LOS VALORES DE GÉNERO EN LOS REGISTROS DE OBSERVACIÓN

RNA from single muscle cells and tissues was extracted using Tri Reagent (Qiagen, Sussex, UK). Muscles were ground and placed into Tri Reagent (1ml per 50- 100mg of tissue) and centrifuged at 12,000g for 10mins at 4oC to remove insoluble material. Samples were then allowed to stand for 5mins at room temperature. Chloroform (200µL) was then added to the supernatants, samples were shaken

vigorously for 15sec and allowed to stand for 15mins at room temperature. Samples were then centrifuged at 12,000g for 15mins at 4o_{C. Centrifugation separated the}

mixtures into 3 phases: a red organic phase (containing protein), an interphase (containing DNA) and a colourless upper aqueous phase (containing RNA).

The aqueous phase was transferred to a fresh tube and 0.5ml of isopropanol was added to each sample. The samples were allowed to stand for 5-10mins at room temperature and centrifuged at 12,000g for 10mins at 4oC. The supernatants were then discarded and the RNA pellets were washed by adding 1mL of 75% ethanol. Samples were then centrifuged at 7,500g for 5mins at 4oC. Following centrifugation, the RNA

pellets were briefly dried for 5-10mins by air-drying and 100µL of RNase-free H2O was

2.10.2 Purification and DNase treatment of total RNA

All RNA samples were DNase-treated and purified using the RNeasy MinElute cleanup-kit (Qiagen) as described below.

Reagents

• Buffer RLT • Buffer RPE • RNase- Free water

• RNeasy MinElute Spin Columns • Collection tubes (1.5 & 2ml)

RNA samples were adjusted to a volume of 100µl with RNase-free water. RTL buffer (350uL) was added, followed by 250µL Ethanol (100%) and mixed well by pipetting. Samples were transferred to an RNeasy MinELute Spin column, placed in a 2mL collection tube. Samples were centrifuged for 15sec at 8,000g and the flow- through was discarded. RNeasy MinELute Spin column were placed in a new 2ml collection tube and RPE buffer (500µl) was added to the spin columns and centrifuged for 15sec at 8,000g to wash the spin column membrane. The flow-through was discarded as previously. Addition of 80% Ethanol (500µL) to the RNeasy MinELute Spin column followed and samples were centrifuged for 2min at 8,000g to wash the spin column membrane. The flow-through and collection tube were discarded. RNeasy MinELute Spin columns were placed in a new collection tube (2mL) and centrifuged at full speed (20,800g) for 5 min. The flow-though and collection tubes were discarded. Finally, the spin column was placed in a new collection tube (1.5mL) and 14µL of

RNase-free water was added directly to the centre of the spin column membrane. Columns were centrifuged for 1min at full speed (20,800g) to elute the RNA.

A schematic illustration of the steps described above is shown below (Figure 2.1).

Figure 2.1 RNeasy MinElute Cleanup Procedure used to DNAse and purify RNA

samples (from the product specification sheet provided by the company).

2.10.3 RNA content of samples using the RiboGreen RNA quantitation assay

The RNA content of the samples was measured using the RiboGreen RNA quantitation assay kit (Molecular probes, Leiden, The Netherlands).

Reagents

• RiboGreen RNA quantitation reagent (Component A).

• 20X TE (Component B), 25ml of 200mM Tris-HCl, 20mM EDTA, pH 7.5 (20X

TE) in DEPC-treated water.

• Ribosomal RNA standard (Component C), 100µg/ml in TE.

A range of standards between 0-1µg/ml was prepared from a stock solution of

100µg/ml Component C in 1X TE solution. 100µL from the standard, blank or sample

and 100µl of Component A were placed in a 96 well plate. Samples were then incubated

at room temperature for 2-5mins. The fluorescence of standards and samples was measured (excitation 480nm, emission 520nm) using a fluorescence microplate reader (Fluostar optima, BMG, Germany). The RNA content of each sample was calculated from the standard curve.

2.10.4 Generation of first-strand cDNA

Purified RNA was utilised to generate first-strand cDNA using the iScript cDNA Synthesis kit (Bio-Rad, Hertfordshire, UK).

Reagents

• 5 x iScript reaction mix • iScript reverse transcriptase • Nuclease-free water

Purified RNA (1ug/sample) was added in DNAse-RNAse free eppendorfs along with 5µL of master mix, which consisted of 4µL of 5 x iScript reaction mix and 1µL of iScript reverse transcriptase. To reach a final volume of 20µL, Nuclease-free water was added in each sample. To confirm the absence of genomic DNA, additional samples were prepared in which iScript reverse transcriptase was not added. For cDNA synthesis, the complete reaction mix was incubated in a PCR thermal cycler (Bio Gene Rapid cycler, Idaho Technology, Idaho Falls, USA) using the protocol:

5 minutes at 25 oC, 30 minutes at 42 oC, 5 minutes at 85 oC, 5 minutes at 4 oC.

Following first strand synthesis, cDNA was transferred into new DNAse-RNAse free eppendorfs and stored in -20 oC until further analysis.

2.10.5 Assessing the optimal annealing temperature for each primer set

Primers for real-time PCR analyses were designed (primer sets are described in “Experimental procedures” of the results chapters) and the optimal annealing temperature for each primer set was determined by using an annealing temperature gradient between 55 and 62°C. An example is shown in figure 2.3. Real-time PCR reactions were performed on an iCycler Detection System using iQ SYBR Green Supermix (Bio-Rad, Hertfordshire, UK) and the specificity of the PCR products was determined by melt curve analysis and agarose gel electrophoresis.

Figure 2.2 Experimental determination of optimal annealing temperature for p67phox

(protein of the NADPH oxidase complex) transcript in GTN skeletal muscle. The PCR product corresponds to the amplicon size shown in table 2.1 below.

Primer Name (ID) Forward Primer Sequence Reverse Primer Sequence Amplicon Size (bp)

p67phox gaccttaaagaggccttgacg atgccaactgctcttctgct 160

Table 2.1 Sequences of the specific primers used for RT-PCR amplification of p67phox

in GTN skeletal muscle.