wing imaginal discs of flügellos (fl), a wingless mutant of the silkworm, Bombyx mori. Dev Genes Evol 207:12–18 27. Grether, M. E., J. M. Abrams, et al. (1995). "The head involution defective gene of

Drosophila melanogaster functions in programmed cell death." Genes & Development

28. Hay, B. A., D. A. Wassarman, et al. (1995). "Drosophila homologs of baculovirus inhibitor of apoptosis proteins function to block cell death." Cell 83(7): 1253-1262. 29. Horn, C. and E. A. Wimmer (2000). "A versatile vector set for animal transgenesis." Dev

Genes Evol 210(12): 630-637.

30. Igaki, T., H. Kanuka, et al. (2000). "Drob-1, a Drosophila member of the Bcl-2/CED-9 family that promotes cell death." Proc Natl Acad Sci U S A 97(2): 662-667.

31. Inohara, N., T. Koseki, et al. (1997). "CLARP, a death effector domain-containing protein interacts with caspase-8 and regulates apoptosis." Proc Natl Acad Sci U S A

94(20): 10717-10722.

32. Jacobson, M. D., M. Weil, et al. (1997). "Programmed cell death in animal development." Cell 88(3): 347-354.

33. Jiang, C., E. H. Baehrecke, et al. (1997). "Steroid regulated programmed cell death during Drosophila metamorphosis." Development 124(22): 4673-4683.

34. Jindra, M., F. Malone, et al. (1996). "Developmental profiles and ecdysteroid regulation of the mRNAs for two ecdysone receptor isoforms in the epidermis and wings of the tobacco hornworm, Manduca sexta." Dev Biol 180(1): 258-272.

35. Jones, G., D. Jones, et al. (2000). "Deterin, a new inhibitor of apoptosis from Drosophila melanogaster." J Biol Chem 275(29): 22157-22165.

36. Kanuka, H., K. Sawamoto, et al. (1999). "Control of the cell death pathway by Dapaf-1, a Drosophila Apaf-1/CED-4-related caspase activator." Mol Cell 4(5): 757-769.

37. Keller, A. D. and T. Maniatis (1991). "Identification and characterization of a novel repressor of beta-interferon gene expression." Genes Dev 5(5): 868-879.

38. Kodama R, Yoshida A, Mitsui T (1995) Programmed cell death at the periphery of the pupal wing of the butterfly, Pieris rapae. Roux’s Arch Dev Biol 204:418–426

39. Lee, C. Y. and E. H. Baehrecke (2000). "Genetic regulation of programmed cell death in Drosophila." Cell Res 10(3): 193-204.

40. Li, P., D. Nijhawan, et al. (1997). "Cytochrome c and dATP-dependent formation of Apaf 1/caspase-9 complex initiates an apoptotic protease cascade." Cell 91(4): 479-489. 41. Lin, H. V., A. Rogulja, et al. (2004). "Wingless eliminates ommatidia from the edge of

the developing eye through activation of apoptosis." Development 131(10): 2409-2418. 42. Liu, Z. and M. Friedrich (2004). "The Tribolium homologue of glass and the evolution of

insect larval eyes." Dev Biol 269(1): 36-54.

43. Lorenzen, M. D., S. J. Brown, et al. (2002). "Transgene expression from the Tribolium castaneum Polyubiquitin promoter." Insect Mol Biol 11(5): 399-407.

44. Lorenzen, M. D., Z. Doyungan, et al. (2005). "Genetic linkage maps of the red flour beetle, Tribolium castaneum, based on bacterial artificial chromosomes and expressed sequence tags." Genetics 170(2): 741-747.

45. Miller, D. T. and R. L. Cagan (1998). "Local induction of patterning and programmed cell death in the developing Drosophila retina." Development 125(12): 2327-2335. 46. Milligan, C. E., D. Prevette, et al. (1995). "Peptide inhibitors of the ICE protease family

arrest programmed cell death of motoneurons in vivo and in vitro." Neuron 15(2): 385- 393.

47. Quinn, L., M. Coombe, et al. (2003). "Buffy, a Drosophila Bcl-2 protein, has anti- apoptotic and cell cycle inhibitory functions." EMBO J 22(14): 3568-3579.

48. Richards, S., R. A. Gibbs, et al. (2008). "The genome of the model beetle and pest Tribolium castaneum." Nature 452(7190): 949-955.

49. Riddiford, L. M. (1996). "Juvenile hormone: the status of its "status quo" action." Arch Insect Biochem Physiol 32(3-4): 271-286.

50. Rusconi, J. C., R. Hays, et al. (2000). "Programmed cell death and patterning in Drosophila." Cell Death Differ 7(11): 1063-1070.

51. Savard, J., D. Tautz, et al. (2006). "Genome-wide acceleration of protein evolution in flies (Diptera)." BMC Evol Biol 6: 7.

52. Song, Z., K. McCall, et al. (1997). "DCP-1, a Drosophila cell death protease essential for development." Science 275(5299): 536-540.

53. Sokoloff, 1972."The biology of Tribolium castaneum with special emphasis on genetic aspects.

54. Spencer, S. A., P. A. Powell, et al. (1998). "Regulation of EGF receptor signaling establishes pattern across the developing Drosophila retina." Development 125(23): 4777-4790.

55. Tomoyasu, Y. and R. E. Denell (2004). "Larval RNAi in Tribolium (Coleoptera) for analyzing adult development." Dev Genes Evol 214(11): 575-578.

56. Wang, L., S. Wang, et al. (2007). "BeetleBase: the model organism database for Tribolium castaneum." Nucleic Acids Res 35(Database issue): D476-479.

57. White, K., E. Tahaoglu, et al. (1996). "Cell killing by the Drosophila gene reaper." Science 271(5250): 805-807.

58. Wilm, T. P. and L. Solnica-Krezel (2005). "Essential roles of a zebrafish prdm1/blimp1 homolog in embryo patterning and organogenesis." Development 132(2): 393-404.

59. Wolff, T. and D. F. Ready (1991). "Cell death in normal and rough eye mutants of Drosophila." Development 113(3): 825-839.

60. Yang, X., N. Zarinkamar, et al. (2009). "Probing the Drosophila retinal determination gene network in Tribolium (I): The early retinal genes dachshund, eyes absent and sine oculis." Dev Biol 333(1): 202-214.

61. Yu, S. Y., S. J. Yoo, et al. (2002). "A pathway of signals regulating effector and initiator caspases in the developing Drosophila eye." Development 129(13): 3269-3278.

62. Zhang, H., Q. Huang, et al. (2000). "Drosophila pro-apoptotic Bcl-2/Bax homologue reveals evolutionary conservation of cell death mechanisms." J Biol Chem 275(35): 27303-27306.

63. Zou, H., W. J. Henzel, et al. (1997). "Apaf-1, a human protein homologous to C. elegans CED-4, participates in cytochrome c-dependent activation of caspase-3." Cell 90(3): 405- 413.

ABSTRACT

THE NOVEL PRDM GENE APOPTIX ANTAGONIZES PRORAMMED CELL DEATH

Documento similar