Topological and functional characterization of WbpM, an inner membrane UDP-GlcNAc C 6 dehydratase essential for lipopolysaccharide biosynthesis in Pseudomonas aeruginosa
Carole Creuzenet and Joseph S. Lam*
Department of Microbiology, University of Guelph, Guelph, Ontario, N1G 2W1, Canada.
Summary
WbpM is essential for the biosynthesis of B-band lipopolysaccharide (LPS) in many serotypes of Pseudomonas aeruginosa. Homologues that can functionally complement a wbpM null mutant and that are also necessary for virulence have been identified in numerous pathogenic bacteria. WbpM and most of its homologues are large membrane proteins, which has long hampered the elucidation of their biochemical function. This paper describes the detailed characterization of WbpM using bothin vivo and in vitro approaches. LacZ and PhoA fusion experiments showed that WbpM was anchored to the inner membrane via four N-terminal transmembrane domains, whereas the C-terminal catalytic domain resided in the cytoplasm. Although the membrane domains did not have any catalytic activity, comple- mentation experiments suggested that they were important for the polymerization of high-molecular- weight B-band LPS. The biochemical characterization of a soluble truncated form of WbpM, His-S262, showed that WbpM was a C6dehydratase specific for UDP-GlcNAc. It exhibited unusual low temperature (25 – 308C) and high pH (pH 10) optima. Although WbpM possessed an altered catalytic triad composed of SMK as opposed to SYK commonly found in other dehydratases, its catalysis was very efficient, with a kcat of 168 min21 and a kcat/Km of 58 mM21min21. These unusual physico-kinetic properties suggested a potentially different mechanism of C6dehydration for WbpM and its large homologues. His-S262 is now a precious tool for further structure – function studies.
Introduction
Pseudomonas aeruginosa is an opportunistic pathogen that can cause life-threatening infections in burn wound victims, immunocompromised individuals or patients affected by the genetic disease cystic fibrosis (Hancock et al., 1983). This Gram-negative bacterium produces a wide variety of virulence factors that are important at different stages of infection, including several toxins and surface carbohydrates. Among them, B-band lipopolysac- charide (LPS) has been recognized as essential for virulence and initial host colonization (Hancock et al., 1983; Cryz et al., 1984; Goldberg and Pier, 1996; Tang et al., 1996). Twenty different serotypes ofP. aeruginosa can be distinguished on the basis of the antigenic properties of their B-band LPS. Serotypes O6 and O11 are the most frequently represented in clinical isolates, whereas serotype O5 is the best studied at the molecular level. The gene clusters responsible for the biosynthesis of B-band LPS have been identified in these three serotypes (Burrowset al., 1996; Be´langeret al., 1999; Deanet al., 1999; Rocchettaet al., 1999). Our group has shown that the wbpM gene is essential for B-band LPS production not only in serotypes O5 and O6, but also in serotypes O3 and O10. Knock-out mutants ofwbpMin these serotypes all exhibited a deficiency in B-band biosynthesis and produced rough LPS (Be´langeret al., 1999; Burrowset al., 2000). In addition,wbpMhomologues that are essential for LPS or capsule biosynthesis have been found in numerous medically relevant bacteria. These include homologues found in Gram-negative bacteria, such as wlpL from Bordetella pertussis(Allen and Maskell, 1996) andwbcP fromYersinia enterocolitica (Skurnik et al., 1995; Zhang et al., 1996; 1997). In addition, a homologuecapD was identified in several serotypes of the Gram-positive bacterium Staphylococcus aureus(Lin et al., 1994; Sau and Lee, 1996; Sauet al., 1997). Importantly, a previous report by our group has shown thatwlpLandcap8Dcould complement awbpMmutant inP. aeruginosaand restore B-band LPS production (Burrows et al., 2000). Hence, deciphering the biochemical function of WbpM found in P. aeruginosa will provide valuable information for the understanding of the biosynthesis of complex carbo- hydrate structures such as LPS and capsule in a variety of Accepted 20 June, 2001. *For correspondence. E-mail jlam@
uoguelph.ca; Tel. (11) 519 824 4120, ext. 3823; Fax (11) 519 837 1802.
organisms. It will also contribute knowledge necessary for the design of therapeutic compounds that could be effective against several serotypes ofP. aeruginosaand against other bacteria that harbour awbpMhomologue.
This is particularly important in the case ofP. aeruginosa, which is intrinsically highly resistant to antibiotics because of the low permeability of its outer membrane, the presence of multidrug efflux pumps in its outer membrane and the presence of peripheralb-lactamases (Pooleet al., 1993; 1996; Srikumaret al., 1999; Limet al., 2001). It is also important in the case of S. aureus for which the emergence of methicillin resistant strains has been described recently (Archer and Bosilevac, 2001).
To date, the biochemical function of WbpM and its family of homologues is unknown. They all share a high level of homology with members of the short-chain dehydrogen- ase/reductase (SDR) family, such as sugar-nucleotide C4
epimerases (Jornvallet al., 1995; Frey, 1996; Creuzenet et al., 2000a). However, judging by the known surface carbohydrate structures available for the organisms in which WbpM or an essential homologue exists (Hoffman et al., 1980; Fournier et al., 1984; Knirel et al., 1985;
Knirel, 1990; Knirel and Kochetkov, 1994), these proteins appeared likely to be C6 dehydratases involved in the formation of 6-deoxy sugars including N-acetyl quinovo- samine (QuiNAc) or N-acetyl fucosamine (FucNAc) (Creuzenetet al., 2000b). The presence of four potential transmembrane domains at the N-terminus of these proteins has long hampered progress in their biochemical characterization. A refined sequence analysis revealed the existence of much shorter homologues that were devoid of hydrophobic domains (Creuzenetet al., 2000b).
These smaller homologues share conserved consensus sequences with the C-terminal half of WbpM. This suggested that the C-terminal half of WbpM was its catalytic domain. FlaA1 is one of these short soluble homologues found inHelicobacter pylori. Complementa- tion analysis in aP. aeruginosabackground showed that FlaA1 and WbpM were functionally equivalent. FlaA1 was found to be a unique bifunctional C6 dehydratase/C4
reductase specific for UDP-GlcNAc. The initial C6
dehydration results in the production of 4-keto, 6-deoxy UDP-GlcNAc, which is further reduced by FlaA1 itself into UDP-QuiNAc (Creuzenet et al., 2000b). Although these results provided the basis for predicting the enzymatic function of WbpM and the other large membrane homologues, several questions remained unanswered.
First, FlaA1 is exceptional in its bifunctional character, as no reductase activity has ever been reported to be associated with a C6dehydratase. It is not known whether WbpM and the other large homologues also share this particularity. The successful complementation of awbpM mutant by adding flaA1 in trans did not allow us to conclude whether WbpM was bifunctional or not. A
positive complementation could also be obtained if WbpM was only a UDP-GlcNAc C6 dehydratase and if the reduction step was performed by another enzyme.
Consequently, direct biochemical characterization of WbpM is needed to answer the question of its bifunctionality. Secondly, FlaA1 has been shown to be stereospecific in its reductase activity, so that it exclusively generates UDP-QuiNAc (Creuzenet et al., 2000b).
Although the LPS ofP. aeruginosaserotype O6 contains QuiNAc residues, the LPS ofP. aeruginosaserotype O5 and the capsule ofStaphylococcus aureusserotype O8 do not contain QuiNAc. Instead, they contain residues of the C4epimer of QuiNAc, FucNAc. Hence, the stereospeci- ficity of WbpMO5and of the Cap8D homologue needs to be determined. In addition, it is intriguing that the typical SYK catalytic triad found in most SDR enzymes and in all other C6dehydratases known to date is replaced by an SMK sequence in WbpM and its large homologues (Thorson et al., 1994; Jornvall et al., 1995; 1999; Marolda and Valvano, 1995; Ohyama et al., 1998; Rocchetta et al., 1998; Sullivan et al., 1998; Jornvall, 1999). Based on earlier studies of C4epimerases, the tyrosine residue of the catalytic triad is essential for the formation of a 4-keto derivative of the substrate (Frey, 1996; Thoden et al., 1996a; Thoden and Holden, 1998). Although the formation of the 4-keto intermediate has also been observed for C6
dehydration, the differences observed at the level of the catalytic triad suggest that the mechanism underlying its formation in C6 dehydratases of the WbpM family is different from that involved in C4epimerases and other C6dehydratases.
In this paper, we provide topological evidence to show that WbpM is anchored in the inner membrane, whereas its catalytic site resides in the cytoplasm. We also describe the functional analysis of WbpMin vivoin aP. aeruginosa background. In addition, despite the inherent difficulty in studying large membrane proteins at the biochemical level, we describe the overexpression and study of the activity of full-length WbpM in a membrane-bound state.
We also report the biochemical characterization of a soluble truncated version of WbpM in aqueous solution.
All the data presented here will contribute to the understanding of the functional particularities of the large membrane homologues that are found in medically relevant bacteria.
Results
Overexpression of WbpM inEscherichia coliand comparison with native WbpM fromP. aeruginosa WbpM from P. aeruginosa serotype O5 (PAO1) was overexpressed in E. coli with an N- or C-terminal hexahistidine tag (His-WbpM and WbpM-His respectively).
The overexpressed products were detected as bands of apparent molecular mass 63 and 64 kDa, respectively, instead of the expected 75.8 and 78.8 kDa (Fig. 1).
Similarly, a 13 kDa discrepancy between the expected and obtained protein size was observed when WbpM from P. aeruginosaserotype O6 or Cap8D fromS. aureuswere overexpressed in the same systems. The presence of the histidine tag in all expression products was confirmed by Western immunoblotting using an antihexahistidine mono- clonal antibody (mAb). When a truncated version of WbpM in which the putative membrane domains were removed was overexpressed, the corresponding protein (His-L133, amino acids 133 – 675 of WbpM) had an apparent molecular mass of 60 kDa, which was identical to the expected size (Fig. 1). This suggested that the hydro- phobic domains present at the N-terminus of WbpM were responsible for the anomalous migration of His-WbpM and WbpM-His on SDS – PAGE gels and that the full-length proteins were expressed in each case.
Western immunoblotting analysis using a polyclonal antiserum raised against His-L133 showed that the native WbpM detected in the membrane fraction of PAO1 appeared to be 12 – 13 kDa shorter than expected (Fig. 1) and exhibited a size similar to that of overexpressed WbpM produced inE. coli. Altogether, these data indicated that the products obtained after overexpression of WbpM inE. colicorresponded to the full-length proteins.
Membrane localization of native and overexpressed WbpM
Native WbpM is only produced at low levels and could only be detected in the membrane fraction of P. aeruginosa (Fig. 1). This confirmed that WbpM was a membrane protein inP. aeruginosa, as suggested by the presence of putative transmembrane domains at its N-terminus. After overexpression inE. coli, both His-WbpM and WbpM-His were also entirely targeted to the membrane (Fig. 2). This indicated that the presence of the tag did not prevent the insertion of the protein into the membrane, even when the tag was located in the close proximity of the membrane domains (His-WbpM). In addition, WbpM was fully recovered in the soluble fraction after selective solubil- ization of the inner membrane by lauryl sarcosine (Filip et al., 1973). This indicated that WbpM was most probably an inner membrane protein (data not shown).
Topology of WbpM in the inner membrane
As indicated above, overexpressed His-WbpM is effi- ciently targeted to the membrane. Consequently, the topological mapping of WbpM was accomplished using reporter proteins fused to the C-terminus of His-WbpM.
The reporter proteins were alkaline phosphatase (PhoA) and b-galactosidase (LacZ), which are markers for periplasmic and cytoplasmic localization respectively (Manoil, 1991). The results indicated that amino acids D45 and S109 were exposed into the periplasmic space, whereas residues M78 and S147 resided in the cytoplasm (Fig. 3). Obtaining positive results with the cytoplasmic marker LacZ at residues M78 and S147 excludes the possibility that WbpM would be integrated in the outer membrane and confirms its inner membrane localization.
Altogether, the data indicate that the four putative transmembrane domains (amino acids 20 – 41, 51 – 73, 84 – 106 and 117 – 134) cross the cytoplasmic membrane entirely, and that the orientation is such that the N-terminus of the protein is located in the cytoplasm.
Sequence analysis revealed the existence of four additional hydrophobic domains located between amino acids 164 and 180, 303 and 321, 405 and 423 and 475 and 492. The significant levels of LacZ activity observed with the G170 – S312 – , V418 – and N482 – LacZ fusions Fig. 1.SDS – PAGE analysis of overexpressed WbpM produced in
E. coliand comparison with native WbpM fromP. aeruginosa. WbpM (His-WbpM) and a truncated version devoid of membrane domains (His-L133) were overexpressed with an N-terminal hexahistidine tag in the pET system usingE. coliBL21(DE3)pLys as a host. WbpM was also expressed with a C-terminal hexahistidine tag (WbpM-His) in the Topo-pBAD system usingE. coliTop10 as a host. After 2 h of induction, whole cells were analysed by SDS – PAGE. Cells from the sameE. colihosts harbouring a control plasmid (nowbpMgene) are shown as negative controls (labelled none). Whole cells (Tot) or membranes (Mbn) of wild type (PAO1) and awbpMknock-out mutant (wbpM::Gm) ofP. aeruginosawere also analysed simultaneously.
Detection was performed by Coomassie staining or by Western immunoblotting using the monoclonal anti-His6antibody or the anti- His-L133 polyclonal antiserum.
generated within these hydrophobic domains confirmed that they were not involved in anchoring the protein in the inner membrane (Fig. 3). Finally, the positiveb-galactosi- dase activity obtained with the R345 – and Y647 – LacZ fusions, together with the positive activity obtained with the S312-, V418-, and N482-LacZ fusions, confirmed that the putative catalytic domain of WbpM (amino acids 286 – 665) resides in the cytoplasm (Fig. 3).
Mapping of the catalytic domain by complementation analysis inP. aeruginosa
To map the catalytic domain of WbpM, the possibility of complementing awbpMknock-out mutant ofP. aeruginosa (Burrowset al., 1996) by various truncated and tagged forms of WbpM was investigated. The reactivity of a mAb specific for O5 B-band LPS (MF15-4) with the LPS of the strains complemented by His-WbpM or WbpM-His
showed that both forms of the enzyme were catalytically active despite the presence of a histidine tag at either end of the sequence (Fig. 4). If their enzymatic activity was partial or altered, the synthesized sugar would not be recognized by the mAb M15-4, and they would most probably not even be assembled into an LPS molecule because of the high specificity of the transferases involved. To confirm that the membrane domains (amino acids 1 – 132) were devoid of catalytic activity and that the catalytic domain of WbpM was limited to its C-terminal half (amino acids 285 – 665), two N-terminally histidine-tagged truncated versions of WbpM were designed: His-L133 and His-V285 (Fig. 5). They were both able to complement the knock-out mutation of wbpM, as demonstrated by the restoration of the production of LPS that reacted with the B-band-specific monoclonal antibody (Fig. 4). These results indicated that the membrane domains and the stretch of amino acids 133 – 285 of as yet unknown function were not required for catalytic purposes, and that the C-terminal half of WbpM contained its catalytic domain.
Investigation of the role of the transmembrane domains of WbpM on LPS polymerization by complementation analysis inP. aeruginosa
Although the catalytic activity was recovered in all complementation assays described above, only the wbpM mutant complemented with C-terminally tagged WbpM (WbpM-His) showed an LPS banding profile identical to wild-type LPS, with a typical bimodal distribution. On the contrary, the bacteria complemented with N-terminally tagged WbpM (His-WbpM) produced LPS that showed a changed modal distribution and lacked the high-molecular-weight B-band LPS (Fig. 4). The same result was obtained when complementation was per- formed with His-L133 and His-V285, which both lacked the transmembrane domains. The observations were repro- ducible and were not caused by differences in the amounts of samples loaded. These data suggested that the membrane domains of WbpM could modulate the polymerization of high-molecular-weight B-band LPS by their presence and/or proper packing in the inner membrane.
Biochemical activity of full-length WbpM in a membrane- bound form
The C-terminus of WbpM is highly homologous to FlaA1, a UDP-GlcNAc C6dehydratase found inHelicobacter pylori (Creuzenetet al., 2000b) that produces UDP-QuiNAc via the formation of a 4-keto, 6-deoxy intermediate. Conse- quently, the potential C6 dehydratase activity of WbpM was investigated. For this purpose, membranes in which Fig. 2.SDS – PAGE analysis of overexpressed WbpM showing its
targeting to the membrane. WbpM carrying an N-terminal (His-WbpM) or a C-terminal (WbpM-His) hexahistidine tag was recovered in the membrane fraction (M) of the cells after overexpression. Membranes obtained from the sameE. colihost harbouring a control plasmid (no wbpMgene) are shown as negative controls (labelled none). The overexpressed proteins could be purified (P) to near homogeneity by a single step of nickel chelation chromatography after solubilization in Triton X-100. Detection was performed as indicated in the legend to Fig. 1.
overexpressed His-WbpM represented 50% of the total proteins (Fig. 2) were assayed for UDP-GlcNAc C6
dehydratase activity under the optimal conditions estab- lished previously for FlaA1 (pH 7.0, 378C, no cofactor). A peak potentially corresponding to the expected UDP- QuiNAc was identified by capillary electrophoresis (CE) analysis (Fig. 6A, line b, peak 3). This peak corresponded to 3.8% of substrate conversion as determined by surface area integration. This peak was not present when the reactions were carried out with membranes prepared from the sameE. colihost that harboured a control pET plasmid only (nowbpMgene; Fig. 6A, line a). This indicated that the formation of this product resulted specifically from the activity of His-WbpM. In addition, the yield of the reaction was dependent on the amount of membrane-bound enzyme present. It could be increased up to 29.8% when higher amounts of WbpM-containing membrane prep- arations were used (Fig. 6A, lines c and d). The reaction yield could also be considerably increased (from 3.8% up to 9.5%) with the addition of exogenous NAD1 to the reaction mixture (Fig. 6A, line c). The pH dependence was also determined for the enzyme activity of His-WbpM. A shift from pH 7 to pH 10 increased the activity ninefold when the substrate was present in excess (Fig. 6B).
Complete utilization of the substrate UDP-GlcNAc was achieved when large amounts of membrane-bound WbpM enzyme were used under optimal pH conditions (pH 10) (Fig. 6B, line d). At both pH 7 and pH 10, when large amounts of membrane preparations were used, a small additional peak potentially corresponding to 4-keto, 6-deoxy, UDP-GlcNAc was observed (peak 2). However, this peak might also correspond to background activity
resulting from the presence of other UDP-GlcNAc- modifying enzymes associated with the membranes (Creuzenetet al., 2000a). This would explain why peak 2 was not discerned when low membrane concentrations were used. Finally, the broad peak observed at 14.5 min arises from the commercial NAD1 used for these experiments and is not related to enzymatic function.
Similarly, it was possible to obtain activity with WbpM- His at pH 10 and in the presence of exogenous cofactor NAD1(Fig. 7B, lines a and c). However, the reaction yields were lower with WbpM-His than with His-WbpM at equal amounts of membrane preparations used per reaction.
These different catalysis yields are probably the result of different contents of overexpressed protein in the membrane preparations (Fig. 2).
As mentioned above, the reaction product obtained with membrane-bound WbpM was expected to be UDP- QuiNAc based on its migration profile on CE. The identity of the reaction product generated by His-WbpM and WbpM-His was confirmed by co-migration with standard UDP-QuiNAc at different concentrations. Because no commercial UDP-QuiNAc is available, a UDP-QuiNAc standard previously characterised by mass spectrometry analysis was obtained by reaction of FlaA1 with UDP- GlcNAc (Creuzenetet al., 2000b). We have demonstrated previously that the CE technique used provides exquisite resolution for differentiating between closely related sugar- nucleotides (Creuzenetet al., 2000a,b). Consequently, the observation that a single peak was obtained when the UDP-QuiNAc standard was co-injected with the product generated by His-WbpM or WbpM-His indicated that UDP- QuiNAc was the reaction product (Fig. 7A and B, line d).
Fig. 3.Topological model of WbpM based on WbpM – PhoA and WbpM – LacZ fusion analysis and computer prediction data (TM-PREDICT
program). The transmembrane domains are represented by hatched boxes and are predicted to assume ana-helical structure. The secondary hydrophobic domains are
represented by open boxes. The amino acid position at the boundaries of each hydrophobic segment is indicated. The terminal amino acids of WbpM that were fused to either PhoA or LacZ are represented by a black dot accompanied by the amino acid name and position (e.g. S109).
The results for the PhoA assay (two independent assays with triplicate measurements) are indicated in alkaline phosphatase units (Danielset al., 1998) for each fusion in a hexagon. The results for the LacZ assay (two independent assays with triplicate measurements) are indicated in Miller units (Danielset al., 1998) for each fusion in a circle. Accession number for WbpM is AAC45867.
Therefore, these results clearly indicated that WbpM has the same biochemical activity as its short homologue FlaA1. It is bifunctional and proceeds to both C6
dehydration and C4reduction of UDP-GlcNAc. However, contrary to what was observed for FlaA1, hardly any 4-keto, 6-deoxy UDP-GlcNAc intermediate was released during catalysis with WbpM. This indicated that WbpM had a more efficient reductase activity than FlaA1. In addition, these results showed that WbpM has the same stereo- specificity as FlaA1 and formed UDP-QuiNAc exclusively.
The membrane domains and stretch of amino acids 133 – 284, which are not found in FlaA1, did not confer WbpM with additional catalytic properties, as no other new product was detected by CE analysis.
Expression and purification of truncated forms of WbpM Meaningful kinetic data cannot be derived from membrane- bound enzyme preparations that might contain variable amounts of enzyme and/or contaminating enzymatic activities. Consequently, both His-WbpM and WbpM-His were purified by metal chelation after solubilization in Triton X-100 (Fig. 2). However, the recovered proteins were totally inactive. Because the results described above showed that the N-terminal half of WbpM (amino acids 1 – 284) did not confer the protein with any catalytic properties, the design of soluble truncated versions of WbpM was investigated as a potential alternative. Five truncated versions of WbpM that were devoid of transmembrane domains were designed. Each of them carried an N-terminal hexahistidine tag (Fig. 5). As described above,in vivocomplementation showed that the longest
Fig. 5.Schematic representation of WbpM and its truncated versions. The conserved domains (1 – 5) identified with theMEMEMASTsearch program in our earlier study (Creuzenetet al., 2000b) are represented by numbered boxes. The transmembrane domains of WbpM are indicated (M) as well as the N-terminal histidine tag (H). For comparison, the conserved domains are also indicated for the homologue FlaA1. Drawings are not to scale.
Fig. 4.Complementation of the production of B-band LPS by different tagged and/or truncated forms of WbpM in a WbpM knock-out mutant (wbpM::Gm) ofP. aeruginosa(PAO1). The LPS were analysed by SDS – PAGE and visualized by silver staining or by Western immunoblotting using monoclonal antibodies specific for A-band (N1F10) or B-band (MF15 – 4) LPS.
and the shortest derivatives of the series (His-L133 and His-V285) were catalytically active. This suggested that the overexpressed truncated forms of WbpM should be biochemically active. The five truncated WbpM versions were overexpressed in the pET system. The expression yields ranged from 2% to 5% up to 60% of total cellular proteins (Fig. 8). The identity of the proteins expressed and the presence of the histidine tag were confirmed by Western immunoblotting using the anti-His-L133 and antihistidine tag antibodies respectively. Although each truncated version was predicted to be soluble and stable, only His-S262 yielded soluble protein. The overexpressed protein was purified to homogeneity in a single step of nickel chelation affinity chromatography (Fig. 9). Typically, 10 mg of pure protein could be obtained from 900 ml of induced culture. The identity of the purified protein was confirmed by mass spectrometry analysis (MALDI-TOF) after trypsinolysis of the protein (data not shown).
Biochemical characterization of purified His-S262 The biochemical activity of purified His-S262 was
investigated under several conditions. As described for the full-length, membrane-bound WbpM, the production of a peak potentially corresponding to UDP-QuiNAc was observed by CE analysis after reaction of His-S262 with UDP-GlcNAc in the presence of NAD1(Fig. 10, lines a and b). The reaction product co-migrated with the UDP- QuiNAc standard generated by reaction of FlaA1 with UDP-GlcNAc (Fig. 10, lines c and d). As the reactions were performed using pure His-S262 enzyme, we were able to confirm that the reaction product was indeed a 6-deoxy derivative of UDP-GlcNAc by CE/MS and MS/MS analyses (data not shown).
The activity of His-S262 was dependent on the amount of enzyme added (Fig. 11A). The optimal temperature for activity of His-S262 was found to be unusually low, being in the range 25 – 308C (Fig. 11B). His-S262 exhibited an unusual pH dependence (Fig. 11C). Very little substrate conversion was observed from pH 5.0 to pH 8.5. However, above pH 8.5, a small increase in the pH resulted in a considerable increase in activity. The activity was optimal at the highest pH tested, pH 10. The higher pH not only affected the total yield of substrate conversion but also
Fig. 7.Capillary electrophoresis comparison of the reaction products obtained with membrane- bound His-WbpM or WbpM-His with those generated by the UDP-GlcNAc
C6-dehydratase/C4reductase FlaA1. All reactions were performed for 3 h with 1.5 mM UDP-GlcNAc as the substrate.
A. His-WbpM, no NAD1. B. WbpM-His,10.28 mM NAD1.
Line a: control membranes, no enzyme. Line b:
FlaA1. Line c: membranes containing His- WbpM (A) or WbpM-His (B). Line d: co- migration of samples from lines b and c. Peak 1:
UDP-GlcNAc. Peak 2: 4-keto, 6-deoxy intermediate. Peak 3: UDP-QuiNAc.
Fig. 6.Capillary electrophoresis analysis of the activity of membrane-bound His-WbpM at pH 7 (A) or pH 10 (B). All reactions were performed for 3 h with 1.5 mM UDP-GlcNAc as the substrate. Line a: control membranes, no enzyme,10.28 mM NAD1. Line b: 14mg of membranes containing His-WbpM, – NAD1. Line c: 14mg of membranes containing His- WbpM,10.28 mM NAD1. Line d: 70mg of membranes containing His-WbpM,10.28 mM NAD1. Peak 1: UDP-GlcNAc. Peak 2: 4-keto, 6-deoxy intermediate. Peak 3: UDP-QuiNAc.
increased the rate of catalysis (Fig. 11D). The kinetic parameters (Km, Vmax) were determined under optimal activity conditions (pH 10, 308C, in the presence of excess cofactor) and are described in Table 1.
His-S262 was found to be specific for UDP-GlcNAc, as no catalysis was observed using closely related substrates such as UDP-Glc, UDP-GalNAc or UDP-Gal. No catalysis was obtained either with substrates of other known C6
dehydratases such as GDP-mannose, dTDP-Glc and CDP-Glc.
Discussion
WbpM is an enzyme essential for the biosynthesis of B-band LPS in several serotypes of P. aeruginosa.
Although several putative functions have been postulated for WbpM and its homologues in the literature (Burrows et al., 1996; 2000), no biochemical evidence has been provided for any of them. These enzymes exhibit high levels of homology to C4epimerases. However, analysis of available LPS and capsule structures suggested that they were C6dehydratases. The recurring ambiguity resulting from these contradictory observations called for precise biochemical evidence. The difficulty in studying WbpM and its homologues resided in the presence of transmembrane
domains that resulted in an anomalous migration of the overexpressed and native WbpM on SDS – PAGE gels.
Cellular fragmentation experiments indicated that WbpM was inserted in the membrane. The recovery of WbpM in the lauryl sarcosyl-solubilized fraction and the results from the topological characterization of WbpM using LacZ and PhoA fusions confirmed that WbpM was localized in the inner membrane. The topological characterization of WbpM also showed that the C-terminus resided in the cytoplasm and was not associated further with the membrane despite the presence of additional hydrophobic segments. This is an important finding that indicates that it should be possible to produce short soluble and active versions of WbpM. They would be useful for future pursuit of the structure of the enzyme by X-ray crystallography and for the design of inhibitors against this potential therapeutic target.
The reason why WbpM is anchored to the inner membrane is not yet known. The in vitro study of the catalytic activity of membrane-bound WbpM indicated that the membrane domains were devoid of any catalytic activity.
This was consistent with the mapping of the catalytic domain that was performedin vivo by complementation analysis and also showed that targeting to the membrane was not essential for catalytic purposes. In addition, the membrane localization of WbpM is intriguing considering that the substrate and product of the enzyme are soluble cytoplasmic components, and that other enzymes that produce sugar constituents of B-band LPS are predicted to be soluble and to reside in the cytoplasm. However, during LPS biosynthesis, the synthesized sugar monomers are ligated to a membrane-bound undecaprenol-phosphate acceptor (Whitfield, 1995). Consequently, it is possible that WbpM acts as a membrane anchor to recruit a
Fig. 9.Overexpression and purification of His-S262 as analysed by SDS – PAGE. Whole cells (Tot) ofE. coliharbouring a control plasmid only (/) or the His-S262 construct (His-S262) were analysed by SDS – PAGE. Detection was performed by Coomassie staining or by Western immunoblotting using an anti-His6antibody. The
overexpressed His-S262 was purified to homogeneity in a single step of nickel chelation by FPLC (Pur).
Fig. 8.SDS – PAGE analysis of overexpressed truncated versions of WbpM. All truncated versions were overexpressed with an N-terminal hexahistidine tag in the pET system usingE. coliBL21(DE3)pLys as a host. After 2 h of induction, whole cells were analysed by SDS – PAGE and detected as indicated in the legend to Fig. 1. For all proteins, the observed size corresponded to the expected size.
biosynthetic complex to the membrane in the close vicinity of the final membrane-bound acceptor. The existence of a membrane-associated biosynthetic complex would also be consistent with the fact that LPS biosynthesis is very
sensitive to changes in growth conditions (Creuzenetet al., 1999). This could reflect the disruption of specific interactions within a biosynthetic complex. Consistent with these hypotheses, ourin vivocomplementation data showed that the membrane domains were not necessary for catalysis, and that their presence and/or correct packing in the inner membrane was essential to restore wild-type-like LPS patterns with full assembly of the high- molecular-weight LPS. The altered LPS banding patterns obtained with His-WbpM, His-L133 and His-V285 were reminiscent of the phenotypes observed when the chain length regulatorwzz2was inactive (Matewishet al., 1998), or when the organism was cultivated under abnormal growth conditions (high pH, temperature, osmolarity, ionic strength; Makin and Beveridge, 1996; Creuzenet et al., 1999). Hence, it is possible that the membrane domains of WbpM and/or the small loops that they delineate are involved in interactions with other enzymes of the biosynthetic and assembly pathway, such aswzz2, or with regulatory enzymes. Alternatively, it is possible that the membrane domains only play an anchoring role, and that interactions with other enzymes of the complex involve the C-terminal half of WbpM. Probing of potential interactions between WbpM and other enzymes of the LPS biosyn- thetic machinery is under investigation using biosensor and cross-linking technologies.
Fig. 11.Physico-kinetic characterization of the UDP-GlcNAc C6dehydratase activity of His- S262 as measured by capillary electrophoresis.
All reactions were performed for 15 min at 378C, pH 7.0, with 0.75 mM UDP-GlcNAc and 1mg of enzyme unless otherwise stated.
A. Dependency of the activity on the enzyme amount present in the reaction.
B. Temperature dependency of the activity.
A and B. The results are the average of two independent experiments.
C. pH dependency of the activity. Reactions were performed using sodium acetate (20 mM) for pH 5 – 6.5 (black circles) and bis-Tris- propane for pH 6.5 – 10 (open circles).
D. Time course of UDP-GlcNAc dehydration by His-S262 as a function of pH.
C and D. Several experiments were performed with varying concentrations of enzymes. The data presented are one example obtained with 1mg of enzyme.
Fig. 10.Capillary electrophoresis analysis of the UDP-GlcNAc C6
dehydratase activity of purified His-S262. Line a: UDP-GlcNAc only, no enzyme. Line b: UDP-GlcNAc1His-S262. Line c: UDP- GlcNAc1FlaA1. Line d: co-migration of samples from lines b and c.
Peak 1: UDP-GlcNAc. Peak 2: 4-keto, 6-deoxy intermediate. Peak 3:
UDP-QuiNAc.
The presence of transmembrane domains has rendered the biochemical characterization of WbpM and its homologues very difficult and has long limited the extent of analyses that could be achieved. Until now, only FlaA1, the short soluble homologue of WbpM that is found in Helicobacter pylori, had been characterized fully. How- ever, determining the precise biochemical function of WbpM was of fundamental significance, as it had implications for the general biosynthetic pathways pro- posed for LPS and capsules. Our data showed that WbpM was also a bifunctional UDP-GlcNAc C6dehydratase/C4
reductase that exclusively produces UDP-QuiNAc. The substrate specificity and the stereospecificity of product formation imply that another enzyme is responsible for the conversion (C4epimerization) of UDP-QuiNAc into UDP- FucNAc for B-band LPS biosynthesis in serotype O5. The B-band LPS gene cluster ofP. aeruginosacontains a gene called wbpK that encodes a putative C4 epimerase (Burrows et al., 1996). Its biochemical activity is under investigation. It is noteworthy to point out that WbpK is not present in serotype O6 (Be´langeret al., 1999), in which UDP-QuiNAc is incorporated directly into the tetrasac- charide repeating unit of the LPS and where, conse- quently, C4 epimerization activity is not necessary. In addition, the finding that WbpM was bifunctional and proceeded to C4 reduction of the 4-keto intermediate prompts the need to investigate the biochemical activity of WbpB. WbpB is a putative oxidoreductase encoded by the LPS biosynthetic gene cluster ofP. aeruginosaserotype O5 (Burrowset al., 1996). It was previously thought to catalyse the reduction step involved in the formation of UDP-QuiNAc. In view of our results with WbpM, this functional assignment for WbpB seems redundant. The analysis of the genome ofP. aeruginosa suggests that functional redundancy might not be unusual in this organism, as several copies of the same gene are frequently observed (Matewishet al., 1998; Stoveret al., 2000). However, WbpB and WbpM exhibit very limited sequence homologies and WbpB does not have any homologue inP. aeruginosa serotype O6 that produces QuiNAc. Consequently, the biochemical function of WbpB needs to be reconsidered and verified experimentally.
The detailed physico-kinetic analysis performed on the
soluble form of WbpM, His-S262, revealed significant differences from its homologue from H. pylori, FlaA1 (Creuzenet et al., 2000b). In particular, His-S262 shows very unusual physical parameters for optimal activity, with a low optimal temperature (25 – 308C) and very high pH optimum (pH 10). His-S262 also exhibited a strong requirement for NAD1, whereas no addition of exogenous cofactor was necessary to obtain full activity of FlaA1.
Altogether, these unexpected particularities of WbpM might also have hampered elucidation of the enzymatic activity of the large homologues.
The unusually low optimal temperature displayed by WbpM could reflect the fact thatP. aeruginosacan survive in the outside environment, whereas H. pylori is exclusively found in the human stomach (Mobley, 1997;
Karlsson, 2000). The sharp decline in the activity of His- S262 with increasing temperatures above 308C could play a role in the regulation of B-band LPS expression in P. aeruginosa. In liquid cultures, the assembly of high- molecular-weight B-band LPS of P. aeruginosa is abolished at elevated temperatures (458C) (Makin and Beveridge, 1996; Creuzenet et al., 1999) and can be restored to normal levels within minutes by shifting to lower temperatures (,378C). During this process, the level of expression of WbpM is constant (Creuzenetet al., 1999).
These changes in LPS assembly correlate well with the observed modulation of activity of WbpM with respect to temperature changes. In addition, in P. aeruginosa, B-band LPS is essential in the initial steps of host colonization but disappears progressively once the infection is established (Lam et al., 1989; Govan and Deretic, 1996). Consequently, it is possible that the regulation of activity of WbpM by the temperature participates in the differential expression of LPS at different stages of host colonization.
The kinetic analysis of His-S262 has revealed additional unexpected novel features compared with the short homologue FlaA1. Although the affinity of His-S262 for the substrate was lower than that of FlaA1, the rate of catalysis was much higher. As a result, a much higher catalysis efficiency is observed in His-S262 than in FlaA1 when each of these enzymes is used under conditions that are optimal for their respective activity.
Table 1.Kinetic parameters for His-S262 determined for the substrate UDP-GlcNAca – c. Km
(mM)
Vmax
(nmol min21)
Enzyme (pmol)
kcat
(min21)
kcat/Km
(mM21min21)
2.77^0.006 1.65^0.13 10.2 168^14 58^5
a.Reactions were performed in the presence of excess cofactor (0.14 mM NAD1) at 308C and pH 10 as described inExperimental procedures.
b.The results are the average of two independent experiments in which 11 data points were collected in duplicate for substrate concentrations ranging from 0.05 to 3.5 mM.
c.Analysis was performed by capillary electrophoresis, and the percentage of substrate conversion was determined by integration of the surface area of the substrate and product peaks.
A close examination of the sequence of WbpM and of other large homologues revealed a potential explanation for these physico-kinetic differences. Of particular signifi- cance is the fact that most members of the short-chain dehydrogenase/reductase (SDR) family share a con- served catalytic triad composed of S(X)nY(X)3K (Jornvall et al., 1995). This is also the case in FlaA1. Extensive site- directed mutagenesis and crystallography data on the C4
epimerase GalE, a typical member of the SDR family (Swanson and Frey, 1993; Thodenet al., 1996a,b,c; 1997;
Thoden and Holden, 1998), demonstrated that the tyrosine present in the catalytic triad was essential for activity.
Specifically, in C4 epimerases, the tyrosine acts as a catalytic base that is involved in abstracting a proton from C4 of the sugar ring and transferring it to the acceptor cofactor molecule. This charge transfer interaction between the tyrosine and the cofactor NAD1is known as a critical step in the formation of the 4-keto intermediate. In the absence of tyrosine residue within the catalytic triad, a shift in pH optimum towards very basic values is observed, as demonstrated with the Y149F mutant of the C4
epimerase GalE (Liuet al., 1996; 1997). By extension, it is widely accepted that the same mechanism is shared by C6 dehydratases. However, WbpM and the other large homologues, such as Cap8D, WbcP and WlbL, exhibit an altered catalytic triad in which the tyrosine residue is substituted for a methionine (Linet al., 1994; Skurniket al., 1995; Allen and Maskell, 1996; Sau and Lee, 1996; Zhang et al., 1996; 1997; Sau et al., 1997). Very efficient C6
dehydration was consistently obtained using WbpM.
However, the unusual pH dependence observed for WbpM supports the fact that the methionine residue in the triad does not play the role of a catalytic base demonstrated for the tyrosine. Consequently, either another residue, yet to be identified, plays the role of a catalytic base in WbpM or the mechanism for C6
dehydration by WbpM and other homologues that harbour an altered SMK catalytic triad is different from the mechanism inferred from earlier studies on C4epimerases and does not involve the formation of a 4-keto intermediate. Although this would be consistent with the fact that no released 4-keto intermediate is observed with WbpM, it is highly unlikely that none is formed considering the following observations. First, previous studies using FlaA1 have shown that enzyme preparations of high specific activity release little or no 4-keto intermediate, although its formation during the catalytic process has been demonstrated clearly (Creuzenetet al., 2000b). In the case of WbpM, the kinetic analysis reported in this paper has shown that WbpM was much more efficient than FlaA1, which could explain how the 4-keto intermediate is formed but not released. Secondly, site-directed mutagen- esis data performed on FlaA1 indicate that an altered SMK triad still supports the efficient formation of a 4-keto
intermediate (unpublished data). All this supports our interpretation that WbpM is bifunctional and that its activity involves the formation of a 4-keto intermediate, but the mechanism involved in its formation is different from that established previously for other enzymes. Further characterization of the mechanism for C6-dehydration in this subset of novel C6dehydratases will be investigated with His-S262 as a model enzyme using a combination of site-directed mutagenesis, circular dichroism and crystallography approaches.
In conclusion, despite the inherent difficulty in studying large membrane proteins such as WbpM, we were able to perform a detailed characterization of this enzyme bothin vivoand in vitro. The data presented in this paper have confirmed that the protein was anchored to the inner membrane. However, the transmembrane domains did not have any catalytic properties. Our data suggested that they could play a role in regulating LPS assembly, possibly by recruiting a multienzyme biosynthetic complex to the inner membrane. The biochemical characterization of the soluble truncated form of WbpM, His-S262, clearly showed that WbpM was a C6 dehydratase specific for UDP-GlcNAc. It has also revealed unusual and novel features for this enzyme with regard to its physico-kinetic properties that suggest a potentially novel mechanism for C6dehydration in WbpM and its large homologues. His- S262 is now a precious biochemical tool that will allow further investigation of this mechanism via structural studies and site-directed mutagenesis approaches. It will also be valuable for the development of potential inhibitors against WbpM and its homologues.
Experimental procedures Materials
Unless otherwise stated, all chemical reagents used were from Sigma. Restriction enzymes and T4 DNA ligase were from Life Technologies.Pwoand Expand DNA polymerases were from Roche Molecular Biochemicals. Unless otherwise stated, all cloning was performed inE. coliDH5a. The penta- His antihistidine tag antibody was from Qiagen. All the kits or enzymes were used according to the manufacturer’s instructions. Protein quantification was performed using the BCA reagent (Pierce). The sequence of WbpM was previously deposited in GenBank no. AAC45867.
Cloning and overexpression of His-WbpM in the pET system
WbpM was cloned in a pET23 derivative (Newton and Mangroo, 1999) with an N-terminal histidine tag. The sequences of primers used to amplifywbpMby polymerase chain reaction (PCR) from genomic DNA (strain PAO1) were 50-ACTGTACATGTCGATGTTGGATAATTTGAGG-30 and 50-AATATGGATCCTCAGGGTTCTCGCCGCCTC-30 for the
top and bottom primers respectively. The PCR reaction consisted of 100 ng of genomic DNA, 0.5mM each primer, 0.25 mM each dNTP, 4 mM MgCl2and 1buffer in a total of 50ml. A 5 min denaturation at 948C was carried out before the addition of DNA polymerase (1.5 units of Pwo). This was followed by 25 cycles of 1 min at 948C, 45 s at 438C and 90 s at 728C. A final 7 min elongation was performed at 728C. The PCR product was cut withAflIII andBamHI and ligated into the pET23 derivative previously digested with NcoI and BamHI. The constructs obtained were checked by restriction analysis and sequencing. The construct was subsequently transformed into the expression strain BL21(DE3)pLysS (Novagen) with ampicillin (100mg ml21) and chloramphenicol (35mg ml21) selection. For the expression of His-WbpM, 6 ml of an overnight culture were inoculated into 300 ml of LB in the presence of ampicillin and chloramphenicol. The culture was grown at 378C. When the OD600 reached 0.6, IPTG (Promega) was added to a final concentration of 1 mM, and expression was allowed to proceed overnight at 378C. The cells were harvested by centrifugation at 5000gfor 15 min at 48C, and the pellet was immediately processed for membrane preparations without prior freezing. Expression was mon- itored by SDS – PAGE analysis, with Coomassie blue staining or Western immunoblot using the penta-His antihistidine tag antibody or the adsorbed anti-His-L133 antiserum (see below).
Cloning and overexpression of truncated versions of WbpM in the pET system
The truncated versions of WbpM were cloned in theNcoI and BamHI sites of the pET23 derivative (Newton and Mangroo, 1999) with an N-terminal histidine tag. The gene fragments were amplified from the full-length His-WbpM/pET construct by PCR using the polymerase Expand. For all the constructs, the 30primer was the same as for cloning of His- WbpM in the pET construct. The 50 primers were: 50-ACT TTACATGTTGCGTCTGGCCATGC G-30 for His-L133;
50-ACTGTACATGTCACGTCTCGGTCGGGCGATG-30 for His-R182; 50-ACTGTACATGTCCGCCACTCGAGCCCG-30 for His-S234; 50-ACTGTACATGTCCGGCCGGGTCAA GGTGG-30 for His-S262; and 50-ACTTTAC ATGTCCGTCG CACCGCGCAAGGAG-30 for His-V285. The PCR was performed as described above except that elongation was performed at 688C and the annealing temperature was 558C.
The constructs obtained were checked by restriction analysis and sequencing. Protein expression was carried out using the strain BL21(DE3)pLysS (Novagen) grown in Luria broth at 378C or 308C or in Terrific broth at 378C. Protein expression was induced by the addition of 0.15 – 0.50 mM IPTG. After 3 h induction, the cells were harvested by centrifugation at 5000g for 15 min at 48C, and the pellets were frozen at2208C.
Cloning and overexpression of WbpM-His in the Topo-pBAD system
PCR amplification of WbpM from genomic DNA was performed using the Expand enzyme with annealing at 428C. The primers used were 50-ATGTTGGATAATTTGAGG A-30and 50-GGGTTCTCGCCGCCTCTG-30. The PCR product
was cloned directly into the Topo-pBAD vector as instructed by the manufacturer. All cloning was performed under repressing conditions (0.2% glucose). Expression was performed inE. coli Top10. For protein expression, 6 ml of an overnight culture in 100mg ml21LB – ampicillin and 0.2%
glucose was inoculated into 300 ml of fresh LB in the presence of ampicillin and glucose. The culture was grown at 378C.
When the A600reached 0.6, arabinose was added to a final concentration of 0.2%, and expression was allowed to proceed overnight at 378C. Cells were harvested by centrifugation at 5000gfor 15 min at 48C, and the pellet was immediately processed for membrane preparations without prior freezing.
In vivocomplementation inP. aeruginosa
For cloning His-WbpM, His-L133 and His-V285 into the shuttle vector pUCP26 (Westet al., 1994), theXbaI –BamHI fragment containing His-L133 or His-V285 was excised from the corresponding pET construct, blunt ended using T4 polymerase and ligated into theSmaI-cut pUCP26 vector. For cloning His-WbpM and WbpM-His into pUCP26, the histidine- tagged gene was amplified by PCR from the corresponding pET or Topo-pBAD construct respectively. The primers were the T7 universal promoter primer and 50-CTCAAGCTTTCA GGGTTCTCGCCGCCTC-30for His-WbpM. The primers were 50-GCTCTAGAAATAATTTTGTTTAA-30 and 50-CGCAAG CTTTCAATGGTGATGGTGATG-30for WbpM-His. PCR was performed with Expand polymerase as described above, with an annealing temperature of 458C. The purified PCR products were cut withXbaI andHindIII and ligated into pUCP26 that had previously been cut with the same enzymes. All cloning was performed inE. coliDH10B under repressing conditions (0.2% glucose). Lipopolysaccharides were prepared accord- ing to the method of Hitchcock and Brown (1983) from overnight cultures grown in the absence of repressor. They were analysed by SDS – PAGE electrophoresis. Detection was carried out by silver staining and Western immunoblotting using A-band (N1F10) and B-band (MF15 – 4) LPS-specific monoclonal antibodies.
Cloning and assay of PhoA and LacZ fusions
Truncated versions of His-WbpM were amplified by PCR using the His-WbpM/pET construct as a template. For all the constructs, the top primer was the universal T7 promoter primer. For the PhoA fusions, the bottom primers contained a HindIII site and were 50-CAGGATCCTAAGCTTTGTCTTCTG TGCCCAACC-30for D45 – PhoA, 50-CAGGATCCTAAGCTTG CATCACCGCCCGGTACA-30for M78 – PhoA, 50-CAGGATC CTAAGCTTCGGAGCGGTACCAGTAGAC-30 for S109–PhoA and 50-CAGGATCCTAAGCTTCAGAGTACCAGTCTCCCA-30 for S147 – PhoA. The PCR amplification was carried out using Expand in the same conditions as described above except that the annealing temperature was 508C. The PCR products were digested withXbaI andHindIII and cloned in frame with PhoA in the pRMCD28 vector (Danielset al., 1998) inE. coliDH5a. The bottom primers used for the LacZ fusions all contained a BamHI site. They were 50-CAGGATC CACGTCTTCTGTGCCCAACCT-30 for D45 – LacZ, 50-CA GGATCCATCACCGCCCGGTACAT-30 for M78 – LacZ,
50-CAGGATCCGAAGAGTACCAGTCTCCCAT-30for S147 – LacZ, 50-CAGGATCCCCCGCGCCATAGATAGC-30 for G170 – LacZ, 50-CAGGATCCTGGTCATCATCGATGAACG C-30 for D195 – LacZ, 50-ACGGATCCTGACGCTCCAGTTC CTGATG-30for R345 – LacZ, 50-ATGGATCCTCGACCTGCA CCGCGGCCT-30 for V418 – LacZ, 50-CAGGATCCTCGTTG CCGAAGCGGACCAT-30 for N482 – LacZ and 50-CTGGATC CACATAGCCGCTGACGGTTTC-30 for Y647 – LacZ. The PCR amplification was carried out using Expand in the same conditions as described above except that the annealing temperature was 498C. The PCR products were digested with XbaI and BamHI and cloned in frame with LacZ in the pRMCD70 vector in the LacZ-deficientE. colistrain CC118 (Danielset al., 1998). Alkaline phosphatase andb-galacto- sidase assays were performed according to the method of Danielset al. (1998).
Preparations of membranes containing His-WbpM or WbpM-His
Cell pellets (300 ml) obtained after overnight expression of His-WbpM or WbpM-His were resuspended in 40 ml of ice- cold 50 mM Tris, pH 7.5. They were lysed by passage three times through a French press (American Instrument Com- pany) with a cell pressure of 1000 psi. Cell debris was pelleted down by centrifugation at 12 000g for 30 min at 48C.
Membranes were obtained by ultracentrifugation of the supernatant at 100 000gfor 45 min at 48C. The membranes were resuspended in 500ml of 50 mM Tris, pH 7.5, and maintained on ice throughout analysis. For solubilization purposes, 350ml of membrane preparations was resus- pended in 2% Triton X-100 or 1% lauryl sarcosyl in 50 mM Tris, pH 7, and agitated gently at room temperature for 1 h.
Insoluble material was removed by ultracentrifugation at 100 000g for 45 min at 48C. The histidine-tagged proteins solubilized in Triton were purified batchwise by nickel chelation in the presence of detergent using 1.5 ml of nickel chelation resin (chelating fast flow Sepharose; Pharmacia).
The purified proteins were dialysed in 50 mM Tris, pH 7, supplemented with 0.1% Triton X-100.
Purification of His-L133 for antiserum preparation His-L133 was overexpressed in E. coli BL21(DE3)pLysS grown in LB at 378C and induced with 1 mM IPTG. In these conditions, His-L133 was only produced as inclusion bodies.
The cell pellet (200 ml of induced culture) was resuspended in 50 mM Tris, pH 8, and lysed by sonication. The inclusion bodies were recovered by centrifugation at 12 000g for 30 minat 48C. They were solubilized in 6 M guanidine and purified by nickel chelation (chelating fast flow Sepharose;
Pharmacia) in the presence of 6 M guanidine. After elution from the nickel column, the protein was purified further by microelution from SDS – PAGE gels using the Bio-Rad microeluter system as instructed by the manufacturer. The pure protein was dialysed against 50 mM Tris, pH 8, and lyophilized.
Immunization procedure and preparation of the antiserum for protein analysis
Immunization was carried out in two female New Zealand white rabbits using 150mg of protein per injection. For each injection, the protein (150mg in 250ml of 1.7% NaCl) was mixed in equal parts with Freund’s incomplete adjuvant extemporaneously. Subcutaneous injections were adminis- tered at days 1 and 4, followed by intramuscular injections on days 16 and 30. A booster injection was administered at day 70, and the rabbits were bled 6 days afterwards for serum collection. The serum was separated from the blood by clotting. Summarized briefly, the blood was incubated for 1 h at room temperature, followed by 30 min at 378C and 1 h at 48C. The serum was centrifuged at 1100gfor 10 min, and the supernatant was stored at2208C. To increase its specificity, the antiserum was adsorbed against E. coli (BL21(DE3)- pLysS). For this purpose, cells from 100 ml of overnight culture were lysed by incubation in lysis buffer [50 mM Tris, pH 8, 2 mM EDTA, 2% (w/v) SDS, 4% (v/v)b-mercaptoetha- nol, 1% (w/v) lysozyme]. After incubation for 1 h at 378C, the lysate was spun at 12 000g at 48C for 30 min, and the supernatant was used for antiserum adsorption. Nitrocellu- lose membranes (five pieces of 35 cm2) were immersed in the cell lysate and incubated for 1 h at room temperature. They were washed three times for 10 min in 10 mM Tris, pH 8, 150 mM NaCl (TBS) and blocked for 1 h with 3% BSA in TBS.
The membranes were washed again three times with TBS.
One membrane was immersed into diluted antiserum (1:100) and incubated for 1.5 h at room temperature. After incubation, this membrane was removed and replaced by a second membrane. The process was repeated until all five membranes had been used. The selectivity of the antiserum for WbpM was tested by Western immunoblot using wild-type P. aeruginosaand itswbpMknock-out mutant. The adsorbed antiserum was diluted further four times before use, and washes were performed using 20 mM Tris, pH 8, 500 mM NaCl, 0.05% (v/v) Tween 20 and 0.2% (v/v) Triton X-100.
Detection was performed with anti-rabbit F(ab0)2conjugated to alkaline phosphate using NBT and BCIP as substrates.
Purification of His-S262 by metal chelation on fast protein liquid chromatography (FPLC)
Pellets from 900 ml of induced cultures were resuspended in 80 ml of buffer A (5 mM imidazole, 20 mM Tris, pH 7, 0.1 M NaCl). The cells were sonicated briefly (macrotip, sonicator XL2020; Heat Systems; power set to 4, 2 min total, 5 s on, 5 s off) on ice. Cell debris was removed by centrifugation at 13 000gfor 15 min at 48C. The supernatant was delipidated by ultracentrifugation at 100 000g for 45 min at 48C. The supernatant was filtered through a 0.2mm filter before loading onto the column. The column was a Poros MC (Perseptive Biosystems) semi-preparative column (10 cm1 cm) run at 30 ml min21 on a Beckman Coulter FPLC Gold purification system. The column was loaded with nickel by the application of 10 column volumes (CV) of 100 mM nickel sulphate, followed by a rinsing step with 10 CV of water. The column was equilibrated with 10 CV of buffer A, and the sample (40 ml) was loaded onto the column at a reduced flow rate of 20 ml min21. The column was then rinsed with 5 CV of buffer
A, and the flow rate was adjusted to 30 ml min21. The column was rinsed further with 10 CV of 97% buffer A23% buffer B. Buffer B consisted of 1 M imidazole, 20 mM Tris, pH 7, 0.1 M NaCl. The elution was carried out by applying a gradient from 3% to 50% of buffer B in 22 CV. Fractions (5 ml) were analysed for their protein content by SDS – PAGE, and fractions containing pure His-S262 were pooled together.
They were concentrated by ultrafiltration using YM10 Diaflo membranes (Amicon). The protein concentrate was dialysed against 50 mM Tris, pH 7, or frozen at2208C after the addition of 25% glycerol.
Capillary electrophoresis (CE) analysis of reaction products
CE was performed using a P/ACE-MDQ system (Beckman Coulter) with UV detection. The running buffer was 25 mM sodium tetraborate, pH 9.4. The capillary was bare silica (75mm57 cm), with a detector at 50 cm. The capillary was conditioned before each run by washing with 0.2 M NaOH for 2 min, water for 2 min and running buffer for 2 min. Samples were introduced by pressure injection for 8 s, and the separation was performed at 22 kV. Typically, reactions were carried out using 0.75 mM UDP-GlcNAc as a substrate, 0.28 mM NAD1as a cofactor and 1mg of pure enzyme or 14 – 74mg of membrane preparations. The reactions were incubated in 20 mM Tris, pH 7, at 378C, unless stated otherwise. The specific composition of each reaction mix and the reaction time are indicated in the legend to each figure. For determination of kinetic parameters, reactions were performed in a total volume of 70ml with 0.47mg of enzyme and 0.14 mM NAD1 at pH 10. The substrate concentration varied from 0.05 to 3.5 mM. The reactions were quenched after incubation for 10 min at 308C.
Acknowledgements
This work was supported by operating grants to J.S.L. from the Canadian Institute for Health Research (CIHR) (MOP- 14687) and from the Canadian Bacterial Diseases Network, a consortium of the Federal Networks of Centres of Excellence program. An equipment grant to J.S.L. for the purchase of the capillary electrophoresis instrument was obtained from CIHR (MMA-41558). C.C. is the recipient of a postdoctoral fellow- ship from the Canadian Cystic Fibrosis Foundation (CCFF).
J.S.L. is the recipient of a Marshe Morton scholarship from CCFF. We thank W. Ciccotelli for technical assistance in raising the anti-WbpM antiserum, as well as J. Li (National Research Council, Canada) for performing mass spectro- metry analyses. We thank C. Daniels and G. Newton for advice on the LacZ and PhoA fusion experiments.
References
Allen, A., and Maskell, D. (1996) The identification, cloning and mutagenesis of a genetic locus required for lipopoly- saccharide biosynthesis in Bordetella pertussis. Mol Microbiol19: 37 – 52.
Archer, G.L., and Bosilevac, J.M. (2001) Microbiology.
Signaling antibiotic resistance in Staphylococci. Science 291: 1915 – 1916.
Be´langer, M., Burrows, L.L., and Lam, J.S. (1999) Functional analysis of genes responsible for the synthesis of the B-band O antigen of Pseudomonas aeruginosaserotype O6 lipopolysaccharide.Microbiology145: 3505 – 3521.
Burrows, L.L., Charter, D.F., and Lam, J.S. (1996) Molecular characterization of thePseudomonas aeruginosaserotype O5 (PAO1) B-band lipopolysaccharide gene cluster. Mol Microbiol22: 481 – 495.
Burrows, L.L., Urbanic, R.V., and Lam, J.S. (2000) Functional conservation of the polysaccharide biosynthetic protein WbpM and its homologues in Pseudomonas aeruginosa and other medically significant bacteria.Infect Immun68:
931 – 936.
Creuzenet, C., Smith, M., and Lam, J.S. (1999) Environmen- tal regulation of B-band lipopolysaccharide biosynthesis in Pseudomonas aeruginosa. In Pseudomonas 99: Biotech- nology and Pathogenesis Conference.Abstract 93. Maui, HI: American Society for Microbiology Press.
Creuzenet, C., Be´langer, M., Wakarchuk, W.W., and Lam, J.S. (2000a) Expression, purification, and biochemical characterization of WbpP, a new UDP-GlcNAc C4
epimerase from Pseudomonas aeruginosa serotype O6.
J Biol Chem275: 19060 – 19067.
Creuzenet, C., Schur, M.J., Li, J., Wakarchuk, W.W., and Lam, J.S. (2000b) FlaA1, a new bifunctional UDP-GlcNAc C6 dehydratase/ C4 reductase from Helicobacter pylori.
J Biol Chem275: 34873 – 34880.
Cryz, S.J., Jr, Pitt, T.L., Furer, E., and Germanier, R. (1984) Role of lipopolysaccharide in virulence of Pseudomonas aeruginosa.Infect Immun44: 508 – 513.
Daniels, C., Vindurampulle, C., and Morona, R. (1998) Overexpression and topology of the Shigella flexneri O-antigen polymerase (Rfc/Wzy). Mol Microbiol 28:
1211 – 1222.
Dean, C.R., Franklund, C.V., Retief, J.D., Coyne, M.J., Jr, Hatano, K., Evans, D.J.,et al.(1999) Characterization of the serogroup O11 O-antigen locus of Pseudomonas aeruginosaPA103.J Bacteriol181: 4275 – 4284.
Filip, C., Fletcher, G., Wulff, J.L., and Earhart, C.F. (1973) Solubilization of the cytoplasmic membrane ofEscherichia coli by the ionic detergent sodium-lauryl sarcosinate.
J Bacteriol115: 717 – 722.
Fournier, J.M., Vann, W.F., and Karakawa, W.W. (1984) Purification and characterization ofStaphylococcus aureus type 8 capsular polysaccharide.Infect Immun45: 87 – 93.
Frey, P.A. (1996) The Leloir pathway: a mechanistic imperative for three enzymes to change the stereochemical configuration of a single carbon in galactose.FASEB J10:
461 – 470.
Goldberg, J.B., and Pier, G.B. (1996) Pseudomonas aeruginosalipopolysaccharides and pathogenesis.Trends Microbiol4: 490 – 494.
Govan, J.R., and Deretic, V. (1996) Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepacia.Microbiol Rev60: 539 – 574.
Hancock, R.E., Mutharia, L.M., Chan, L., Darveau, R.P., Speert, D.P., and Pier, G.B. (1983) Pseudomonas aeruginosa isolates from patients with cystic fibrosis: a class of serum-sensitive, nontypable strains deficient in