Study of the TRF1 telomeric protein as therapeutic target in Glioblastoma

Universidad Autónoma de Madrid

Programa de Doctorado en Biociencias Moleculares

Study of the TRF1 telomeric protein as therapeutic target in Glioblastoma

DOCTORAL THESIS Leire Bejarano Bosque

Madrid, 2018

Facultad de Medicina Departamento de Bioquímica

Study of the TRF1 telomeric protein as therapeutic target in Glioblastoma

DOCTORAL THESIS Leire Bejarano Bosque

BSc, MSc

The entirety of the work presented in this Thesis has been carried out at the Telomeres and Telomerase Group in the Spanish National Cancer Centre (CNIO, Madrid) under the direction and supervision of Dr. Maria

Blasco Marhuenda

Madrid, 2018

Summary/ Resumen

1. English

Glioblastoma multiforme (GBM) is the deadliest and more common type of brain tumor in the adult, with a mean survival of only 14-16 months. This poor prognosis is linked to its high proliferation index and to tumor heterogeneity, including the existence of tumor cells with stem-like properties, also known as glioma stem-like cells (GSCs). Interestingly, the vast majority of GBM show mutations in telomere maintenance genes. Telomeres are nucleo-protein structures located at the end of the chromosomes and are essential for chromosome stability. They are protected by a six-protein complex, also termed the shelterin complex. The shelterin complex constitutes the so-called “capping” of the telomeres, which is essential for their protection, preventing telomeres from degradation and fusion to other chromosomes. TRF1 is an essential component of shelterin, which binds to the double- strand telomeric DNA. TRF1 inhibition results in telomere uncapping and effectively blocks the growth rapidly growing, p53-null, lung tumors independently of telomere length. TRF1 also marks and it is essential for both adult and pluripotent stem cells.

Based on this, the principal aim of this thesis is to address whether targeting TRF1 could be an effective therapeutic strategy for GBM. To this end, we generated mice with GBM by targeting neural stem cells (NSCs) with different oncogenic insults. In particular, we generated three different GBM subtypes by overexpressing PDGFA and PDGFB in Cdkn2a deficient background or knocking down both Nf1 and p53. Interestingly, we found that the three GBM subtypes overexpressed TRF1 in a telomere length independent manner. In addition, Trf1 genetic ablation effectively inhibited both GBM initiation and progression leading to a significant increase in mouse survival. This was accompanied by increased telomeric DNA damage, inhibition of proliferation and reduced stemness. Of note, brain- specific or whole-body Trf1 deletion in healthy mice did not compromise organism viability or cognitive functions.

To address whether our findings could be translated to human patients, we first checked whether TRF1 was upregulated in human samples. Using both human cells lines and patient-derived tissue we demonstrated that GBM presented higher TRF1 levels compared to normal brain. Next, we test the effect of TRF1 chemical modulators in human GBM cells and patient-derived GSCs. Interestingly, TRF1 chemical modulators also induced DNA damage, and decreased proliferation and stemness in GBM cells. Moreover, TRF1 chemical downregulation blocked tumor-sphere formation and tumor growth in xenografts from patient-derived primary GSCs. Taken together, these results suggest that targeting telomeres throughout TRF1 inhibition may be a novel therapeutic strategy for GBM.

Summary/Resumen

II

2. Español

El Glioblastoma multiforme (GBM) es uno de los tumores cerebrales más comunes y agresivos en adultos, con una supervivencia media de 14 a 16 meses. La esperanza de vida tan reducida se debe a son tumores muy proliferativos y heterogéneos, así como a la existencia de células madre tumorales, también conocidas como “células madre de glioma”.

La mayoría de los casos de GBM presentan mutaciones en genes asociados con el mantenimiento telómerico. Los telómeros con unas estructuras nucleo-proteícas localizadas al final de los cromosomas, y son esenciales para su estabilidad. Los telómeros están protegidos por un complejo de seis proteínas, también conocido como complejo shelterina.

Este complejo evita que los cromosomas se degraden o se fusionen entre ellos. Uno de los componentes de este complejo de proteínas es TRF1, que se une al ADN telomérico de doble cadena. La inhibición de TRF1 causa una “desprotección” telomérica y bloquea así el crecimiento de tumores de pulmón muy agresivos y deficientes de p53, independientemente de la longitud telomérica. Además, TRF1 es esencial para las células madre adultas y las células madre inducidas.

El principal objetivo de esta tesis es determinar si TRF1 podría usarse como diana terapéutica en GBM. Para ello, generamos ratones con GBM introduciendo diferentes estímulos oncogénicos en células madre neuronales. En particular, generamos tres subtipos diferentes de GBM, sobrexpresando PDGFA o PDGFB en un fondo genético deficiente para Cdkn2a o inhibiendo los supresores tumorales Nf1 y p53 al mismo tiempo. Observamos que en los tres subtipos la expresión de TRF1 era más alta en comparación con cerebro normal, de forma independiente a la longitud telomérica. Además, la deleción genética de Trf1 bloquea tanto la iniciación como la progresión del GBM, mediante un mecanismo que incluye la inducción de daño en el DNA y la inhibición de la proliferación y las capacidades de células madre. También observamos que la pérdida genética de Trf1 en ratones sanos no afecta a la supervivencia ni causa deterioro cognitivo.

Con el fin de comprobar si la inhibición de TRF1 podría ser efectiva en pacientes de GBM, comprobamos si estos también exhibían altos niveles de TRF1. Para ellos, usamos células y tejido de paciente y demostramos que el GBM humano tenia niveles más altos de TRF1 que el cerebro normal. Además, comprobamos que la inhibición química de TRF1 en células humanas de GBM también induce daño en el ADN y reduce la proliferación y las capacidades de células madre. Por último, también vimos que la inhibición química de TRF1 afectaba a la formación de esferas y al crecimiento de xenoinjertos con células madre de tumor. En conclusión, estos resultados sugieren que atacar los telómeros mediante la inhibición de TRF1 podría ser una estrategia prometedora para el tratamiento de GBM.

Index

Index

1

Summary/Resumen

1. English

2. Español

Index

Abbreviations

Introduction

1. Telomeres

1.1 History of telomeres 19

1.2 The telomeric DNA structure 19

1.3 The shelterin complex 20

1.4 Telomere sencondary structures: T-loop and G-quadruplex 22

2. Telomere shortening and telomere elongation mechanisms

2.1 End-replication problem 23

2.1 Telomerase 24

2.3 Alternative Lengthening of Telomeres (ALT) 25

3. Telomeres and DNA damage response

3.1 Activation of the ATM/ATR pathway 26

3.2 Activation of non-homologous end-joining repair pathways: c-NHEJ and alt-NHEJ 26

3.3 Homology Directed Repair (HDR) 27

4. Telomeres and aging

4.1 Telomere associated diseases 28

5. Targeting telomeres in cancer

5.1 Telomerase inhibitors 29

5.2 G-quadruplex stabilizers 29

5.3 Telomere homolog oligonucleotides (T-oligos) 30

5.4 Targeting the shelterin complex: TRF1 30

6. Glioblastoma multiforme (GBM)

6.1 Molecular classification of Glioblastoma. The new era. 31

6.2 Modeling GBM using the RCAS-Tva system 32

6.2 Tumor heterogeneity and Glioma Stem Cells (GSCs) 33

6.3 Telomeres in glioblastoma 34

Objectives

Material and Methods

1. Mice experimentation

1.1 Mice generation 45

1.2 Mice maintenance 45

1.3 Mice genotyping 45

1.4 Generation of mouse models with brain tumors 47

1.5 Intracranial cell transplantation into syngeneic mice 48

1.6 Xenografts experiments 48

1.7 Cognitive tests 48

2. Cell culture

2.1 Cell transfection 49

2.2 Neural stem cell (NSC) and Glioma Stem Cell (GSC) isolation 49

2.3 Neurosphere formation assays 49

2.4 Irradiation and temozolomide 49

3. Histopathology, Immunofluorescence and

immunohistochemistry analysis

3.1 Histopathological analysis

3.2 Immunofluorescence analyses in cells and tissue sections 50

3.2 Immunohistochemistry analyses in tissue sections 50

4. Western-Blotting

Index

3

5. In situ hybridization

5.1 Quantitative Fluorescence In situ Hybridization (qFISH) 51

5.2 Immuno-FISH 51

5.3 FISH analysis on metaphase spreads 52

6. Real-time qPCR

7. PCR

8. TRF1 chemical modulators

9. Tissue microarray (TMA)

10. Quantification and statistical analysis

Results

1. Effects of Trf1 genetic deletion in mouse models of GBM

1.1 TRF1 is overexpressed in different mouse GBM subtypes 59

1.2 Effects of Trf1 deletion in tumor initiation 63

1.2.1 Trf1 deletion impairs tumor initiation in PDGFB and PDGFA induced GBM 63 1.2.2 Trf1 abrogation leads to telomere damage and reduced stemness in NSCs 66 1.3 Therapeutic effects of Trf1 abrogation in already established GBMs 69

1.3.1 Trf1 deficiency impairs tumor progression in PDGFB and PDGFA

induced GBM 69

1.3.2 Trf1-deficient GSCs show decreased stemness and tumorigenicity 73

1.4 Effects of Trf1 deletion in healthy mice 75

1.4.1 Brain specific Trf1 deletion does not impair cognitive functions in

healthy mice 75

1.4.2 Whole-body Trf1 deletion is compatible with mice viability and does not impair cognitive functions in a Cdkn2a deficient background 79

2. Therapeutic effects of targeting TRF1 in GBM human cells

and patient-derived xenografts

2.1 TRF1 is overexpressed in human GBM 82

2.2 Effects of Trf1 knockdown in U251 human GBM cell line 83 2.3 TRF1 protein downregulation using chemical compounds 85

2.3.1 Effect of TRF1 chemical modulators in the U251 GBM human cell line 85 2.3.2 Synergic effect of TRF1 downregulation with γ-irradiation and temozolomide 88

2.3.3 Effect of TRF1 chemical modulator in patient-derived GSCs 90

2.3.4 Screening of novel TRF1 modulators in compounds approved by the FDA or in clinical trials 93

2.3.5 Synergic effects of different TRF1 modulators 97

Discussion

1. Glioblastoma multiforme, an incurable tumor

2. TRF1 inhibition as a novel approach to target GSCs

3. Targeting telomeres independently of telomere length

4. Trf1 deletion as a safe approach for a healthy organism

5. TRF1 chemical modulation

6. Future perspectives

Conclusions

Bibliography

Acknowledgements

Annexes

Abbreviations

a.u.f./a.u. Arbitrary Units (of Fluorescence) AC3 Active Caspase 3

AKT AKT Serine/Threonine Kinase

ALT Alternative Lengthening of Telomeres alt-NHEJ alternative Non-Homologous End Joining APBs ALT-associated-PML Bodies

ATCC American Type Culture Collection ATM Ataxia Telangiectasia Mutated ATR Ataxia Telangiectasia Related

ATRX Alpha Thalassemia/Mental Retardation Syndrome X-Linked BLM Bloom’s syndrome helicase

BSA Bovine Serum Albumin

c-NHEJ classical Non-Homologous End Joining CAS Cardiac angiosarcomas

CD133 PROM1, Prominin 1

CDKN2A Cyclin Dependent Kinase Inhibitor 2A CDKN2B Cyclin Dependent Kinase Inhibitor 2B CEIyBA Comite de Ética de Bienestar Animal Chk1 Checkpoint kinase 1

Chk2 Checkpoint kinase 2

CIOMS Council for International Organizations of Medical Sciences CLL Chronic Lymphocytic Leukaemia

CNS Central Nervous System

Abbreviations

10

CNIO Centro Nacional de Investigaciones Oncológicas

Cre-ERT2 Cre recombinase fused to an Estrogen Receptor domain version 2 D-Loop Displacement Loop

DAPI 4',6-Diamidino-2-phenylindole dihydrochloride DC Dyskeratosis Congenita

DDR DNA-Damage Response DKC1 Dyskerin 1

DMEM Dulbecco's Modified Eagle's Medium DNA-PK DNA-dependent Protein Kinase

DSB Double-Strand Break EGF Epidermal Growth Factor

EGFR Epidermal Growth Factor Receptor ERK Extra-cellular signal Regulated Kinase ETP Experimental Therapeutics Programme FBS Fetal Bovine Serum

FELASA Federation of European Laboratory Animal Science Associations FGF Fibroblast Growth Factor

G2/M Transition between the cell cycle phases G2 (Gap2) and M (Mitosis) G4 Guanine 4 (Guanine Quadruplex)

GBM Glioblastoma Multiforme

GEMM Genetically Engineered Mouse Models GFP Green Fluorescent Protein

GRO Guanine-Rich Oligonucleotides

GSCs Glioma Stem-like Cells HA Human Astrocytes HA tag Hemagglutinin tag HCS High Content Screening HDR Homology-Directed Repair hUBC Human Ubiquitin C promoter

IDH Isocitrate Dehydrogenase

iMSRC Intelligent Matrix Screener Remote Control iPS cells Induced Pluripotent Stem cells

IR γ-Irradiation

K-Ras^G12V Kirsten Rat Sarcoma viral oncogene, with a mutation in codon 12 that generates a Glycine to Valine transition

Kb Kilo bases KO Knockout

LFL Li-Fraumeni like-families MRE11 Meiotic Recombination 11

MRN Complex formed by MRE11, RAD50 and NBS1 MTS Multitelomeric Signals

MYC Myelocytomatosis viral oncogene homolog NBS1 Nijmegen Breakage Syndrome 1

NF1 Neurofibromin 1

NHEJ Non-Homologous End Joining NMP N-methyl-2-pyrrolidone

NSCs Neural Stem Cells

Abbreviations

12

PARP1 Poly-Adenosine diphosphate Ribose Polymerase 1 PARP2 Poly-Adenosine diphosphate Ribose Polymerase 1 PBS Phosphate Buffered Saline

PDGFA Platelet Derived Growth Factor Subunit A PDGFB Platelet Derived Growth Factor Subunit B PDGFR Platelet Derived Growth Factor Receptor PDGFRA Platelet Derived Growth Factor Receptor Alpha PEG Poly Ethylene Glycol

PIK3CA Phosphatidylinositol-4,5-Bisphosphate 3-Kinase Catalytic Subunit Alpha PIK3R1 Phosphoinositide-3-Kinase Regulatory Subunit 1

PINX1 PIN2/TRF1 Interacting, Telomerase Inhibitor 1 PML Promyelocytic Leukaemia

POT1 Protection of Telomeres 1 pRB phospho Retinoblastoma protein PTEN Phosphatase and Tensin Homolog

RAD50 RAD50 double strand break repair protein RAP1 Repressor Activator Protein 1

RCAS Retroviral vectors derived from the SR-A strain of Rous sarcoma virus (RSV) RFP Red Fluorescent Protein

RT Room Temperature

S phase DNA Synthesis phase of cell cycle Sh Short-Hairpin

SOX2 SRY-Box 2

ssDNA single strand DNA SVZ Subventricular Zone T-Loop Telomere Loop

T-oligos Telomere homolog Oligonucleotides TBS Tris Buffered Saline

Terc Telomerase RNA Component TERT Telomerase Reverse Transcriptase TIF Telomere Induced Foci

TIN2 TRF1 Interacting Protein 2

TMA Tissue Microarray TMZ Temozolomide TP53 Tumor Protein P53 TPP1 TINT1/PTOP/PIP1

TRF1 Telomere Repeat binding Factor 1 TRF2 Telomere Repeat binding Factor 2

Tva The cellular receptor for subgroup A avian leukosis viruses UCM Universidad Complutense de Madrid

USP13 Ubiquitin Specific Peptidase 13 WRN Werner’s syndrome helicase WT Wild Type

XPF Xeroderma Pigmentosum group F

γH2AX Gamma-phosphorylated Histone 2 variant A.X (c)DNA (complementary) Deoxyribonucleic Acid

Abbreviations

14

(m)RNA (messenger) Ribonucleic acid

(p)RPA (phosphorylated) Replication Protein A

(Q-)FISH (Quantitative) Fluorescence In Situ Hybridization (RT-q)PCR (Real Time-quantitative) Polymerase Chain Reaction 53BP1 p53 Binding Protein 1

Introduction

Introduction

19

1. Telomeres

1.1 History of telomeres

The term telomere derives from the Greek words telos (end) and meros (part). It was first described in Drosophila and maize cells by Hermann Müller and Barbara McClintock, respectively. They observed that the very end of the chromosomes did not present chromatic fusions and therefore, they postulated the existence of a structure protecting chromosomal extremities (McClintock 1941; Müller 1938).

It was in 1978 when Elizabeth Blackburn and Joe Gall deciphered the structure of the chromosome ends showing that eukaryotic telomeres consist of tandem repeats of oligonucleotide sequences (Blackburn and Gall 1978). The next milestone in telomere biology was the discovery of telomerase, a reverse transcriptase with the function of telomere elongation (Blasco et al. 1997; Greider and Blackburn 1985; Hanahan and Weinberg 2011).

More than 40 years after the discovery of the first telomeric sequence, we now have a deepest knowledge about telomere structure and function, as well as about its role in two of the main concerns in the 21^st century: cancer and aging.

1.2 The telomeric DNA structure

The telomeric DNA is a highly conserved heterochromatic structure at the end of the eukaryotic chromosomes. This region does not contain protein-coding genes and in mammals is formed by tandem repeats of the 5’-TTAGGG-3’ sequence (Figure 1) (Meyne, Ratliff, and Moyzis 1989). The repetitive telomere sequence ends in a guanine-rich, single stranded 3’ overhang of approximately 150 to 200 bp, also known as G-strand overhang.

The presence of this structure is essential for chromosome stability as explained later in section 1.4 (Griffith et al. 1999; Klobutcher et al. 1981).

Telomere length is heterogeneous across species and within the same species, depending on the developmental stage and the cell type (Flores et al. 2008; Marion et al.

2009). In average, human telomeres span 5 to 15 kb (de Lange et al. 1990) whereas the average of murine telomeric repeats spans between 15 and 40 kb depending on the genetic background (Hemann and Greider 2000; Zijlmans et al. 1997). Within the same species telomere length varies between different organisms, tissues, cell types (Canela, Klatt, and Blasco 2007; Flores et al. 2008) and even between different DNA ends of the same chromosome (Lansdorp et al. 1996; Zijlmans et al. 1997). This heterogeneity does not alter the function of the telomere as long as the size remains above a critical length, required for

the proper protection of the chromosome and for the maintenance of genomic stability (Blasco et al. 1997; Lee et al. 1998).

1.3 The shelterin complex

Mammalian telomeres are bound by the so-called shelterin complex formed by the telomere repeat factors 1 and 2 (TRF1 and TRF2), the TRF1-interacting factor 2 (TIN2), the Protection of Telomeres 1 (POT1), the POT1-TIN2 organizing protein TPP1 (also known as TINT1, PTOP or PIP1) and the repressor/activator protein 1 or RAP1 (De Lange 2002, 2005;

Liu et al. 2004). TRF1 and TRF2 are bound to double stranded DNA repeats and interact with each other through TIN2 (Houghtaling et al. 2004; Jeffrey Zheng Sheng Ye et al. 2004).

POT1 binds to the single stranded G-rich overhang (De Lange 2005) and it is connected to the shelterin complex by direct binding to TPP1 that itself also binds to TIN2 (Figure 2) (Houghtaling et al. 2004; J. Z S Ye et al. 2004). RAP1 binds to telomeres through its interaction with TRF2 (De Lange 2005) (Figure 2).

The shelterin complex constitutes the so-called “capping” of the telomeres, which is essential for their protection, preventing telomeres from degradation and fusion to other chromosomes (De Lange 2005). Also, the shelterin complex impedes the recognition of telomeres as double strand breaks (DSB) and the subsequent activation of the DNA damage response (DDR) (De Lange 2005). Some shelterin proteins also play an essential role in telomere length regulation, as detailed below. A summary of shelterin functions is shown in Table 1.

Figure 1. Structure of the telomeres. Schematic description of the telomeric DNA, composed by tandem repeats of de TTAGGG sequence.

Introduction

21

TRF1 and TRF2

TRF1 and TRF2 show a high primary structure homology (Bianchi et al. 1997; Broccoli et al.

1997). They bind to the double strand telomeric DNA as homodimers (Bianchi et al. 1997;

Broccoli et al. 1997). Their main functions consist in telomere length regulation (Smogorzewska et al. 2000), telomere capping and DDR prevention (Martínez et al. 2009).

Also, TRF1 plays an exclusive role facilitating telomere replication (Martínez et al. 2009;

Sfeir et al. 2009). Further details of TRF1 will be discussed in section 5.4.

POT1

POT1 is the only shelterin specifically binding to the single stranded G-rich overhang (De Lange 2005). In mice we found distinct forms of POT1 (POT1a and POT1b) while in humans there is only one form (Hockemeyer et al. 2006). POT1 plays an essential and exclusive role protecting the single stranded G-rich overhang (Baumann and Cech 2001). Other roles of this protein consist in impeding the DDR and telomere length regulation (Loayza and De Lange 2003; J. Z S Ye et al. 2004).

TIN2

TIN2 serves as bridge between the homodimers (TRF1 and TRF2) and TPP1. This shelterin component stabilizes TRF2 binding to the telomere (Houghtaling et al. 2004; Kim et al. 2004;

Jeffrey Zheng Sheng Ye et al. 2004) and also mediates the recruitment of POT1 via TPP1 (Jeffrey Zheng Sheng Ye et al. 2004). Thus, its main functions consists in telomere capping and telomere length regulation (Kim, Kaminker, and Campisi 1999).

TPP1

TPP1 serves as bridge between TIN2 and POT1, favoring the recruitment of POT1 to the telomere (Kibe et al. 2010; J. Z S Ye et al. 2004). TPP1 is mainly implicated in telomere length regulation by recruiting the TERT subunit of the telomerase enzyme to telomeres (Tejera et al. 2010).

Figure 2. The mammalian shelterin complex.

RAP1

RAP1 binds directly to TRF2 (Li 2003; Li, Oestreich, and De Lange 2000). RAP1 is the only shelterin component not required for telomere capping but it participates in telomere length regulation and inhibition of the DNA damage response (Martinez et al. 2010; Sfeir et al.

2010). Interestingly, RAP1 also has several extratelomeric roles as transcriptional regulator of metabolic genes and silencing of subtelomeric proteins (Martinez et al. 2010; Martínez and Blasco 2011).

In mammals, there are several complementary proteins binding the telomere repeat binding factors. In particular, TRF1 interacts with two enzymes that regulate its binding to the telomere, Tankyrase 1 and 2 (Smith 1998) and with the negative regulator of telomerase PINX1 (Zhou and Lu 2001). TRF2 mainly interacts with components of DNA repair pathways like the DNA-PKs complex (Khadka et al. 2014), the MRN complex (Zhu et al. 2000), the helicases WRN and BLM (Opresko et al. 2002), the ADP-ribosilases PARP1 and PARP2 (Gomez 2006) and the nucleases XPF and Apollo (Lenain et al. 2006; Zhu et al. 2003).

Although they are not exclusive, these proteins play an important role in maintaining the protective function of telomeres.

SHELTERIN COMPONENT TELOMERIC ROLE

TRF1 Telomere replication

POT1 3’ overhang protection

TRF1, TRF2, PPO1, RAP1 DNA damage response inhibition TRF1, TRF2, POT1, TIN2, TPP1 Telomere length regulation TRF1, TRF2, POT1, TIN2, TPP1, RAP1 Telomere capping

1.4 Telomere secondary structures: T-loop and G-quadruplex

The linear telomere conformation presented in Figure 1 and 2 allows telomerase to access the telomere easily but suffers from a major shortcoming: the chromosome ends remain unprotected and can be recognized as DSBs (De Lange 2002; Loayza and De Lange 2003). To overcome this problem, a higher conformation that stabilizes the telomere structure was established, called telomere loop or T-loop (Goytisolo et al. 2000; Griffith et al.

1999). The T-loop is a DNA-protein structure formed when the single stranded G-rich overhang invades the double stranded telomeric DNA, forming the T-loop and an associated structure, called displacement-loop or D-loop (Figure 3A and 3B) (Goytisolo et al. 2000;

Table 1. Role of the different shelterin components at the telomeres.

Introduction

23

Greider 1999; Griffith et al. 1999). This higher order DNA structure prevents the telomeres from being detected as DSB and protects them from degradation and repair activities (Greider 1999; Griffith et al. 1999).

Apart from the T-loop, the G-rich strand can adopt an alternative conformation known as G-quadruplex or G4 (Tang et al. 2008). G-quadruplex structures are groups of four Hoogsteen-bonded guanines formed spontaneously and in the absence of the shelterin components (Figure 3C) (Sundquist and Klug 1989; Williamson, Raghuraman, and Cech 1989). Although the exact role of the G-quadruplex in the telomere remains unclear, it has been proposed as an alternative of telomere protection when the shelterins and the T-loop is lost (Lipps and Rhodes 2009).

2. Telomere shortening and telomere elongation mechanisms

2.1 End-replication problem

With each cell division, telomeres shorten 50 to 200 bp due to the incomplete replication of chromosome ends, a phenomenon known as the “end-replication” problem (Olovnikov 1973).

This phenomenon is caused by the antiparallel nature of the double DNA and by the characteristics of semiconservative DNA replication. During replication, DNA polymerases can only add bases to the 3’ end of a newly synthesizing strand, which divides the daughter

Figure 3.T-loop and G-quadruplex structures. (A) Structure of the T-loop. (B) Electron microscopy visualization of the mammalian T-loop in HeLa cells (Griffith et al., 1999) (C) G-quadruplex strutures (Nelson et al. 2004)

DNA strands into leading and lagging strand. The leading strand is synthesized continuously with the progression of the replication fork machinery in the 5’-3’ direction. The lagging strand, however must be synthesized in a discontinuous manner by the so-called Okazaki fragments (Figure 4A) (Okazaki et al., 1967). In this process, the DNA primases introduce short RNA fragments into the lagging strand, which allows the DNA polymerase to synthesize the rest of the DNA molecule. RNA primers are after degraded and the gaps are filled by the DNA polymerase. However, at the very end of the chromosome, the degradation of the RNA primers creates a gap that the DNA polymerase is not able to synthesize due to the lack of a 3’-hydroxi end. This results in a shorter daughter strand in each cell division, the phenomenon known as end-replication problem, which leads to replication or age-related telomere shortening (Calvin B. Harley, Futcher, and Greider 1990; Hastie et al. 1990; Ohki et al., 2001). Also, as the leading strand is synthesized on a complete manner, the resulting DNA molecule is blunt ended. In this DNA molecule, APOLO and EXO nucleases digest the 5’-end creating the G-strand overhang resulting in a shorter 5’ DNA strand and a shorter telomere (Figure 4B) (Huffman et al. 2000; Longhese et al. 2010; Wu, Takai, and De Lange 2012).

2.2 Telomerase

Telomere shortening can be compensated through de novo addition of telomeric repeats by telomerase, a reverse transcriptase composed by a catalytic subunit (TERT) and an RNA component (Terc) (Greider and Blackburn 1985). Additional components are required to stabilize the complex, such as the dyskerin 1 or DKC1 (Cohen et al. 2007;

Mitchell, Wood, and Collins 1999).

Figure 4. The end replication problem. (A) The leading strand is synthesized continuously.

The lagging strand must be synthesized discontinuously by the Okazaki fragments.

(B) Telomeres shorter due to the end replication problem in the lagging strand, and due to nuclease digestion in the leading strand.

Introduction

25

The complex recognizes the 3’-hydroxi group of the G-strand overhang where it acts as a reverse transcriptase, using the RNA component Terc as a template to add the repetitive telomeric sequence TTAGGG (Greider and Blackburn 1985). The accessibility of telomerase to the telomere depends on the telomere conformation: when the telomere is short and with a low amount of shelterin proteins bound to it, the T-loop is disrupted making the reverse transcriptase more accessible to the telomere. This has been proposed as a mechanism of telomere length autoregulation (Marcand, Gilson, and Shore 1997). Also, telomere elongation is regulated by the cell cycle, occurring in the late S phase during DNA replication (Marcand et al. 2000).

Telomerase expression is restricted to several cell types during development. It is predominantly expressed in embryonic stem cells, germ cells, in several tissue specific adult stem cell compartments and also in the majority of human cancers (Allsopp et al. 2003;

Greenberg et al. 1998; Hoffmeyer et al. 2012; De Lange and DePinho 1999; Montgomery et al. 2011; Schepers et al. 2011; Shay and Bacchetti 1997; Varela et al. 2011). However, in most somatic cells in the adult organism telomerase expression is absent or not sufficient to maintain telomere length after several rounds of cell division and differentiation, leading to one of the molecular mechanism underlying organism aging: telomere shortening.

2.3 Alternative Lengthening of Telomeres (ALT)

ALT represents a minor but alternative mechanism to elongate telomeres in the absence of a functional telomerase complex. This mechanism, which was first described in tumors and immortalized cell lines, is based on homologous recombination (Bryan et al.

1997). ALT is characterized by a highly heterogeneous telomere length as well as by telomere association with promyelocytic leukemia (PML) protein, also known as ALT- associated-PML bodies or APBs (Bryan et al. 1995, 1997; Dunham et al. 2000; Muntoni and Reddel 2005). This pathway is present in 10-15% of the tumors (Bryan et al. 1997) but there is still no evidence suggesting that ALT could prevent age related telomere loss.

3. Telomeres and DNA damage response

As mentioned earlier, the T-loop prevents telomeres from being detected as DSB and activating the subsequent DDR. However, when telomeres are critically short or the shelterin complex is destabilized, the T-loop is disrupted exposing telomeres in an open conformation. At this point, DDR transduction-related proteins (53BP1, γH2AX, NBS1, ATM, ATR, DNA-PK) initiate a signaling cascade, which results in the activation of several tumor

suppressor genes such as p53, p21, p16, Chk1 and Chk2 that lead to a p53/pRB-dependent senescence or apoptosis (Figure 5) (Artandi and Attardi 2005; Goytisolo et al. 2000; Martínez et al. 2009; Sfeir et al. 2009;

Smogorzewska and de Lange 2002). The mayor characteristic of a dysfunctional telomere is the so-called Telomere Induce Foci (TIF), which represents the colocalization of a DDR related protein with the telomere (De Lange 2005). The different DDR pathways are detailed below.

3.1 Activation of the ATM/ATR pathway

Upon telomere damage, ATM and ATR kinases are among the earliest transducers in the DDR signaling cascade.

When the T-loop is disrupted, the MRN complex formed by MRE11, RAD50 and NBS1 (De Jager et al. 2001) recognizes the telomere as a DSB and activates ATM (Lee and Paull 2007). On the contrary, ATR is activated in the presence of single stranded DNA (ssDNA) (Cimprich and Cortez 2008). It has been proposed that in the absence of POT1, RPA is able to bind to the G-strand overhang and recruits ATR (Barrientos et al. 2008). ATM acts through a CHK2-dependent pathway, while ATR activates CHK1. In both cases, it leads to p53 activation and the subsequent cell cycle arrest, senescence and apoptosis.

3.2 Activation of non-homologous end-joining repair pathways: c-NHEJ and alt- NHEJ

The non-homologous end-joining pathway (NHEJ) is also activated in the presence of DSBs and elicits chromosome fusions.

The classical-NHEJ (c-NHEJ) is triggered when the DNA-PK becomes activated in the presence of a DSB (Calsou et al. 2003). The activated DNA-PK promotes the association of the chromosome end with another DNA-PK bound chromosome (DeFazio et al. 2002). Exonucleases are then recruited to generate blunt ends followed by the ligation of the chromosome ends by ligases (Celli and de Lange 2005; Espejel, Franco, Rodriguez- Perales, et al. 2002; Espejel, Franco, Sgura, et al. 2002; Smogorzewska et al. 2002; Zhu et al. 2003).

Figure 5. DNA damage response by dysfunctional telomeres

Introduction

27

The alternative-NHEJ (alt-NHEJ) is activated in the absence of a proficient c-NHEJ (Nussenzweig and Nussenzweig 2007; Riballo et al. 2004; Wang et al. 2006). Alt-NHEJ is characterized by causing larger deletions, insertions and chromosomal translocations in the repair junctions (Nussenzweig and Nussenzweig 2007). Some tumors, like leukemia, use alt-NHEJ related proteins to generate a higher genomic instability, leading to disease progression and resistance to treatments (Li et al. 2011; Sallmyr, Tomkinson, and Rassool 2008).

3.3 Homology Directed Repair (HDR)

The activation of HDR pathway occurs in the presence of DBS in a lesser extent compared to the NHEJ. It is an error free-repair mechanism that requires the sister chromatid as template for homologous recombination. During the process, the single stranded G-rich overhang invades the sister-chromatid and uses the intact sequence as a template for DNA synthesis.

4. Telomeres and aging

A possible link between telomeres and aging was first suggested in 1961 by Hayflick and Moorhead, when they observed that in vitro passaging of human fibroblasts caused an irreversible growth arrest, also called replicative senescence. They hypothesized that this phenomenon was caused by the loss of “several factors”, which would impede the indefinite proliferation of normal cells (Hayflick and Moorhead 1961). Later studies pointed at telomere shortening as one of the main causes of this limited duplication capacity (C B Harley, Futcher, and Greider 1990). This idea was strengthened by the fact that ectopic re- expression of telomerase is able to prevent replicative senescence in many cell types (Bodnar et al. 1998; Vaziri and Benchimol 1998; Yang et al. 1999), whereas telomerase inhibition in immortalized cells induces a proliferation arrest (Ohmura et al. 1995).

With the development of genetic mouse models, the link between telomeres and aging was further demonstrated in vivo in a Terc^-/- mouse, a model deficient in functional telomerase (Blasco et al. 1997). Terc^-/- mice are characterized by an increased number of short telomeres, which impairs the proper formation of the T-loop and leads to the activation of the DDR pathways. As consequence, these mice lose regenerative capacities in several tissues and organs, which finally leads to premature aging and reduced lifespan (Blasco et al. 1997; Franco et al. 2002; Herrera 1999; Herrera et al. 1999; Herrera, Martínez-A, and Blasco 2000; Lee et al. 1998; Rudolph et al. 1999; Samper et al. 2002). Interestingly, re-

expression of functional telomerase in these mice rescued both telomere shortening and the observed phenotype (Samper, Flores, and Blasco 2001).

4.1 Telomere associated diseases

In agreement with the fact that telomere shortening underlies one of the main mechanisms of aging, mutations in both telomerase and the shelterin complex have been linked to rare degenerative diseases in humans, also known as telomere syndromes (Armanios and Blackburn 2012; Donate and Blasco 2011). This group of rare diseases is characterized by the presence of critically short or dysfunctional telomeres (Figure 6), linked to the characteristic impairment of the regenerative capacities and finally resulting in premature aging and death (Armanios and

Blackburn 2012; Donate and Blasco 2011).

Precisely, TERT, TERC and DKC1 mutations are linked to Dyskeratosis congenita (DC), a severe disease that causes bone marrow deficiency. Other examples are Aplastic anemia, characterized by an hypocellular bone marrow; Idiopathic pulmonary fibrosis, a degenerative lung disease; and liver fibrosis (Armanios et al. 2007; Calado et al.

2009; Tsakiri et al. 2007; Yamaguchi et al.

2005).

5. Targeting telomeres in cancer

Senescence and apoptosis constitute the two main barriers to proliferation; thus, any neoplastic cell should overcome these barriers to achieve an unlimited replicative potential.

As mentioned before, telomere maintenance above a minimum length is essential to impede cells entering into crisis, which makes telomere maintenance

mechanisms really attractive and even indispensable for cancer cells. In fact, more than Figure 6. The connection between telomere length, aging and cancer

Introduction

29

90% of human tumors aberrantly over-express telomerase (Figure 6 and Fig 7) (Joseph et al. 2010; Kim et al. 1994; Shay and Bacchetti 1997), while the remaining telomerase- negative tumors activate ALT (see section 2.3) (Barthel et al. 2017; Bryan et al. 1997). Thus, telomeres have been widely studied as potential anti-cancer targets.

5.1 Telomerase inhibitors

In this regard, most studies have focused in telomerase inhibition. The best example is GRN163L, also called Imetelstat. However, mouse models of telomerase-based therapeutic strategies have shown some limitations, as the anti-tumorigenic effect is only achieved when telomeres reach a critically short length (Gonzalez-Suarez et al. 2000;

Perera et al. 2008) and this effect is lost in the absence of the p53 tumor suppressor gene, which is commonly mutated in cancer (Chin et al. 1999; Greenberg et al. 1999). In agreement with these findings in mice, human clinical trials with telomerase inhibitors have only shown therapeutic benefits in few myeloid malignancies but have largely failed in solid tumors (Baerlocher et al. 2015; Daniel El Fassi et al. 2015; Middleton et al. 2014; Parkhurst et al. 2004; Tefferi et al. 2015), maybe as a consequence of telomere length heterogeneity within tumors, which may hamper the effective killing of all tumor cells (Figure 8).

5.2. G-quadruplex stabilizers

An alternative strategy to avoid telomere elongation by telomerase consists in stabilizing G-quadruplex (G4) structures (Wang et al. 2011). As mention in section 1.4, G4 are naturally formed in telomeres due to the interaction between the guanine residues in the telomeric repeats (Tang et al. 2008). Interestingly, these structures impede the access of telomerase to the telomere (Wang et al. 2011). Thus, by using G4-stabilizing ligands

Fig 8. Disadvantages of telomerase inhibition

telomere elongation can be prevented. However, this strategy may as well present some limitations as we discussed in section 5.1.

5.3. Telomere homolog oligonucleotides (T-oligos)

T-oligos consist in guanine-rich oligonucleotides (GRO) homologous to the telomeric G-rich overhang. They accumulate in the nucleus and are able to induce DDR mediated by ATM and p53 among others, resulting in cell cycle arrest, senescence and apoptosis (Ivancich et al. 2017). Even though T-oligos showed a promising effect in several tumors the mechanism is still poorly understood.

5.4 Targeting the shelterin complex: TRF1

As mentioned in several points of this chapter, the shelterin complex has an indispensable role in protecting telomeres from activating DDR and triggering apoptosis and senescence. Interestingly, not only telomerase but also shelterins are often mutated in cancer. Indeed, our group and others have identified POT1 as the first member of telomeric proteins to be mutated in several types of human cancer, both sporadic and familial, including chronic lymphocytic leukaemia (CLL) (Ramsay et al. 2013), familial melanoma (Robles-Espinoza et al. 2014; Shi et al. 2014), Li-Fraumeni like-families (LFL) with cardiac angiosarcomas (CAS) (Calvete et al. 2015), glioma (Bainbridge et al. 2015), mantle cell lymphoma (Zhang et al. 2014), and parathyroid adenoma (Newey et al. 2012). The fact that shelterins are frequently mutated in cancer supports the notion that targeting shelterins may be a novel and promising strategy to target telomeres in cancer, which would lead to a rapid telomere dysfunction independently of telomere length (Figure 9).

Among all the shelterins, TRF1 has been deeply studied in our lab during the years.

Indeed, several studies suggest that inhibiting TRF1 could represent an alternative to telomerase in order to target telomeres more efficiently. As mentioned before, TRF1 directly binds TTAGGG telomeric DNA where it is essential for telomere protection (De Lange 2005;

Martínez and Blasco 2011). TRF1 genetic deletion in vivo induces a persistent DNA damage response at telomeres, which is sufficient to block cell division and induce senescence and/or apoptosis in different mouse tissues (Beier et al. 2012; Martínez et al. 2009;

Schneider et al. 2013). Interestingly, TRF1 is over-expressed in adult stem cell compartments as well as in induced pluripotent stem cells (iPS), where it is essential to maintain tissue homeostasis and pluripotency, respectively (Boué et al. 2010; Schneider et al. 2013). Over-expression of TRF1 has been also reported in several types of cancer such as renal cell carcinoma (Pal et al. 2015) and gastrointestinal tumors (Hu et al. 2010). Finally, we recently reported that induction of telomere uncapping by Trf1 genetic depletion or

Introduction

31

chemical inhibition can effectively block the growth of very aggressive and rapidly growing lung tumors in p53-defficient K-RasG12V-mice, in a manner that is independent of telomere length (García-Beccaria et al. 2015), further supporting that TRF1 could be a good anti- cancer target for aggressive tumors.

6. Glioblastoma Multiforme (GBM)

Malignant gliomas represent the majority of all primary central nervous system (CNS) neoplasms. Based on the cell type of origin, gliomas were first categorized into 4 different groups: astrocytomas (astrocytes), ependymomas (ependymal cells), oligodendrogliomas (oligodendrocytes) and mixed gliomas. Also, the World Health Organization (WHO) classified the central nervous system tumors into four different grades (grade I to grade IV) according to the histological characteristics and tumor aggressiveness (Louis et al. 2007).

The most frequent and aggressive glioma is glioblastoma multiforme, a grade IV astrocytoma (Louis et al. 2007). According to Medscape, it accounts for 12-15% of intracranial neoplasm and 50-60% of astrocytic tumors, with an incidence of 1-3 new cases per 100.000 people every year. The current treatments for GBM consist in surgical resection combined with radiotherapy and adjuvant chemotherapy. Despite all the advances in the molecular characterization of glioblastoma, the median survival has not improved in the last 50 years, being only about 14-16 months (Wen and Kesari 2008).

6.1 Molecular classification of Glioblastoma. The new era.

In 2016, the WHO integrated the classic classification based on histological analysis (Louis et al. 2007) with genome-wide molecular-profiling studies (Louis et al. 2016). It resulted in a revised version of tumor classification with important implications diagnosis, outcome prediction and individualized treatments. In the new classification, GBMs are

Figure 9. Advantages of targeting the shelterin complex

mainly divided into IDH-wildtype GBM, which represents the majority of the cases (about 90%) and corresponds to primary GBM; and IDH-mutant GBM, the remaining 10% of the cases that correspond to secondary GBM progressing from lower-grade gliomas (Louis et al.

2016).

The most common genetic alterations in IDH-wildtype GBM include mutations or homozygous deletions in important tumor suppressors like PTEN, CDKN2A and CDKN2B, as well as TERT promoter mutations (Aldape, K., Zadeh, G., Mansouri 2015). Also, EGFR and PDGFR gene amplifications are often detected (Aldape, K., Zadeh, G., Mansouri 2015).

Other less common alterations can occur in TP53, NF1, PIK3CA and PIK3R1 genes (Brennan et al. 2013).

Importantly, mRNA expression analysis categorized adult GBM in four different subtypes: proneural, neural, classic and mesenchymal (Verhaak et al. 2010). However, in many cases this division is not completely accurate, as the same sample could show patterns from more than one subtype (Brennan et al. 2009; Sottoriva et al. 2013; Verhaak et al. 2010). Each of the mentioned subtypes can be associated with canonical mutations, like PDGFRA amplification in proneural GBM, amplification of EGFR in classical GBM or loss of NF1 and P53 in mesenchymal GBM (Verhaak et al. 2010). In the case of the neural subtypes, no specific alterations have been yet identified.

6.2 Modeling GBM using the RCAS-Tva system

Genetically engineered mouse models (GEMM) mouse models of GBM have been essential to develop a deeper knowledge about GBM pathogenesis by underlying the mechanisms behind tumor initiation and progression, as well as to make preclinical testing of promising therapies.

Among the different strategies used to model GBM, the RCAS-Tva system represents one of the most relevant systems.

The RCAS vectors belong family of retroviral vectors derived from the avian sarcoma-leukosis virus (ASLV) family. These vectors only transduce genetically engineered mammalian cells that express the avian retroviral receptor Tva (Figure 10). In

GBM, this system has been broadly used by generating transgenic models which express the Tva receptor under the promoter of Nestin or Gfap, well-known markers for glial progenitor and astrocytes, respectively. This strategy allows specifically targeting the cell of

Figure 10. RCAS-Tva system

Introduction

33

interest with different oncogenic insults, allowing the generation of different GBM subtypes.

For example, overexpression of PDGF ligands (PDGFA or PDGFB) in Cdk2a^-/- background leads to mesenchymal enriched tumors (PDGFB) or proneural tumors (PDGFA) in short periods of time (Ozawa et al. 2014). Also, knocking down Nf1 and p53, two important tumor suppressors in GBM, induces the mesenchymal subtype GBM (Ozawa et al. 2014).

6.3 Tumor heterogeneity and Glioma stem cells

GBMs are highly heterogeneous tumors at both cellular and molecular levels. Cells within the tumor present different expression profiles and may have different responses to radio- and chemotherapy (Bhat et al. 2013; Ohgaki and Kleihues 2009; Segerman et al.

2016). This complexity may account for the strong recurrence after treatment and the grave clinical outcome, highlighting the urgent medical need of new effective treatments (Chen, McKay, and Parada 2012).

Several studies point to the existence of a small fraction of cells within the bulk of the tumor with stem-like properties, also termed glioma stem-like cells (GSCs). These cells are able to recapitulate the original tumor after injection into the brain of immunodeficient mice (Singh et al. 2004). Furthermore, they exhibit radio- and chemoresistant properties, which might explain GBM recurrence after treatment (Bao et al. 2006) (Figure 11). Thus, these cells might be considered as the appropriate targets for new therapeutic interventions.

Figure 11. Tumor heterogeneity in GBM. After current therapies, GSCs remain in the brain and are able to recapitulate the whole tumor.

6.4 Telomeres in glioblastoma

As discussed in section 5, telomeres are considered potential anticancer targets due to the fact that more than 90% of human tumors aberrantly over-express telomerase (Joseph et al.

2010; Kim et al. 1994; Shay and Bacchetti 1997), while the remaining telomerase-negative tumors activate ALT (Barthel et al. 2017; Bryan et al. 1997). In the particular case of glioblastoma, the promoter of the catalytic subunit of telomerase (TERT) is mutated in 58- 84% of human primary GBMs (Arita et al. 2013; Boldrini et al. 2006; Brennan et al. 2013;

Koelsche et al. 2013; Nonoguchi et al. 2013), while pediatric GBMs frequently display an ALT phenotype associated with ATRX mutations (Heaphy et al. 2011; Schwartzentruber et al. 2012). Also, a component of the shelterin complex, POT1, has been found to be mutated in familiar glioblastoma cases (Bainbridge et al. 2015; Calvete et al. 2015; Newey et al.

2012; Ramsay et al. 2013; Robles-Espinoza et al. 2014; Shi et al. 2014; Zhang et al. 2014).

These facts highlight the importance of telomere maintenance in glioblastoma and thus, reinforce the possibility of achieving therapeutic effects in GBM by targeting the telomeres.

As previously discussed, most of the studies have focused in telomerase inhibition, which shows a main disadvantage: the effect is only achieved when telomeres are critically short. GBM is known for the high proliferative and infiltrative nature, as well as for the cancer stem cell or tumor initiating cell characteristics (Molina et al. 2010). In addition, GBM are also highly heterogeneous tumors (Soeda et al. 2015), which highlights the importance of targeting telomeres independently of telomere length, as telomerase based therapies may fail to kill all the tumor cells, including the tumor-initiating populations with stem cell-like properties. Together, these properties of GBM make us hypothesize that disrupting telomere stability by targeting TRF1 could open a new therapeutic window for the treatment of this disease.

Objectives/Objetivos

1. To study the potential of targeting telomeres through Trf1 inhibition in GBM mouse models. For this purpose, we aimed:

- To study TRF1 expression in different mouse GBM subtypes

- To deleteTrf1 simultaneously with tumor induction to address the effects of Trf1 deficiency in early stages of tumor initiation

- To delete Trf1 once the tumors are formed to study the potential of Trf1 abrogation in advanced tumors

- To analyze the effects of Trf1 deletion in vitro in both Neural Stem Cells and Glioma Stem Cells

- To address the impact of Trf1 brain-specific or whole-body depletion in the cognitive functions of healthy mice

2. To characterize the effects of TRF1 inhibition in human GBM. For this purpose, we aimed:

- To study TRF1 levels in human GBM samples

- To study the effects of TRF1 chemical modulation in vitro in human GBM cell lines and Glioma Stem Cells

- To address the impact of TRF1 chemical downregulation in Glioma Stem Cell- derived xenografts

Objectives/Objetivos

40

1. Estudiar el potencial de atacar los telómeros mediante la inhibición de TRF1 en modelos de ratón de GBM. Para ello, nos propusimos:

- Estudiar los niveles de TRF1 en diferentes modelos de GBM

- Delecionar Trf1 al mismo tiempo que inducimos los tumores para analizar los efectos de la deficiencia de Trf1 en fases tempranas de desarrollo tumoral.

- Eliminar condicionalmente Trf1 una vez los tumores están formados para estudiar el potencial de atacar Trf1 en los tumores avanzados.

- Analizar los efectos de delecionar Trf1 in vitro células madre neuronales y células madre de glioma.

- Estudiar el impacto de delecionar Trf1 (específicamente en el cerebro o en todo el organismo) en las funciones cognitivas de animales sanos.

2. Caracterizar los efectos de inhibir TRF1 en GBM humano. Para ello, nos propusimos:

- Analizar los niveles de TRF1 en muestras de GBM humanas.

- Estudiar los efectos de la modulación química de TRF1 in vitro en células humanas de GBM y en células madre de glioma.

- Investigar el impacto de la modulación química de TRF1 en xenografts derivados de células madre de paciente.

Materials and Methods

Materials and Methods

45

1. Mice experimentation

1.1. Mice generation

For the GBM experiments, Nestin-Tva (Holland et al., 1998; Hambardzumyan et al., 2011), Cdkn2a^-/- (Serrano et al., 1996) and Trf1^lox/lox (Martínez et al., 2009) mice were crossed to obtain the Trf1^lox/lox; Nestin-Tva; Cdkn2a^-/-; or Trf1^+/+; Nestin-Tva; Cdkn2a^-/- mouse models. These mouse models were further crossed with a mouse strain carrying ubiquitously expressed, tamoxifen-activated recombinase, hUBC-CreERT2 (Ruzankina et al., 2007) to generate Trf1^lox/lox; hUBC-CreERT2; Nestin-Tva; Cdkn2a^-/- and Trf1^+/+; hUBC- CreERT2 Nestin-Tva; Cdkn2a^-/- mice.

For xenograft experiments, athymic nude females were obtained from Harlan (Foxn1^nu/nu).

1.2. Mice maintenance

All mice were maintained at the Spanish National Cancer Centre (CNIO) under specific pathogen-free conditions in accordance with the recommendations of the Federation of European Laboratory Animal Science Associations (FELASA). All animal experiments were approved by the Ethical Committee (CEIyBA) from the CNIO and performed in accordance with the guidelines stated in the International Guiding Principles for Biomedical Research Involving Animals, developed by the Council for International Organizations of Medical Sciences (CIOMS). Along with those guidelines, mice were monitored in a daily or weekly basis and they were sacrificed in CO₂ chambers when the human endpoint was considered.

Mice were maintained on a 12-hour light/12-hour dark cycle. During light cycle, white light was provided by fluorescent lamps (TLD 36W/840 and TLD58W/840, Philips). Mice had free access to water and standard chow diet (18% of fat-based calory content, Harlan Teckland 2018). Trf1^lox/lox or Trf1^+/+;hUBC-CreERT2 mice received intraperitoneal injections of tamoxifen (2 mg/injection, 4-6 injections) for short-term experiments or they were fed ad libitum with tamoxifen containing diet for long-term experiments.

1.3 Mice genotyping

Mice genotyping was performed by Transnetyx private company (Cordova, TN 38016), except for tamoxifen treated mice. In these mice, Trf1 deletion was assessed by standard PCR.

- Transnetyx genotyping

Transnetyx uses a RT-qPCR based system and Taqman probe technology to measure the presence or absence of a desire sequence. The following probes were used to assess the different mouse genotypes:

CRE – used to test for Cre; targeted to sequence within the Cre gene coding region.

Forward Primer Sequence: TTAATCCATATTGGCAGAACGAAAACG Reverse Primer Sequence: CAGGCTAAGTGCCTTCTCTACA

Probe Sequence: CCTGCGGTGCTAACC

Terf1-3 MD – used to test for Trf1^lox; targeted to a sequence unique to the Trf1 recombined allele.

Forward Primer Sequence: GCTATACGAAGTTATTCGAGGTCGAT Reverse Primer Sequence: GGTGGCGGCCGAAGT

Probe Sequence: CTCTAGAAAGTATAGGAACTTC

Terf1-3 WT – used to test for Trf1+; targeted to sequence at the 3’ loxP insertion site.

Forward Primer Sequence: GAGACGGCGCGAAACC Reverse Primer Sequence: GCGGGAGCCAGGACTTC Probe Sequence: CCGCTTCCTGTTTGCTG

Tva- used to test the presence of the Tva transgene Forward Primer Sequence: CACAGAGGCTCCCACTGT Reverse Primer Sequence: ATGCGGCCGTGATTCCT Probe Sequence: CTGGACGTGCTCTGCC

p16 WT- used to test the presence of the p16 allele

Forward Primer Sequence: CGAGGACCCCACTACCTTCT

Materials and Methods

47

Reverse Primer Sequence: CCGCTCTTGGGCCAAGT Probe Sequence: CAGGCATCGCGCACAT

p16 KO- used to test the absence of the p16 allele

Forward Primer Sequence: CTCTACTTTTTCTTCTGACTTTTCAGGTG Reverse Primer Sequence: CCCCTACCCGGTAGAATTGAC

Probe Sequence: ATGATGATGGGCCCCCGTC

- PCR genotyping

After tamoxifen treatment, Cre mediated Trf1 deletion was assessed by the following primers:

Forward Primer (E1-popout): 5’ ATAGTGATCAAAATGTGGTCCTGGG 3’

Reverse Primer (SA-R1): 5’ GCTTGCCAAATTGGGTTGG 3’

With this pair of primers, the excised Trf1^∆ allele gives an amplified band of 0.48 kb whereas the unexcised Trf1^lox allele gives an amplified band of 1.5 kb. Trf1⁺ allele gives a band of 1.4 Kb.

1.4 Generation of mouse models with brain tumors

The RCAS/Tv-a system used in this work has been previously described (Holland et al., 1998; Hambardzumyan et al., 2009). Adult mice (4.5-6 weeks old) were injected in the SVZ with 1 μl of DF-1 chicken fibroblasts producing RCAS-Cre, RCAS-PDGFB-HA, RCAS- PDGFA-MYC, RCAS-GFP-shNf1 or RCAS-RFP-shp53 as described at a concentration of 200.000 cells/μl, with the exception of RCAS-Cre producing cells that were injected at a concentration of 600.000 cell/μl. All mice were monitored and killed whenever they presented symptoms of brain tumor development. For all studies we used both male and female mice.

1.5 Intracranial cell transplantation into syngeneic mice

Spheres were dissociated using a 200 μl pipette and were resuspended in a concentration of 100.000 cells/μl. From these aliquots, 1 μl was injected into the brain of adult syngeneic mice. All mice were monitored and killed whenever they presented symptoms of brain tumor development.

1.6 Xenografts experiments

h676 and h543 patient-derived GSCs were dissociated using a 200 μl pipet and resuspended in NeuroCult medium and matrigel in a 1:1 ratio in a concentration of 1000 cell/μl. Nude mice (athymic Nude-Foxn1^nu/nu from Harlan) were injected subcutaneously with 100 μl of the cell preparation. ETP-47037 (or vehicle) was orally administrated at a concentration of 75 mg/kg 5 days per week (see also section 8), starting one week after cell injection. The vehicle consisted in 10% N-methyl-2-pyrrolidone (NMP, Sigma Aldrich) and 90% poly ethylene glycol (PEG, Sigma Aldrich). Mice were weighted and tumors were measured every 2-4 days. Tumor area was determined by the following equation: A = π * (a/2) * (b/2), were a and b are tumor length and width respectively.

1.7 Cognitive tests

To evaluate memory skills, mice were tested by the object recognition test (Bernardes de Jesus et al., 2012). A total of two 3 different objects were used for the test, two identical objects (A) and a third different object (B). In day 1, mice were placed in a box with the two identical objects for 10 minutes. In day 2, one of the objects was replaced by object B and the mice were again placed for ten minutes and recorded with a camera.

Analysis was made by calculating time spent with object B divided with time spent with (A+B).

To check the ability to smell, mice were tested by the buried food test (Yang &

Crawley, 2009). Mice were fasted for 24 hr and they were placed in a cage with a buried pellet food. Analysis was made by calculating the percentage of success and the time spent to find the food pellet.

To measure coordination and balance, mice were tested in a Rotarod apparatus (model LE 8200) and with the tightrope test. In the rotarod test we measured the time mice could stay on the rod. In the tightrope test, we evaluate the ability of the mice to stay in the rope without falling, and we considered a “success” if mice were able to stay more than one minute.

Materials and Methods

49

2. Cell culture

Human astrocytes (HA), U251 cells, U87 cells, T98G cells, 293T cells and DF1 cells (ATCC) were grown at 37°C in 10% FBS (GIBCO) containing DMEM (GIBCO). Mice glioma and neural stem cells and patient-derived glioma stem cells (h543 and h676) were cultured in neurosphere medium from NeuroCult (Stem Cell Technologies Inc, Vancouver, Canada) supplemented with 10 ng/ml EGF (Gibco), 20 ng/ml basic-FGF (RD Systems) and 1mg/ml Heparin (Stem Cell Technologies).

2.1 Cell transfection

DF1 cells were transfected with the RCAS-Cre, RCAS-PDGFB-HA, RCAS-PDGFA- MYC, RCAS-GFP-shNf1 or RCAS-RFP-shp53 viral plasmids using Fugene 6 Transfection reagent (Roche), accordingly to manufacture protocol.

pGIPZ lentiviral TRF1 shRNAs and pGIPZ-scrambled shRNA were introduced in the U251 glioma cell line using standard lentiviral infection procedures.

2.2 Neural Stem Cell (NSC) and Glioma Stem Cell (GSC) isolation

NSCs were obtained by neonatal brain digestion with papain (Worthington). GSCs were extracted from mice tumors using the same procedure. As described above, both mice NSC and GSC were cultured in neurosphere medium from NeuroCult (Stem Cell Technologies Inc, Vancouver, Canada) supplemented with 10 ng/ml EGF (Gibco), 20 ng/ml basic-FGF (RD Systems) and 1mg/ml Heparin (Stem Cell Technologies). Cells were grown in NeuroCult medium suspension or in adhesion in laminin (Life Technologies) coated plates.

2.3 Neurosphere formation assays

Spheres were dissociated into single cells and seeded at a density of 50, 100, 200 and 400 cells/well in a 96 well plate. Neurosphere number was assessed after 7 days.

Pictures were taken using Nikon Eclipse Ti-U microscope and neurosphere diameter was measured using NIS Elements BR software.

2.4 Irradiation and temozolomide

Cells were irradiated with 6 Gy using the irradiation apparatus MDS Nordion Gamma Cells 1000. Cells were treated with temozolomide at a concentration of 500 μM or 1000 μM for three days.