Molecular phylogenetics of pristimantis (anura: strabomantidae) and the origin and diversification of central american species

Texto completo

(1)Molecular Phylogenetics of Pristimantis (Anura: S trabomantidae) and the origin and diversification of Central American species. Nelsy Rocío Pinto Sánchez. Trabajo de grado p resentado para optar al título de M aestría en Ciencias Bioló gicas. Director S antiago Madriñán, Ph.D . Profesor Asociado del Departamento de Ciencias Bioló gicas Universidad de los Andes. Codirector Andrew J. Cra wford, Ph.D. Investigador Instituto Smithsonian de Investigaciones Tropicales. Bogotá D. C., Noviembre 2008.

(2) ABSTRACT Pristimantis (Anura: Strabomantidae) represents an exceptionally diverse group among Neotrop ical anurans, but the evolutionary relationship s among subgeneric groups are p oorly known. Using both original and p ublished multilocus DNA sequence data, we develop ed a novel phy logenetic hyp othesis for this genus. Ingroup sampling in cluded 30.9% of the described sp ecies (265 individu als from 132 sp ecies, of which 156 individuals from 34 sp ecies are new data). Genetic d ata includ ed three mitochondrial (COI, 12S, 16S) and two nuclear mark ers (Rag-1 and Tyr) for a total of ~4279 base p airs. Phylogenies were inferred usin g parsimony , maximum likelihood and Bay esian analy ses of individual genes and combin ed data sets. The new p hylogenetic hy p othesis conflicts with most recognized taxonomic group ings. Within Pristimantis, the peruvianus group was the only group recovered, whereas the "conscipilla tus”, “curtipes”, “devillei”, “frater”, “lacrimosus”, “myersi”, “orestes”, “surdus”, and “unistrigatus” were not supported as natural group s. The molecular p hy logeny suggests that the colonization of Central America by South American Pristimantis involved p erhap s 13 indep endent events. Our results suggest alternative interp retations of Pristimantis taxonomy, character evolution, and bio geo grap hy , top ics that now demand more extensive evaluation in future studies. Keywords: Anura, Strabomantidae, Pristimantis, Terrarana, Co lombia, Central America, Great American Biotic Interch an ge, M olecular p hy logenetics..

(3) INTRODUCTION Pristimantis Hed ges et al. (2008) is a Strabomantidae genus which has been assigned to Terrarana (sensu Hedges et al. 2008), with 427 species is the genus of amp hibian with the greatest number of sp ecies in the Americas (Ly nch 1986, Ly nch & Duellman 1997, Camp bell 1999, Duellman 1999, Hed ges 1999, Frost 2008, AmphibiaWeb 2008, Hedges et al. 2008). However, from an evolutionary and taxonomic viewp oint, this clade of frogs is one of the least known of the major group s of vertebrates. Although new sp ecies are recognized and described annu ally, taxonomists have been incapable of agreeing for the most p art on how to organize those sp ecies to better reflect their evolutionary history (e.g., Ly nch 1976, Savage 1987, Ly nch & Duellman 1997, Frost et al. 2006; Hedges et al. 2008). The taxonomic confusion in p art shows the insufficiency of characters availab le for study ing the group and the p lasticity of the few “useful” characters (Hedges et al. 2008). During the past five y ears Terrarana sy stematics has undergon e somethin g of a revo lution as the molecular work has been jo ined by newly developed methods of analy sis. Until recently , nine studies using DNA sequences have been undertaken with these frogs, Darst & Cannatella (2004), Crawford & Smith (2005), Frost et al. (2006), Padial et al. (2007), Padial et al. (2008), Heinick e et al. (2007), Crawford et al. (2007), Hed ges et al. (2008), and Wan g et al. (2008). Exclud in g the Heinick e et al. (2007) and Hed ges et al. (2008) studies, the majority of these investigations have had limited taxon samplin g, includin g less than 5% of all “eleutherodactylines.” Ly nch & Duellman (1997) based exclusiv ely on insp ection of morp hological characters, such as relative len gth of digits assigned the sp ecies of “Eleutherodactylus” to 12 group s: myersi, sulcatus, cerasinus, conspicillatus, curtipes, dolops, devillei, loustes, orestes, surdus, diastema and unistrigatus. Although they considered each sp ecies group as monop hy letic, they did not p resent a formal p hy logenetic an aly sis. Subsequently , based on molecular data and p hy logenetic an aly ses Crawford & Smith (2005) elevated to Craugastor to the generic rank, leav in g the remain in g eleutherodacty lines sp ecies as a monophy letic group . Afterward Heinicke et al. (2007) restricted “Eleutherodactylus” to the South American clade of 87 sp ecies. -3-.

(4) (representing 397 sp ecies) as Pristimantis. Hed ges et al. (2008) prop osed the South American clad e division in three subgenera (Hypod yction, Pristimantis and Yunganastes) and 427 sp ecies. Pristimantis sensu Hedges et al. (2008) is distributed in Central American (eastern Honduras, Panamá, Honduras and Costa Rica), South America (Co lombia, Ecuador, Peru, Bolivia, Amazonian Brazil and the Guian as), Trinidad and Tobago, Grenada, and the Lesser Antilles (Amp hibiaWeb 2008). This genus is most diverse in northwestern South America, where its distribution includes the lowlands to elevations of about 4000 m in the Andes in Colombia, Ecu ador, and Peru (Frost 2008). Study ing the fauna shared between Colo mbia and Central American is motivated by the role of the Panamá Isthmus as a land brid ge and a driver of exp ansion, extinction, and the Great American Biotic Interch an ge (M arshall et al. 1982, M arshall 1988, Simpson 1940, Webb 1978, Webb & Rancy 1996) rough ly three million y ears ago (Coates et al. 2004). M olecular data have been used to investigate the imp act the origin of the Isthmus of Panama on marine organisms (Lessios 1979, Bermin gham & Lessios 1993, Knowlton et al. 1993), aquatic organisms (Bermin gham & M artin 1998) and terrestrial organisms (Zamudio & Greene 1997, Zeh et al. 2003, Weigt et al. 2005, Wan g et al. 2008). An interesting model to study the role of Isthmus of Panama is the genus Pristimantis, because it is a terrestrial organ ism distributed in Central American and South America, intolerant of salt water, unable to fly , and restricted to forested habitats. The geo graphic distribution of Pristimantis has showed that it was originated in South America (Vanzolini & Heyer 1985, Duellman 2001, Savage 2002, Heinick e et al. 2007, Hedges et al. 2008, Wan g et al. 2008). Therefore, we could d istinguish one biogeo grap hical hyp othesis by focusing on one imp ortant questions concernin g to Central American samp les. (1) Do all endemic C entral American samp les form a monop hy letic clade relative to South American samp les?. To answer this question, we inferred the sp atial and genealogical h istory based on mitochondrial and nuclear genes of Pristimantis and comp ared our results to p revious work as well as the geolo gical history of Central America isthmo.. -4-.

(5) METHODS Taxon sampling Throughout this work, we used the taxonomic classification p roposed by Hedges et al. (2008). In total, we samp led 156 individuals rep resenting 34 sp ecies (App endix 1). Additional sequences rep resenting 98 sp ecies and 109 individu als were download ed from GenBank (NCBI; App endix 2). We include 10 species as outgroup s, Craugastor daryi, C. longirostris (Craugastoridae); Agalychn is callidryas, Litoria caerulea (Hy lidae); and Lynchius flavomaculatus, L. nebulanastes Oreobates cruralis, O. saxatilis, Phrynopus auriculatus, P. bracki (Strabomantidae). Recent studies based on molecu lar data (Hed ges et al. 2008) supp ort the hypothesis that Lynchius, Oreobates and Phrynopus genus are the sister sp ecies of Pristimantis. Other group p rop osed to be closely related to Strabomantidae is Crau gastoridae. We used some sp ecies of Hy lidae as more d ivergent outgroup s to root the p hy logeny .. Sp ecimens were collected in 7 countries (Ap p endix1). Museum material was made available for morp hological and molecular examination by the Circulo Herp etológico, Panama (CH); Colección herp etológica, Universidad Industrial de Santander, Colo mbia (UIS-H), Museum Bolivia Herp etology , Bolivia (M BH); M useo de Herpetología de la Universidad de Antioquia, Colo mbia (M HUA), and the Museo de Zoología d e la Pontificia Universidad C atólica d el Ecuador, Ecuador (QCAZ). Tissue samp les were obtained from sp ecimens listed in Ap p endix 1. Tissues were collected in the field and p reserved in 99% ethanol or a 20% solution of dimethy lsulfoxide (DM SO) saturated with NaCl (Amos &Hoelzel 1991, cited in Amos et al. 1992) with the addition of 0.125 M EDTA. Sp ecimens were dep osited at p ublic research institutions. Voucher numbers, locality information, and GenBank accession numbers for each sp ecimen are listed in Appendix 1.. -5-.

(6) La boratory techniques We sequenced the following three mitochondrial genes: 16 S rRNA (16S), 12SrRNA (12S), and COI. For a subset of samp les we also obtained DNA sequence data from two nuclear exon gene regions: the recombination activating gene 1 (Rag-1) and the ty rosinase gene (Tyr) (Table1). The mitochondrial gen es were chosen because they display a slower rate of evolution in an attempt to avoid saturation p roblems (Heinicke et al. 2007). The fragment of the nuclear gene Ty r was chosen because it has been useful in other studies (Bossuy t & Milinkovitch 2001, Frost et al. 2006, Hedges et al. 2008, Heinicke et al. 2007). The fragment of the nuclear gene Rag-1 is from the relatively faster-evolvin g first half of the gene (Hedges et al. 2008, Heinicke et al. 2007). The molecular p rocedure was p erformed at the Instituto de Genética, Universidad de los Andes (Colombia) and the Instituto Smithsonian de Investigaciones Trop icales (Panamá). Genomic DNA was extracted from liver and /or thigh muscle tissue using Qiagen QIAamp tissue kit. PCR amp lification of gene fragments was p erformed in 12.5-ml reactions using 0.125 Qiagen Taq, 1.25 µl Buffer 10X with 1.5mM of MgCl2, 1.25µl dNTPs at 2mM , 0.625 µl forward and reverse p rimers at 10 mM, and 1 ml of extracted DNA (more for low-quality tissue). Standard reaction conditions were an initial ho ld for 5 min at 94°C; followed by 29 cy cles of 94°C/30 s, 55°C (for 16S and 12S) 52°C (for COI) and 60°C (Rag-1 and Ty r) for 30 s and 72°C/60 s. After 29 cy cles, a final ho ld of 72°C/7 min was p erformed before termin ating the reaction at 4°C. For low- or nonyielding samp les, annealin g temp erature was dropp ed from 60°C to 46°C. Primers used in PCR reactions were obtained from the literature or designed in the lab (see Table 1). Poly merase chain reaction (PCR) p roducts were cleaned by gel slicing and agarose digest, or Exo I/SAP digest. For each individual, both H (heavy ) and L (light) strands were sequenced d irectly . Cy cle sequencing reactions were completed usin g the corresp onding PCR p rimers and BigDy e Terminator (App lied By osciences), with a standard cycle sequencin g p rofile (96°C/60 s; 30 cy cles of 96°C /10 s, 50°C/15 s and 60°C/4 min; and 72°C /7min). DNA sequencin g was p erformed with an ABI Prism 3100 sequencher (PE App lied Biosystems).. -6-.

(7) The DNA sequences were analy zed with Sequencher 4.2 (Gene Codes Corp oration) and Geneious 3.7.0 (Biomatters Ltda). The alignments were conducted in itially using MAFFT version 6 (Katoh 2002) under default p arameters. M anual adjustments using M acClade ver. 4.07 (M addison & M addison 2000) were p articularly important in p rotein codin g genes (COI, Rag-1 and Tyr) to maintain readin g frames. The 16S and 12S gen es are a high ly conserved mitochondrial marker but mutations are common in some variable regions, corresp onding to loop s in the ribosomal RNA structure. Therefore these alignments were insp ected for errors and comp ared against secondary structure models available from the Europ ean ribosomal RNA database. Regions of uncertain homo lo gy were excluded from p reliminary analy sis using G-block 0.91b (Castresana 2000), and manual p runin g guided by the results obtained therein. GenBank accession numbers will be provided for all DNA sequences obtained for this study up on accep tance of this manuscrip t, and all alignments will be made available at TreeBase (http://www.treebase.org) (accession numb ers: xxxxxxxxx). Phylogenetic analyses With our data and Gen-Bank information, we constructed four matrices, the first one with 243 individuals and 2503 ribosomal base p airs, the second one with 243 individuals and 3115 mitochondrial b ase pairs, the third one with 80 individuals and 4279 mitochondrial and nuclear characters), the last one 132 sp ecies (265 individuals and 4279 mitochondrial base p airs). Phylogenetic analyses were conducted using maximu m parsimony (M P), maximum likelihood (ML), and Bay esian methods for individual genes, as well as for the concatenated dataset (see data p artitions). For M P analysis we performed a heuristic search with 10000 rep licates of random taxon-addition and TBR branch swap ping, with gap s treated as missing ch aracters, usin g PAUP* version 4.0b10 (Swofford 2002) as imp lemented in CIPRES portal. Non-p arametric bootstrap values (Felsenstein 1985) were. -7-.

(8) obtained with 5000 rep licates, each havin g ten replicates of random taxon-addition.. For ML and Bay esian analysis, we used Modeltest version 3.7 (Posada & Crandall 1998) to evaluate different models of evolution. We selected the model obtained by means of the criterion of Akaike or AIC (Akaike 1973) as this allowed us to simultaneously comp are non-nested models, assess model selection uncertainty , and allowed for the estimation of model p arameters usin g all availab le mod els (Posada & Buck ley 2004). M aximum likelihood analyses were run in RAxML 7.0.0 (Randomized Axelerated M aximum Likelihood, availab le at http ://www.p hy lo.org/) (Stamatakis et al. 2008), which uses GTRCAT as an app roximation for GTR+Gamma. Node supp ort was assessed via 1000 bootstrap rep licates.. We conducted Bay esian p hy logenetic an aly ses using M rBay es, version 3.1 (Ronquist & Huelsenbeck 2003) as imp lemented in CIPRES portal, under the same model as in the M L analy sis. We conducted two parallel runs of the M CMC algorithm for 10 million gen erations each, samp led one tree p er 1000 gen erations. All runs emp loy ed four chains with M etropolis coup led MCMC heating. In all search es stationarity of the M arkov Chain was determined as the p oint when samp led log likelihood values p lotted against gen eration time reached a stable mean equilibriu m valu e; "burn-in" data samp led from gen erations p recedin g this p oint were discarded (Huelsenb ack & Ronquist 2001). The graphics were visualized usin g Tracer 1.3 (Rambaut & Drummond 2003).. Initially each gen e fragment was analy zed individually . Top ologies resulting from each gen e were co mp ared to detect areas of incon gruence that were strongly supp orted by bootstrap values and/or p osterior probabilities (Wiens 1998). We did not emp loy the Incongru ence Len gth Difference (ILD) test because its power to detect incongruence is extremely low when the incongru ence is caused by different topologies, when the number of informative sites is small, and the heterogeneity of among-site substitution rate is. -8-.

(9) large. Besides the incon gruence caused by unequal branch len gths does not appear to be detected easily by the ILD test (Barker & Lutzoni 2002, Darlu & Leco intre 2002).. Our goal was to analy ze the data jointly . Because our combined d ata set is comp rised of one p rotein-coding mitochondrial gene (COI), two ribosomal genes with secondary structure (12S and 16S), and two nuclear genes (Rag-1 and Ty r), we susp ected that app lication of a single nu cleotide substitution model was unlikely to p rovide a p articularly good fit to the data (e.g., Ny lander et al. 2004, Brandley et al. 2005). Therefore, we p artitioned the data set by gene (12S, 16S, COI, Rag-1 and Ty r), but analyze the data jointly .. Divergence times Times of divergence were estimated for the 80-species data set by using the p rogram BEAST v1.4.6 (Drummond & Ramb aut 2007). The assumed topology was from the fivegen e M L analy sis. The dataset was analyzed under the GTR+Gamma model with a relaxed clock, allowin g branch lengths to vary accordin g to an uncorrelated Lognormal distribution (Drummond et al. 2006). This p rogram co-estimates p hy logeny and divergence times under a new class of relaxed clock models. For sp ecies-level p hy logenies, the Yule tree p rior that assumes a constant sp eciation rate p er lineage was used, as suggested by Drummond et al. (2006). The “treeModel.RootHeight” p rior (i.e., the age at the root of the tree) was set to 57 million y ears (with a standard deviation of 14 million y ears), in accord ance with results from Roelants et al. (2007). We used the Central American clade (Craugastor) as calibration point (42 million y ears with a standard deviation of 11 million y ears) accordin g to Heinicke et al. (2007). All other p riors were left to the defaults in BEAST. Parameters were estimated usin g 2 indep endent runs of 1 million generations each (with a p re-run burn-in of 10000 generations), with p arameters samp led every 1000 generations. Convergence was ch ecked in the Tracer v1.4.6 p rogram and summary trees were. -9-.

(10) gen erated usin g TreeAnnotator v1.4.6, both p art of the BEAST package.. Hypothesis testing Phylogenetic Predictions: We tested predictions from the p ossibility that the taxonomic group s "conscipilla tus”, “curtipes” “devillei”, “frater”, “lacrimosus”, “myersi” “orestes”, and “unistrigatus” amon g Pristimantis genus were monop hyletic. Seven a priori tree top ologies were constructed with MacClade ver. 4.07 (M addison & M addison 2000). Every one top ology p resented each individual group as monophy letic, without any relationship among the group s. With the top ologies with constrain is running a new M L search. The significance of the difference in the sum of site-wise log-likelihoods for all trees is evalu ated by bootstrap samp ling of site scores with 1000 rep licates and then calculating how far the observed differen ces are from the mean of the bootstrap rep licates (Shimodaira & Hasegawa 1999).. Biogeographic Predictions: We generated a biogeo graphical hy p othesis from distributional data for Pristimantis and from geolo gical d ata on the formation of the Isthmus (Coates & Obando 1996, Coates et al. 2004). Pristimantis is thought to have origin in South America (Vanzolin i & Hey er 1985, Duellman 2001, Savage 2002, Heinicke et al. 2007, Hed ges et al. 2008, Wan g et al. 2008). Today Pristimantis is distributed on Central American and South America. However, the incomp lete isthmus up heaval before 3.1 My a (Coates & Obando 1996) could rep resent a significant disp ersal barrier b etween South America and Central America. Therefore, to achiev e its p resent distribution we assume that the ancestor of Centroamerica Pristimantis likely had one disp ersal history . It may have disp ersed along Panamá Isthmus and invaded the Central America land. Therefore our a priori hy p othesis is that all Central America sp ecies form a monop hy letic clade relative to South American samples.. -10-.

(11) This hyp othetical top ology was comp ared to the top ology obtained with M L using the p aired-sites test (SH) of Shimodaira & Hasegawa (1999) as imp lemented in PAUP version 4.0b10 (Swofford 2002). The SH tests whether a M L p hy logenetic tree estimated under a top ological constraint is significantly worse than the optimal (unconstrained) tree.. RESULTS AND DISCUSS ION Phylogenetic analysis The final data set for all five gene regions comp rised 4279 base pairs (612 from COI, 1543 from 16S, 960 from 12 S, 633 from Rag-1 and 531 from Tyr), from 265 individuals and 132 sp ecies(Figure 4, 5). We show Maximum p arsimony (MP) and likelihood (M L) trees for 80-data set (Figs. 1 and 2) because it is the data set wit h the comp lete data (4279 characters), except for COI gen e and in clude bootstrap confidence valu es and Bay esian confid ence values (p osterior p robabilities) on nodes. Bay esian inference analyses y ielded trees very similar in top ology to those obtained from Maximum likelihood. The data set was combined because strongly supp orted conflicts were absent when comp aring the ind ividual gene trees. For ML and Bay esian analyses, ModelTest selected in the majority of cases the GTR+I+G model as op timal for each gene (Table 2). Base co mposition, gamma p arameters, and a prop ortion of invariant sites for each of the data sets are p resented in Table 2. The A−G and C−T substitution (see Table 2, bold letter) rate p arameters have higher relative importance valu es than the transversion parameters. This indicates that for these data it is imp ortant to allow the two transition typ es to have different rates, more so than the transversion typ es. As expected, mitochondrial genes p resented more variability amon g taxa than nuclear genes (Table 3).. -11-.

(12) In gen eral in all topologies we observe that Pristimantis was a monop hyletic genus with significant supp ort (100%) in the MP, M L and Bay esian analy sis. In all trees, it app ears as a close relative of the clade contain in g Lynchius, Oreobates, and Phrynopus, with support (100%) in the MP, M L and Bay esian analy sis (Figure 1-2). Hedges et al. (2008) p roposed that there are three subgenera n amed as Hypodictyon, Pristimantis and Yunganastes within Pristimantis. Based on our p reliminary top ologies (figures 1-4) these clades are not recovered. Within Pristimantis, the peruvianus group was the only group recovered and well supported (100%) (Figure 1-2) while " conscipillatus”, “curtipes”, “devillei”, “frater”, “lacrimosus”, “myersi”, “orestes”, “surdus”, and “unistrigatus” app ear as non-natural group s. For the chalceus, galdi, and orcesi group s, we only have one species rep resenting each one of these group s; therefore we cannot infer any thing about monop hy ly of these group s. Comp aring the Figure 1 hyp othesis with the a priori topology with each one of the group s as monop hy letic is p ossible concluded that each top ology with each one of the group s as monop hyletic was rejected with P<0.05. Based on our molecular p hy logenies (Figs. 1–2 and sup plementary material Figs. 3-8) many of the sp ecies group s recovered here are d emonstrably not monophy letic. Our hyp otheses disagree with the p reviously defined morp hological sp ecies group s (Ly nch & Duellman 1997). Our results show that the Pristimantis group s p rop osed by Ly nch & Duellman (1997) based on morp hological characters are p henetic group s. Therefore, is necessary to search for morp hological homo lo gous characters that allow the definition of the groups p roposed by the molecular data. These discrep ancies and the limited taxon samplin g (132 sp ecies) make it difficu lt to define subdivisions within Pristimantis. We refrain fro m definin g other group s until DNA sequence data become availab le for a larger p rop ortion of the Pristimantis genus.. -12-.

(13) Divergence Times and Biogeographical history Dates of divergen ce were obtain ed by using the 80 data set (Figure 2). Our results indicate that the Pristimantis genus diverged fro m other eleutherodactylines in the Eocene 44 My a (with credibility interval CI of 32-60 Mya) and began an exp losive diversification 34 My a (CI=26-44 My a). The geolo gic epoch is concordant with the times p resented by Heinicke et al. (2007). M ost of the basal branches of eleutherodacty lines with some dating to the early Cenozoic (49.79 My a, CI=37.18-68.67 My a) occur in South America (Heinick e et al. 2007). This shows that South America was the p lace of origin for the genus Pristimantis, accord in g to Vanzolini & Heyer (1985), Duellman (2001), Savage (2002), Heinicke et al. (2007), Hedges et al. (2008), and Wan g et al. (2008). The rap id diversification within this genus began 34 My a and has continued to the present (Figure 2). The enormous diversity of sp ecies within this clade (427 sp ecies) accordin g to Hedges et al. (2008) is linked with the beginnin g Andean up lift (Ly nch 1986), which occurred in the last 10-20 million years (Gregory-Wodzicki 2002, M acFadden 2006). During this p eriod, mountain buildin g and associated climatic chan ges resulted in rep eating p atterns of habitat isolation and sp eciation in these amp hibians (Ly nch & Duellman 1997). An amazing p attern in our results is the app arent successful colonization of some sp ecies of the Pristimantis genus into Central American. The molecular d ata suggest a comp lex history at least of 13 sep arate invasions from South America to Central American (Figure 2). Comp aring this hyp othesis with the hyp othetical top ology with all Central American group s monop hy letic using SH tests it is possible to conclude that the top ology which assumes only one disp ersal event from South America to Central American can be rejected with P<0.05. These invasions occurred mainly 5-25 Mya in the M iocene ep och, which show that the Centroamerican Pristimantis sp ecies already occup ied the isthmian landscap e prior to the comp letion of the isthmian land brid ge 2.8-3.1 My a (Coates & Obando 1996). Although. -13-.

(14) these divergence times of Centroamerican sp ecies seem very great, it corresp onds with divergence times calculated for other group s as túngara fro gs (Weigt et al. 2005), P. ockendeni (Elmer et al. 2007), P. ridens (Wan g et al. 2008), freshwater fishes (Bermin gham & Martin 1998), and vip ers (Zamudio & Greene 1997). Actually , there is geolo gical information that supp orts the disp ersion towards Centroamerica from Southamerican Pristimantis. The fossilized mammals of raccons and giant ground sloths suggest that southern Central America had a dry -land connection (continuous p eninsula) to North America durin g the middle M iocene (Whitmore & Stewart 1965, Kirby & M acFadden 2005). This peninsula may have received in the late M iocene anuran colon ist from South America, such as P. ridens (Wan g et al. 2008), and the túngara fro g (Weigt et al. 2005). Pristimantis cou ld have arrived in Central America before the comp letion of the land brid ge by rafting (Ven ces et al. 2004), or through a p eriod of low sea levels in the end of the Miocene when the sea level was ap p roximately 60 m below today ’s level (Bermingh am & M artin 1998). However, the actual distribution of some sp ecies such as P. taenia tus (L clade) is also comp atible with disp ersal over land after the emergence of the Isthmus of Panamá (aprox. 3 My a). Other scenario although unlikely is that these dispersal events p robably occurred over water along islands in the West Indies (Heinicke et al. 2007 ; Hedges et al. 2008). Traditionally the colonization of a continent by an insular linage has been considered rare, and subsequent diversification is thought to be even rarer. Sev eral exp lanations based on faunal saturation on the main land and comp etitive disadvantage of island sp ecies have been adv anced to explain this p attern (Nicholson et al. 2005). The model of one-way colonization from continent to islands, and the ecological hy p otheses designed to exp lain it, must be revised as more studies reveal more than one invasion (R axworthy et al. 2002, Filardi & M oy le 2005, Dávalos 2007). However accord in g to our results the colonization through the western islands is less possible, because this hyp othesis require the migration of the sp ecies through the islands and then admit several events of extinction. Thus, in order to clarify the groups and the relationship among the sp ecies group s, additional studies are needed, in cludin g more taxa and morp hological and molecular app roaches (microsatellites). Although our results are p reliminary , the phy logenetic and. -14-.

(15) biogeo grap hic hy p otheses are based in the most parsimonious clado gram, which is the less refuted with the current evidence, and “this clado gram is only the focus of the next round of testing, and so it goes” (Klu ge 1997 :93).. ACKNOWLEDGMENTS We are grateful to the many individuals and institutions who p rovided the sp ecimens, p ermits, and tissue necessary for this study Roberto Ibañez, Cesar Jaramillo, C irculo Herpetológico, Panama (CH); M artha Patricia Ramirez, Colección Herpetológica, Universidad Industrial de Santander, Colombia (UIS-H); Eliana M uñoz, Vivian Páez, M useo de Herp etología de la Universidad d e Antioquia, Colombia (M HUA), Julio M ario Hoyos, M useo Javeriano de Historia Natural de la Pontificia Universidad Jav erian a and Luis Coloma, M useo de Zoología de la Pontificia Univ ersidad Católica del Ecuador, Ecuador (QCAZ). Research p ermits in Colombia were issued by the M inisterio del M edio Ambiente (No. 13 del 21 de Diciembre 2006) and in Pan amá by authoritation XXXXX. This study is included in the “Contrato para el Acceso del Recurso Genético No. 0040, del 11 de Enero de 2008” suscribed betweeen Nelsy Rocio Pinto Sánchez and the M inisterio del M edio Ambiente, Colombia. We are in d ebt with J. D. Ly nch by corroboration in the determination of specimens. For help in the laboratory , we would like to thank Grethel Grajales, Maribel Gonzalez, and Oris Sanjur. This work was supported by grants from the Institute Francisco José de Caldas, Colombia, for the adv ancement of Science and Technology (Colciencias) (Convenio No. 074 de 2006), Smithsonian Trop ical Institution (Adelante Fellow), Research Committe of the Faculty of Sciences at Universidad de los Andes. Useful comments on the manuscrip t were p rovided by X, X, and X. This research is part of the first author’s master’s thesis p resented at the Universidad de los Andes, Dep artamento de Ciencias Bioló gicas.. -15-.

(16) REFERENCES Amos W, Whitehead H, Ferrari MJ, Glockner-Ferrari DA, Pay ne R, Gordon J. 1992. Restrictable DNA from sloughed cetacean skin-its p otential for use in p op ulation analysis. Marine Mammal Science 8: 275-283. Akaike H. 1973. Information Theory and an Extension of the Maximu m Lik elihood Princip le. In : Petrov BN, Csaki F, (eds). Second International Symp osium on Information Theory. Budapest: Akademiai Ki-ado, p p . 267–281. AmphibiaWeb: Information on amp hibian bio lo gy and conservation [web ap p lication]. 2008. Berkeley , Californ ia: Amp hibiaWeb. Available from: http ://amp hibiaweb.org/. Barker FK, Lutzoni FM . 2002. The utility of the Incongruen ce Len gth Difference Test. Systematic Biolog y 51: 625-637. Bermin gham E, Lessios H. 1993. Rate variation of p rotein and mitochondrial DNA evolution as revealed by sea urchins sep arated by the Isthmus of Panama. Proceeding of the National Academy o f Sciences 90: 2734-2738. Bermin gham E, M artin AP. 1998. Comp arative mtDNA p hy logeograp hy of Neotrop ical freshwater fishes: testing shared history to infer the evolutionary landscap e of lower Central America. Molecular Ecology 7 : 499-517. Bossuy t F, Milinkovitch MC. 2001. Amphibians as indicators of early Tertiary ‘‘out-ofIndia’’ disp ersal of vertebrates. Science 292: 93-95. Brandley MC, Schmitz A, Reeder TW. 2005. Partitioned Bay esian analyses, p artition choice, and the p hy logenetic relationship s of scincid lizards. Systematic Biology 54: 373–390. Camp bell JA. 1999. Distribution patterns of amphibians in M iddle America. Pp. 111– 210. In: Duellman, W.P.(Eds.). Patterns of Distribution of Amp hibians: A Global Perspective. Johns Hop kins University Press, Baltimore, MD. Castresana J. 2000. Selection of conserved blo cks from multip le alignments for their use. -16-.

(17) in p hy logenetic analy sis. Molecular Biology and Evolution 17: 540 –552. Coates AG, Obando JA. 1996. The geolo gic evolution of the Central American Isthmus. In: Jackson JBC, Budd AF, Coates AG (Eds.). Evolution and Environment in Tropical America. University of Chicago Press, Chicago, IL, p p . 21-56. Coates AG, Collins LS, Aubry M P, Berggren WA. 2004. The geo lo gy of the Darien, Panama, and the late M iocene-Pliocen e collision of the Panama arc with northwestern South America. Geolog ical So ciety of America Bu lletin 116: 13271344. Crawford AJ, Smith E. 2005. Cenozoic bio geo grap hy and evolution in direct-develop ing frogs of Central America (Lep todacty lidae : Eleutherodactylus) as inferred fro m a p hy logenetic an aly sis of nuclear and mitochondrial genes. Molecular Phylogen etics and Evolution 35: 536-555. Crawford AJ, Bermingh am E, Polanía C. 2007. The role of tropical dry forest as long term barrier to disp ersal: a comp arative p hy logeo grap hical analy sis of dry forest tolerant and intolerant frogs. Molecular Eco logy 16: 4789-4807. Darlu P, Lecointre G. 2002. When do es the incongruence len gth difference test fail? . Molecular Biology and Evolution 19: 432–437. Darst CR, Cannatella DC. 2004. Novel relationship s among hy loid fro gs inferred from 12S and 16 S mitochondrial DNA sequences. Molecular Phylogenetics and Evolution 31: 462–475. Dávalos LM. 2007. Short-faced bats (Phyllostomidae: Stenodermatina): a Caribb ean radiation of strict frugivores. Journal o f Biog eography 34: 364-375. Drummond AJ, Ho SYW, Phillip s M J, Rambaut A. 2006. Relaxed p hy logenetics and dating with confidence. Plos Biology 4: 699-710. Drummond AJ, Rambaut A. 2007. BEAST: Bay esian evolutionary analysis by samp ling trees. BMC Evolutionary Bio logy 7: 214. Duellman WE.1999. Distribution p atterns of amphibians in South America. Pp. 255–328. -17-.

(18) In: Duellman WP.(Eds.). Patterns of Distribution of Amphibians: A Global Perspective. Johns Hop kins University Press, Baltimore, MD. Duellman WE 2001. The hy lid frogs of Middle America. Contribu tions herpetology 18: 695-1158. Elmer KR, Dávila JA, Lougheed SC. 2007. Cry ptic diversity and deep divergence in an upp er Amazonian frog, Eleutherodactylus ockenden i. BMC Evolutionary Bio logy. doi: 10.1186/1471-2148-7-24. Felsenstein J. 1985. Confidence limits in phy logenies: an ap p roach using the bootstrap. Evolution 39: 783-791. Filardi CE, Moy le RE. 2005. Sin gle origin of a p an-Pacific b ird group and up stream colonization of Australasia. Nature 438: 216-219. Frost DR, Grant T, Faivovich J, Bain RH, Haas A, Haddad CFB, De Sa RO, Channin g A, Wilkinson M, Donnellan SC, et al. 2006. The Amphibia tree of life. Bulletin o f the American Museum of Natural History 297: 1-371. Frost DR. 2008. Amp hibian Sp ecies of the World: an Onlin e Reference.Version 3.0 (22 August, 2004). Electronic Database accessible at http ://research.amnh.org/herp etology /amp hibia/index.html. American Museum of Natural History , New York, USA. Gregory -Wodzicki KM . 2002. A late M iocene subtrop ical-dry flora from the northern Altiplano, Bolivia. Paleogeography Pa laeoclime Pa laeoecology 180 : 331-348. Hedges SB. 1999. Distribution p atterns of amp hibians in the West Indies. Pp . 211-254. In: Duellman, W.P. (Eds.), Patterns of Distribution of Amp hibians: A Global Perspective. Johns Hop kins University Press, Baltimore, MD. Hedges SB, Duellman WE, Heinicke M P. 2008. New World direct-develop ing fro gs (Anura: Terrarana): M olecular p hylogeny , classification, bio geo grap hy , and conservation. Zootaxa (1737): 1-182.. -18-.

(19) Heinicke MP, Duellman WE, Hedges SB. 2007. Major Caribb ean and Central American frog faun as originated by oceanic disp ersal. Proceed ings of the National Academy of Scien ces (USA) 104: 10092-10097. Huelsenbeck JP, Ronquist F. 2001. M RBAYES: Bay esian inference of phy logeny . Bioinformatics 17: 754-755. Kirby MX, M acFadden B. 2005. Was southern Central America an archip elago or a p eninsula in the middle M iocene? A test using land-mammal body size. Palaeogeography Palaeo climato logy Pa laeoecology. 228: 193-202. Kluge AG. 1997. Testability and the refutation and corroboration of cladistic hyp otheses. Cladistics 13: 81-96. Knowlton N, Weight LA, Solórzano LA, Mills DK, Bermingh am E. 1993. Div ergence in p roteins, mitochondrial ADN, and rep roductive comp atibility across the Isthmus of Panama. Science 260: 1629-1631. Lessios H. 1979. Use of Panamanian sea urchins to test the molecular clock. Nature 280: 599-601. Ly nch JD. 1976. The sp ecies groups of the South American fro gs of the genus Eleuth erodactylus (Lep todacty lidae). Occasional Papers of the Museum of Na tural History, the University of Kansas 61: 1–24. Ly nch JD. 1986. Origins of the high Andean Herpetological fauna. Pp . 478-499. In: Vuilleumier F, M onasterio M. (Eds.).High altitude trop ical bio geograp hy. Oxford university p ress. 649pp . Ly nch JD, Duellman WE. 1997. Fro gs of the genus Eleuth erodactylus in western Ecuador Sy stematics, ecology , and bio geo grap hy . University of Kansas Museum of Natural History Specia l Publications 23: iv+236 pp . M acFadden, BJ. 2006. Extinct mammalian biodiversity of. the ancient New World trop ics. Trends in Ecology and Evolution. 21 : 157-165 M addison DR, M addison WP. 2000. M acClade: analy sis of p hylogeny and character. -19-.

(20) evolution. Vers. 4.0. Sinau er, Sunderland, M. A. MAFFT version 6, M ultip le alignment p rogram for amino acid or nu cleotide sequ ences. Available at: http ://align.b mr.ky ushu-u.ac.jp /mafft/online/serv er/. Katoh K, Misawa K, Kuma K, M iy ata T. 2002. “MAFFT: a novel method for rap id multip le sequence alignment based on fast Fourier transform.” Nucleic Acids Research 30: 3059-3066. M arshall LG, Webb SD, Sep koski JJ, Raup DM . 1982. Mammalian evolution and the great American interchan ge. S cien ce 215: 1351-1357. M arshall LG. 1988. Land mammals and the great American interchan ge. American Scientist 76: 380-388. Ny lander JAA, Ronquist F, Huelsenbeck JP, Nieves-Aldrey JL. 2004. Bay esian p hy logenetic an aly sis of combined data. Systematic Biolog y 53: 47–67. Padial JM , Castroviejo-Fisher S, Köhler J, Domic E, De la Riv a I. 2007. Sy stematics of the Eleutherodactylus fraudator species group (Anura: Brachy cephalidae). Herpetologica l Monographs 21: 213-240. Padial JM , Chap arro JC, De la Riva I. 2008. Sy stematics of Oreobates and the Eleuth erodactylus discoidalis sp ecies group (Amphibia, Anura) based on two mtDNA genes and external morp holo gy . Zoological Journal of the Linnean Society 152: 737–773. Posada D, Buckley TR. 2004. Advantages of AIC and Bay esian ap p roaches over likelihood ratio tests for model selection in p hy logenetics. Systematic Biology 53: 793-808. Posada D, Crandall KA. 1998. M odelTest: Testing the model of DNA substitution. Bioinformatics 14: 817-818. Rambaut A, Drummond AJ. 2003-2005. Tracer. Available at <http://tree.bio.ed.ac.uk/software/tracer/>. -20-.

(21) Raxworthy , CJ, Forstner MRJ, Nussbaum RA. 2002. Chamaleon radiaton by oceanic disp ersal. Nature 415: 784-787. Roelants K, Gower DJ, Wilkinson M , Loader SP, Biju SD, Guillaume K, M oriau L, Bossuy t F. 2007. Global p atterns of diversification in the history of modern amp hibians. Proceed ings of the National Academy o f Science (USA) 104: 887892. Ronquist FL, Huelsenbeck P. 2003. M RBAYES 3.12: B ay esian p hy logenetic inferen ce under mixed models. Bioinformatics 19: 1572-1574. Savage JM . 1987. Systematics and distribution of the M exican and Central American rainfro gs of the Eleuth erodactylus gollmeri group (Amp hibia: Lep todacty lidae). Fieldiana: Zoology 33: 1–57. Savage JM . 2002. The Amp hibians and Reptiles of Costa Rica: A Herp etofauna between Two Continents, between Two Seas. University of Chicago Press, Chicago, IL. Shimod aira H, Hasegawa M.1999. M ultiple comparisons of log-likelihoods with app lications to p hy logenetic inference. Molecular Biology and Evolution 16: 11141116. Simpson GG. 1940. M ammals and land brid ges. Journal of th e Washington Acad emy of Sciences 30: 137-163. Stamatakis A, Hoover P, Rougemont J. 2008. A Rap id Bootstrap Algorithm for the RAxML Web-Servers Systematic Biolog y 75: 758-771. Swofford DL. 2002. PAUP* Phy logenetic Analysis Using Parsimony (*and Other M ethods), Version 4. Sinauer Associates, Sunderland, M A. Vanzolini PE, Hey er WR. 1985. The American herp etofauna and the interchan ge. In: Stehli FG, Webb SD (Eds.). The Great American Biotic Interch ange. Plenu m Press, New York, NY, pp . 475-487. Vences M , Kosuch J, Rodel M -O, Lotters S, Channin g A, Glaw F, Bohme W. 2004. Phylogeography of Ptychadena mascareniensis suggests transoceanic disp ersal in -21-.

(22) a widesp read African-M alagasy frog lineage. Journal o f Biog eogrphy 31; 593-601. Wang IJ, Crawford AJ, Bermin gham E. 2008. Phy logeo grap hy of the Py gmy Rain Frog (Pristimantis ridens) across the lowland wet forest of isthmian Central America. Molecular Phylogenetic and Evolution 47 : 992-1004. Webb SD. 1978. A history of savanna vertebrates in the new world. Part II: South America and the great interchan ge. Annual Review of Ecology and S ystematics 9: 393-426. Webb SD, Ran cy A. 1996. Late Cenozoic evolution of the Neotrop ical mammal fauna. In: Jackson JBC, Budd AF, Coates AG (eds.) Evolution and Environment in Tropical America, pp . 335-358. University of Chicago Press, Chicago, Illinois, USA. Weigt LA, Crawford AJ, Rand AS, Ry an M J. 2005. Biogeo graphy of the túngara fro g. Physalaemus pustulosus: a molecular p erspective. Molecular Ecolog y 14: 38573876. Whitmore Jr, Stewart RH. 1965. Miocene mammals and Central American seaway s. Science 148: 180-185. Wiens JJ. 1998. Combining data sets with different p hy logenetic histories. Systematic Biology 47 : 568-581. Zamudio KR, Greene HW. 1997. Phy logeo grap hy of the bushmaster (Lachesis muta: Vip eridae): imp lications for Neotrop ical bio geo grap hy , systematics, and conservation. Biological Journal of th e Linnean Society 62: 421-442. Zeh DA, Zeh JA, Bonilla MM . 2003. Phylogeo grap hy of the giant harlequin b eetle (Acrocinus longimanus). Journal of Biogeography 30 : 747-753.. -22-.

(23) TAB LES Table 1. Genes and p rimers employ ed in this study . Primer. Primer sequence (5’----3’). Source. Mitochondrial COI dgLCO-1490. GGT CAACAAAT CAT AAAGAYAT YGG. dgHCO-2198. T AAACTTCAGGGTGACCAAARAAYCA. LCO-1490. GGT CAACAAAT CAT AAAGAT ATTGG. Folmer et al. (1994). HCO-2198. T AAACTTCAGGGTGACCAAAAAAT CA. Folmer et al. (1994). 16Sar-L. CGCCT GTTT AT CAAAAACAT. Palumbi et al. (1991). 16Sbr-H. CCGGT CT GAACT CAGATCACGT. Palumbi et al. (1991). 12H10. CACYTT CCRGT RCRYTT ACCRT GTT ACGACTT. Heinicke et al. (2007). 12.1L4E. T ACACAT GCAAGTYT CCGC. Heinicke et al. (2007). R182. GCCAT AACT GCT GGAGCAT YAT. Heinicke et al. (2007). R270. AGYAGATGT T GCCT GGGTCTT C. Heinicke et al. (2007). Tyr1C. GGCAGAGGAWCRT GCCAAGAT GT. Bossuyt & Milinkovitch (2000). Tyr1G. T GCT GGGCRT CT CTCCARTCCCA. Bossuyt & Milinkovitch (2000). Mitochondrial 16S. Mitochondrial 12S. Nuclear RAG1. Nuclear Tyr.

(24) Table 2. Estimated parameters for Bayesian analyses. Parameters were calculated using M r. M odelTest 3.7 (Posada & Crandall, 1998). AIC= Akaike information criterion; I=Proportion of invariable sites; Gamma= Gamma distributed rate variation among sites.. Gen. Best-fit. AIC. Model. score. -ln likelihood. I. Gamma. Rate Matrix. Base frecuency. AC. AG. AT. CG. CT. GT. A. C. G. T. COI. GTR+I+G. 27593.7. 13786.9. 0.4311. 0.5459. 0.5680. 11.2552. 0.4570. 0.4277. 6.3348. 1.0000. 0.3069. 0.3028. 0.1010. 0.2893. 12S. GTR+I+G. 63217.2. 31598.6. 0.2627. 0.7028. 2.6346. 9.1316. 2.6776. 0.4414. 20.9307. 1.0000. 0.3888. 0.2278. 0.1621. 0.2213. 16S. GTR+I+G. 84298.7. 42139.3. 0.2706. 0.6188. 3.3087. 8.6510. 3.3805. 0.7856. 23.7068. 1.0000. 0.4110. 0.2126. 0.1459. 0.2305. Rag_1. GTR+I+G. 8824.5. 4402.3. 0.3280. 1.6718. 1.2761. 4.1305. 0.6188. 1.4669. 5.6222. 1.0000. 0.3329. 0.2123. 0.1756. 0.2793. Tyr. HKY+I+G. 8914.6. 4451.3. 0.3356. 1.1107. 0.2560. 0.2399. 0.2111. 0.2931. Ti/tv ratio 2.5277.

(25) Table 3. Proportion of invariable, variable un-informative and parsimony informative (PI) characters.. Gen. Alignment No. of. Proportion of. No. of variable. Proportion of. No. of. Proportion. positions. invariable sites. sites are un-PI. variable sites are. PI. of PI. invariable sites. un-PI. COI. 612. 286. 0.47. 19. 0.03. 307. 0.50. 12S. 960. 287. 0.30. 105. 0.11. 568. 0.59. 16S. 1543. 496. 0.32. 142. 0.09. 905. 0.59. Rag_1. 633. 299. 0.47. 79. 0.13. 255. 0.40. Tyr. 531. 253. 0.48. 67. 0.12. 211. 0.40.

(26) APPENDIC ES Appendix 1. For each specimen, extraction number or tissue collection number, museum voucher, source, locality and GenBank accession number are reported. Acronyms for museums are: CH = Circulo Herpetologico, Panama; M BH= M useum Bolivia Herpetology, Bolivia; MHUA= M useo de Herpetología de la Universidad de Antioquia, Colombia, QCAZ= M useo de Zoología de la Pontificia Universidad Católica del Ecuador, Ecuador; UIS-H= Colección herpetológica, Universidad Industrial de Santander, Colombia. The abbreviations for the individuals field series are as follows: AJC=Andrew Jackson Crawford; CJD= Claudia Juliana Dulcey; DL= David Laurencio; EMM = Eliana M aria M uñoz; ENS= Eric N. Smith; KRL= Karen R. Lips; NRPS= Nelsy Rocio Pinto Sanchez; RC= Rances Caicedo; SM G= Sandra M . Gallo.. Species. Extraction number. AJC 1144. Craugastor bufoniformis. Craugastor cf. longirostris Craugastor cf. longirostris Diasporus diastema. Diasporus gularis. Museum voucher. E-76 E-78. E-77. AJC 1336 AJC 1193 AJC 0540. AJC 1187. Origin. This study. This study This study This study. This study. Country. P anamá. Colombia Colombia Costa Rica. Colombia. Department/Pr ovince. P anamá. Antioquia Chocó P untarenas. Chocó. Municipality. Mitochondrial genes. Nuclear genes. COI (614 bp). 16S (621 bp). 12S (806 bp). Rag1 (620 bp). Tyr (500 bp). X. X. X. 0. 0. Maceo Nuqui Finca Sergio Jimenez, 6.5 km por air SSE de Aguitas, Drake, Osa. X X. X X. X X. 0 0. 0 0. X. X. 0. 0. X. Nuqui. X. X. 0. 0. X. Altos del María, ~7.5 km NE de El Valle de Anton, corregimiento de Chamé.

(27) AJC 0468. Diasporus hylaeformis. Diasporus hylaeformis Diasporus vocator Diasporus vocator Pristimantis achatinus Pristimantis affinis. E-50. Pristimantis altae. Pristimantis bogotensis Pristimantis caryophyllaceus Pristimantis caryophyllaceus. Pristimantis caryophyllaceus Pristimantis cerasinus Pristimantis cerasinus. Pristimantis cerasinus. E-51. This study. Costa Rica. Alajuela. Estación Biológica Alberto Ml. Brenes, Reserva Biológica San Ramón. 0. X. X. 0. 0. X X X. 0 X X. X X. 0 X X. 0 X X. AJC 0474 AJC 0127 CH 4784 AJC 0573. This study This study This study This study. Costa Rica Costa Rica. Cartago P untarenas. Tapantí, Cantón P araíso Las Cruces. P anamá. Darién. Cana main camp, Sendero Boca de Cupe. X. X. X. X. X. NRP S 0031. This study. Colombia. Cundinamarca. P arque Nacional Natural Chingaza. X. X. X. X. 0. AJC 0398. This study. Costa Rica. Alajuela. Monumento Natural Histórico La P az (MINAE), ~16km por rd. NW de San Ramón, Canton La P az. X. X. X. X. 0. X. X. X. X. X. NRP S 0033. This study. Colombia. Cundinamarca. P arque Nacional Natural Chingaza. AJC 0187 AJC 0486. This study This study. P anamá Costa Rica. Chiriquí San José. Fortuna Rio Gacho, Los Juncos, Cascajal, Cantón Vázquez de Coronado. X. X. X. X. X. X. X. X. X. 0. Cana, Laguna La Selva "Vuelta de Queque" Rio Siquirres trail, Guayacan, Siquirres. X X. X X. X X. X X. X X. X. X. X. X. 0. 0. X. X. X. 0. CH 6367 AJC 0071 AJC 0527. AJC 1132. This study This study This study. This study. P anamá Costa Rica Costa Rica. P anamá. App. p. -2-. Darién Heredia Limón. P anamá. Altos del María, ~7.5 km NE de El Valle de Anton, corregimiento de Chamé.

(28) Pristimantis cerasinus ( white on thighs). AJC 1142. Pristimantis cruentus Pristimantis cruentus. AJC 0234 AJC 0394. Pristimantis cruentus. Pristimantis cruentus Pristimantis cruentus Pristimantis cruentus. AJC 0460. AJC 0475 AJC 0480 AJC 0524. This study. This study This study. This study. This study This study This study. P anamá. P anamá Costa Rica. Costa Rica. Costa Rica Costa Rica Costa Rica. P anamá. Chiriquí Alajuela. Alajuela. Cartago Heredia Limón. Altos del María, ~7.5 km NE de El Valle de Anton, corregimiento de Chamé Fortuna Monumento Natural Histórico La P az (MINAE), ~16km por rd. NW de San Ramón, Canton La P az Estación Biológica Alberto Ml. Brenes, Reserva Biológica San Ramón Tapantí, Cantón P araíso La P az Waterfall Gardens Base de Volcan Turrialba, along rd. Guácimo, Canton Guácimo. Pristimantis cruentus. AJC 1204. This study. P anamá. P anamá. Altos del María, Río María, Distrito de Chamé. Pristimantis cruentus. KRL 0685. This study. P anamá. Coclé. P arque Nacional Omar Torrijos H., El Copé. PristimantIs cruentus (big & plain). AJC 0603. This study. P anamá. Darién. Cana, Pirre high camp. Pristimantis cruentus ( cf. rojo tomate). CH 6721. This study. P anamá. P anamá. Pristimantis cruentus ( golden venter). AJC 0581. This study. P anamá. App. p. -3-. Darién. 0. X. X. 0. X. X. X. X. X. X. 0. 0. 0. 0. 0. X. X. X. X. 0. X X. X X. X X. X X. X 0. X. X. X. X. 0. 0. X. X. 0. 0. X. X. 0. X. X. 0. 0. Refugio ANAM, Cerro Brewster "hacia Cerro Guajaral". Límite P .N. Chagres,. X. X. X. X. X. Cana, Pirre high camp, kitchen.. 0. X. 0. X. X.

(29) Pristimantis cruentus (museosus? ). AJC 1128. Pristimantis cruentus ( pop-eyed). AJC 0985. AJC 1133. Pristimantis cruentus ( pop-eyed). Pristimantis cruralis Pristimantis elegans Pristimantis fenestratus Pristimantis gaigeae Pristimantis gaigeae Pristimantis gaigeae Pristimantis gaigeae. E-53. E-32 E-79. Pristimantis grupo diastema Pristimantis latidiscus ( morfo1) Pristimantis latidiscus ( morfo1) Pristimantis librarius. E-75 E-54 E-56 E-6. Pristimantis cruentus Pristimantis martiae. E-80 E-5. Pristimantis martiae. E-9. Pristimantis medemi Pristimantis mercedesae. E-44. Pristimantis miyatai. E-11. This study. This study. This study. P anamá. P anamá. P anamá. P anamá. P anamá. P anamá. Altos del María, ~7.5 km NE de El Valle de Anton, corregimiento de Chamé. X. X. X. 0. X. Burbayar Lodge, Km 15 on El Llano-Cartí Road, Distrito de Chepo, Corregimiento El Llano. 0. 0. 0. 0. X. Altos del María, ~7.5 km NE de El Valle de Anton, corregimiento de Chamé. 0. X. 0. 0. X. MBH 5699 NRP S 0052. This study This study. Bolivia Colombia. 0. 0. 0. 0. X. Cundinamarca. P arque Nacional Natural Chingaza. 0. 0. 0. 0. X. MBH 5712 AJC 1360 AJC 1339 CH 6471 KRL 8880. This study This study This study This study This study. Bolivia Colombia Colombia. Tolima Antioquia. Ruinas Falan Maceo. 0 X X X. 0 0 X X. 0 0 0 X. 0 0 0 0. X X X X. P anamá. Coclé. P arque Nacional Omar Torrijos H., El Copé. 0. 0. X. 0. X. AJC 1335 NRP S 0054 NRP S 0056 QCAZ 25852 AJC 1344 QCAZ 17998 QCAZ 18018 NRP S 0087 MBH 4695. This study This study This study This study. Colombia Colombia Colombia Ecuador. Antioquia Valle del Cauca Valle del Cauca Napo. Maceo El Cairo El Cairo. 0 X X. X X X. X X X. X X X. X X X. X. X. X. 0. 0. This study This study. Colombia Ecuador. Antioquia Napo. Maceo. X. X. X. 0. 0. X. X. X. X. X. This study. Ecuador. Napo. X. X. 0. X. X. This study This study. Colombia Bolivia. Villavicencio Chuquisaca. Restrepo Vecindad deEl P almar. X. X. 0. X. X. 0. 0. 0. X. X. RC 610. This study. Colombia. Santander. Floridablanca. X. X. X. X. X. App. p. -4-.

(30) Pristimantis miyatai Pristimantis sp. (morfo1) Pristimantis sp. ( morfo2) Pristimantis sp. ( morfo3) Pristimantis moro. E-12 E-42 E-43 E-45. RC 613 NRP S 0083 NRP S 0085 NRP S 0090 AJC 1753. AJC 1860 AJC 1143. Pristimantis moro Pristimantis museosus. Pristimantis museosus. This study This study This study This study This study. This study This study. Colombia Colombia Colombia Colombia P anamá. P anamá P anamá. Santander Villavicencio Villavicencio Villavicencio P anamá. Darién P anamá. Floridablanca Restrepo Restrepo Urbanizacion de los Altos de Cerro Azul, Distrito de Chilibre Serrania de Pirre Altos del María, ~7.5 km NE de El Valle de Anton, corregimiento de Chamé. X X X X. X X X X. X X X X. X X X X. X X X X. X. X. X. 0. 0. X. X. X. 0. X. 0. 0. 0. X. X. AJC 1210. This study. P anamá. P anamá. Altos del María, Río María, Distrito de Chamé. X. X. 0. 0. X. P arque Nacional Natural Chingaza. X. X. 0. 0. X. X. X. 0. X. X. X. X. 0. 0. X. X 0 X. X 0 X. 0 0 0. 0 0 X. X 0 X. X. X. 0. X. X. Pristimantis nervicus. E-52. NRP S 0048. This study. Colombia. Cundinamarca. Pristimantis ockendeni. E-4. This study. Ecuador. Napo. Pristimantis ockendeni. E-10. This study. Ecuador. Orellana. Pristimantis paisa Pristimantis paisa Pristimantis pardalis Pristimantis pardalis. E-60 E-72. QCAZ 25766 QCAZ 25428 NRP S 0060 NRP S 0062 AJC 0188 AJC 1208. This study This study This study This study. Colombia Colombia P anamá P anamá. Antioquia Antioquia Chiriquí P anamá. Caldas Caldas Fortuna Altos del María, Río María, Distrito de Chamé. CH 6284. This study. P anamá. Darién. Tent camp, Reserva Natural P rivada Chucanti, Corregimiento Rio Congo Arriba, Distrito de Chepigana. X. X. 0. X. X. X. X. 0. X. X. X. X. X. X. X. Pristimantis pardalis. Pristimantis pardalis. KRL 0690. This study. P anamá. Coclé. P arque Nacional Omar Torrijos H., El Copé. Pristimantis pirrensis. AJC 0594. This study. P anamá. Darién. Cana, Pirre high camp. App. p. -5-.

(31) Pristimantis pirrensis Pristimantis platydactylus Pristimantis ptochus Pristimantis quaquaversus. E-58 E-7. Pristimantis quaquaversus. E-8. Pristimantis rhabdolaemus Pristimantis ridens Pristimantis ridens Pristimantis ridens. E-31 E-71. Pristimantis ridens Pristimantis ridens. AJC 1863 MBH 5746 NRP S 0058 QCAZ 16150 QCAZ 25676 MBH 5589 AJC 1359 AJC 1373 AJC 0126. This study This study This study This study. P anamá Bolivia Colombia Ecuador. Darién. Serrania de Pirre. Valle del Cauca Sucumbíos. El Cairo. This study. Ecuador. P astaza. This study This study This study This study. Bolivia Colombia Colombia Costa Rica. Tolima Tolima P untarenas. AJC 0216 AJC 0336. This study This study. P anamá P anamá. P anamá P anamá. AJC 0356. Pristimantis ridens. AJC 0522. Pristimantis ridens. This study. This study. Costa Rica. Costa Rica. Limón. Heredia. Pristimantis ridens. DL 401. This study. Costa Rica. San José. Pristimantis ridens Pristimantis ridens Pristimantis ridens ( cf. molinoi) Pristimantis signifer Pristimantis sp. E-55 E-18. ENS 10647 ENS 10722 AJC 0211 NRP S 0055 EMM-232. This study This study This study This study This study. Honduras Honduras P anamá Colombia Antioquia. Olancho Olancho Kuna Yala Valle del Cauca San Rafael. Pristimantis sp. E-21. EMM-233. This study. Colombia. Antioquia. App. p. -6-. X X X. X X X. X X X. X X 0. X X X. X. X. X. X. X. X. X. X. X. X. 0 0 0. 0 0 0. X X X. 0 0 0. 0 0 0. X. X. X. X. X. X. X. X. X. X. X. X. 0. X. X. "Utopia" En el borde Occidental del Rio Blanco, 3.2 km (~ 6 km W de Guápiles). X. X. X. X. X. S. Holdridge, EB La Selva, Puerto Viejo, Sarapiquí. X. X. 0. X. X. X. X. X. X. X. 0 X X X. 0 X X X. X 0 X 0. 0 X X 0. 0 X X X. X. X. X. X. X. X. X. X. X. X. llanito, cerca a Falan Rio Claro, lado P acifico Altos de Campana Altos de Campana National P ark (Sendero de Interpretación). P arque Nacional Carara, Bajo Carara. Sierra de Bataderos Sierra de Agalta Nusagandi El Cairo Sector P apayos, Central Hidroeléctrica Jaguas San Rafael.

(32) Pristimantis sp Pristimantis sp Pristimantis sp Pristimantis sp Pristimantis sp Pristimantis sp Pristimantis sp Pristimantis sp Pristimantis sp Pristimantis sp Pristimantis sp Pristimantis sp Pristimantis sp Pristimantis sp Pristimantis sp Pristimantis sp Pristimantis sp Pristimantis sp Pristimantis sp Pristimantis sp.. E-22 E-26 E-46 E-47 E-48 E-49 E-57 E-59 E-61 E-62 E-63 E-64 E-65 E-66 E-67 E-68 E-69 E-70 E-73. Pristimantis sp. ( cf. cruentus) Pristimantis sp. ( cf. ridens) Pristimantis suetus. E-74 E-3. Pristimantis taeniatus. E-1. Pristimantis taeniatus. E-2. EMM-247 EMM/ NRP S 0016 NRP S 0017 NRP S 0019 NRP S 0022 NRP S 0057 NRP S 0059 NRP S 0067 NRP S 0001 NRP S 0002 NRP S 0007 NRP S 0010 NRP S 0011 NRP S 0013 NRP S 0016 NRP S 0017 NRP S 0019 NRP S 0072 AJC 1670. AJC 0217 AJC 1191 MHUA 0440 MHUA 0426 MHUA 0455. This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study. Colombia Colombia Colombia Colombia Colombia Colombia Colombia Colombia Colombia Colombia Colombia Colombia Colombia Colombia Colombia Colombia Colombia Colombia Colombia P anamá. Antioquia Antioquia Cundinamarca Cundinamarca Cundinamarca Cundinamarca Valle del Cauca Valle del Cauca Antioquia Antioquia Antioquia Antioquia Antioquia Antioquia Antioquia Antioquia Antioquia Antioquia Antioquia Darién. San Rafael San Rafael Yacopí Yacopí Yacopí Yacopí El Cairo El Cairo Caldas Anori Anori Anori Amalfi Amalfi Amalfi Amalfi Amalfi Amalfi Urrao Tent camp, Reserva Natural P rivada Chucanti, Corregimiento Rio Congo Arriba, Distrito de Chepigana. This study This study This study. P anamá Colombia Colombia. Chiriquí Chocó Antioquia. Nuqui Guatapé. This study. Colombia. Antioquia. Maceo. This study. Colombia. Antioquia. Amalfi. App. p. -7-. X 0 X X X X X X X X X X X X 0 X 0 0 X. X X X X X 0 X X X 0 X X X X X 0 X X X. X X X X X X X X 0 X X X 0 X X X X X X. X X X X 0 X X X X X X X X 0 0 0 X 0 0. X X X X X X X X X X X X X 0 0 0 X X X. 0. 0. X. X. X. X X. X X. 0 X. X X. X X. X. X. X. 0. 0. 0. X. X. X. 0. X. X. X. 0. 0.

(33) Pristimantis taeniatus Pristimantis taeniatus Pristimantis taeniatus Pristimantis taeniatus Pristimantis taeniatus Pristimantis taeniatus Pristimantis taeniatus Pristimantis taeniatus Pristimantis taeniatus Pristimantis taeniatus Pristimantis taeniatus Pristimantis taeniatus Pristimantis taeniatus. Pristimantis taeniatus Pristimantis taeniatus. Pristimantis taeniatus Pristimantis taeniatus. Pristimantis taeniatus. E-13 E-14 E-16 E-19 E-23 E-24 E-29 E-33 E-34 E-35 E-36 E-37. CJD 069 SMG 325 CJD-070 CJD-068 CJD-067 CJD-071 AJC 1353 AJC 1363 AJC 1368 AJC 1372 RC 611 RC 612 AJC 1126. AJC 1683 AJC 1782. AJC 1839 AJC 1961. AJC 1977. This study This study This study This study This study This study This study This study This study This study This study This study This study. This study This study. This study This study. This study. Colombia Colombia Colombia Colombia Colombia Colombia Colombia Colombia Colombia Colombia Colombia Colombia P anamá. P anamá P anamá. P anamá P anamá. P anamá. App. p. -8-. Santander Antioquia Santander Santander Santander Santander Tolima Tolima Tolima Tolima Santander Santander Colón. Darién P anamá. Darién P anamá. P anamá. X X X X X X X X X X X X. X X X X X X 0 X X X 0 0. X 0 X X 0 X X X X X X X. 0 X X X X 0 X 0 X X X X. X 0 X X X X 0 X X X 0 X. X. X. X. X. X. Cana, Campo P rincipal Urbanizacion de los Altos de Cerro Azul, Distrito de Chilibre. X. X. X. X. X. X. X. 0. X. X. Cana, Sendero Mina Refugio ANAM, Cerro Brewster "hacia Cerro Guajaral". Límite P .N. Chagres,. X. X. X. X. X. X. X. X. 0. 0. X. X. 0. 0. 0. San Rafael Floridablanca. Falan, no ruins Falan, no ruins Falan, no ruins Ruinas Falan Floridablanca Floridablanca Occidente de Gatun. Estación Río Chico de la ACP , Río Chagres norte, arriba del lago Alajuela. Corregimiento de Chilibre, Distrito de Panamá..

(34) AJC 1993. Pristimantis taeniatus. AJC 1994. Pristimantis taeniatus. AJC 1995. Pristimantis taeniatus. CH 4945 CH 4999 CH 5067 CH 5585 CH 6796. Pristimantis taeniatus Pristimantis taeniatus Pristimantis taeniatus Pristimantis taeniatus Pristimantis taeniatus. Pristimantis taeniatus (cf. P. quidditus) Pristimantis taeniatus (cf. P. diastema) Pristimantis viejas Pristimantis viejas Pristimantis viejas Pristimantis viejas. E-15 E-17 E-20 E-25. This study. This study. This study. This study This study This study This study This study. P anamá. P anamá. P anamá. P anamá P anamá P anamá P anamá P anamá. P anamá. P anamá. P anamá. P anamá P anamá P anamá P anamá P anamá. Estación Río Chico de la ACP , Río Chagres sur, arriba del lago Alajuela. Corregimiento de Chilibre, Distrito de Panamá. Estación Río Chico de la ACP , Río Chagres sur, arriba del lago Alajuela. Corregimiento de Chilibre, Distrito de Panamá. Estación Río Chico de la ACP , Río Chagres sur, arriba del lago Alajuela. Corregimiento de Chilibre, Distrito de Panamá.. Urbanizacion de los Altos de Cerro Azul, Distrito de Chilibre. AJC 1835. This study. P anamá. Darién. Cana, Sendero Mina. CH 6393. This study. P anamá. Darién. Serrania de Pirre. EMM-250 EMM-248 EMM-249 SMG 326. This study This study This study This study. Colombia Colombia Colombia Colombia. Antioquia Antioquia Antioquia Antioquia. San Rafael San Rafael San Rafael San Rafael. App. p. -9-. X. X. X. X. X. X. X. 0. 0. 0. X. X. X. X. X. X X X X. X X X X. X X X X. X X X X. X X X X. X. X. X. X. X. X. X. X. X. X. 0. X. X. X. X. X X X X. X 0 0 0. X X X X. X 0 0 0. X 0 0 0.

(35) Pristimantis viejas Pristimantis viejas Pristimantis zophus Pristimantis zophus Pristimantis zophus Pristimantis zophus. E-28 E-30 E-39 E-38 E-40 E-41. AJC 1352 AJC 1355 NRP S 0071 NRP S 0070 NRP S 0074 NRP S 0076. This study This study This study This study This study This study. Colombia Colombia Colombia Colombia Colombia Colombia. App. p. -10-. Tolima Tolima Antioquia Antioquia Antioquia Antioquia. Falan, no ruins Falan, no ruins Urrao Urrao Urrao Urrao. X X X X X X. 0 0 X X X X. X X X X 0 0. 0 0 X X 0 0. 0 0 X X 0 0.

(36) Appendix 2. GenBank accession numbers for downloaded sequences. All sequences were obtained from GenBank.. Nuclear genes. Mitochondrial genes Species. Extraction voucher. Pristimantis pluvicanorus. Museum vocher. COIbp. 12S. bp16S. Rag_1. Tyr. Origin. AMNH-A 165195. n/a. AY843586. n/a. AY844035. Faivovich et al., 2005. Pristimantis pluvicanorus. n/a. n/a. n/a. AY843586. n/a. n/a. Faivovich et al., 2005. Pristimantis malkini. 267642. QCAZ28296. n/a. EU186663. n/a. n/a. Hedges et al., 2008. Pristimantis terraebolivaris. 102301. n/a. n/a. EU186650. n/a. n/a. Hedges et al., 2008. Pristimantis zeuctotylus. 268013. ROM43978. n/a. EU186678. n/a. n/a. Hedges et al., 2008. Pristimantis galdi. 267975. QCAZ32368. n/a. EU186670. EU186746. EU186767. Hedges et al., 2008. Pristimantis cf_mendax. 267140. MTD45080. n/a. EU186659. n/a. n/a. Hedges et al., 2008. Pristimantis simonsii. 267961. KU212350. n/a. EU186665. n/a. n/a. Hedges et al., 2008. Pristimantis albertus. 171100. KU291675. n/a. EU186695. n/a. n/a. Hedges et al., 2008. Pristimantis cf_rhabdolaemus. 267143. MTD45073. n/a. EU186660. n/a. n/a. Hedges et al., 2008. Pristimantis altamazonicus. 267204. KU215460. n/a. EF493670. EF493441. EU186778. Hedges et al., 2008. Pristimantis ardalonychus. 267959. KU212301. n/a. EU186664. n/a. n/a. Hedges et al., 2008. Pristimantis caryophyllaceus. 268029. MVZ203810. n/a. EU186686. n/a. n/a. Hedges et al., 2008. App. p. -11-.

(37) Pristimantis crucifer. 268105. KU177733. n/a. Pristimantis cruciocularis. 171097. KU291673. n/a. Pristimantis diadematus. 267967. KU221999. Pristimantis eriphus. 267976. Pristimantis inguinalis. EU186736. n/a. n/a. Hedges et al., 2008. EU186656. n/a. n/a. Hedges et al., 2008. n/a. EU186668. n/a. n/a. Hedges et al., 2008. QCAZ32705. n/a. EU186671. n/a. n/a. Hedges et al., 2008. 268010. ROM40164. n/a. EU186676. n/a. n/a. Hedges et al., 2008. Pristimantis jester. 268091. ROM43302. n/a. n/a. n/a. Hedges et al., 2008. Pristimantis marmoratus. 268090. ROM43913. n/a. EU186692. n/a. n/a. Hedges et al., 2008. Pristimantis minutulus. 171117. KU291677. n/a. EU186657. n/a. n/a. Hedges et al., 2008. Pristimantis prolatus. 268107. KU177433. n/a. EU186701. n/a. n/a. Hedges et al., 2008. Pristimantis rhabdocnemus. 171063. KU291651. n/a. n/a. n/a. Hedges et al., 2008. Pristimantis saltissimus. 268092. ROM43310. n/a. n/a. n/a. Hedges et al., 2008. Pristimantis dendrobatoides. 268093. ROM43318. n/a. EU186735. EU186717. n/a. n/a. Hedges et al., 2008. Pristimantis pulvinatus. 268114. KU181015. n/a. EU186741. EU186723. n/a. n/a. Hedges et al., 2008. Pristimantis chalceus. 267865. KU177638. n/a. EF493675. n/a. n/a. Heinicke et al., 2007. Pristimantis bipunctatus. 171021. KU291638. n/a. EF493702. EF493492. Heinicke et al., 2007. Pristimantis caprifer. 267880. KU177680. n/a. EF493391. n/a. n/a. Heinicke et al., 2007. Pristimantis citriogaster. 267201. KU212278. n/a. EF493700. n/a. n/a. Heinicke et al., 2007. Pristimantis condor. 267212. KU217857. n/a. EF493701. EF493443. EF493504. Heinicke et al., 2007. Pristimantis conspicillatus. 267636. QCAZ28448. n/a. EF493529. EF493437. EF493499. Heinicke et al., 2007. EU186734. EU186724. EU186718. EU186716. EU186706. EU186693. App. p. -12-.

(38) Pristimantis fenestratus. 266046. MHNSM9298. n/a. EF493703. n/a. n/a. Heinicke et al., 2007. Pristimantis lymani. 267220. KU218019. n/a. EF493392. n/a. n/a. Heinicke et al., 2007. Pristimantis skydmainos. 266052. MHNSM10071. n/a. EF493393. n/a. n/a. Heinicke et al., 2007. Pristimantis buckleyi. 267210. KU217836. n/a. EF493350. n/a. n/a. Heinicke et al., 2007. Pristimantis cryophilius. 267214. KU217863. n/a. EF493672. n/a. n/a. Heinicke et al., 2007. Pristimantis curtipes. 267215. KU217871. n/a. EF493513. EF493435. EF493497. Heinicke et al., 2007. Pristimantis gentryi. 267230. KU218109. n/a. EF493511. n/a. n/a. Heinicke et al., 2007. Pristimantis appendiculatus. 267866. KU177637. n/a. EF493524. n/a. n/a. Heinicke et al., 2007. Pristimantis devillei. 267216. KU217991. n/a. EF493688. n/a. n/a. Heinicke et al., 2007. Pristimantis quinquagesimus. 267872. KU179374. n/a. EF493690. n/a. n/a. Heinicke et al., 2007. Pristimantis truebae. 267229. KU218013. n/a. EF493512. n/a. n/a. Heinicke et al., 2007. Pristimantis vertebralis. 267870. KU177972. n/a. EF493689. n/a. n/a. Heinicke et al., 2007. Pristimantis ockendeni. 267253. KU222023. n/a. EF493496. 267254. Heinicke et al., 2007. Pristimantis bromeliaceus. 171051. KU291702. n/a. EF493351. n/a. n/a. Heinicke et al., 2007. Pristimantis schultei. 267199. KU212220. n/a. EF493681. n/a. n/a. Heinicke et al., 2007. Pristimantis festae. 267247. KU218234. n/a. EF493515. n/a. n/a. Heinicke et al., 2007. Pristimantis leoni. 267437. KU218227. n/a. EF493684. EF493433. EF493495. Heinicke et al., 2007. Pristimantis ocreatus. 267439. KU208508. n/a. EF493682. n/a. n/a. Heinicke et al., 2007. Pristimantis pyrrhomerus. 267441. KU218030. n/a. EF493683. n/a. n/a. Heinicke et al., 2007. EF493519. App. p. -13-. EF493434.

(39) Pristimantis orcesi. 267221. KU218021. n/a. EF493679. n/a. n/a. Heinicke et al., 2007. Pristimantis thymelensis. 267644. QCAZ16428. n/a. EF493516. EF493442. EF493503. Heinicke et al., 2007. Pristimantis melanogaster. 267438. MHNSM-WED56846. n/a. n/a. n/a. Heinicke et al., 2007. Pristimantis orestes. 267249. KU218257. n/a. EF493388. n/a. n/a. Heinicke et al., 2007. Pristimantis simonbolivari. 267248. KU218254. n/a. EF493671. n/a. n/a. Heinicke et al., 2007. Pristimantis aniptopalmatus. 171070. KU291627. n/a. EF493390. n/a. n/a. Heinicke et al., 2007. Pristimantis peruvianus. 266050. MHNSM9267. n/a. EF493707. EF493436. EF493498. Heinicke et al., 2007. Pristimantis rhabdolaemus. 267875. KU173492. n/a. EF493706. n/a. n/a. Heinicke et al., 2007. Pristimantis sagittulus. 171098. KU291635. n/a. EF493705. EF493439. EF493501. Heinicke et al., 2007. Pristimantis stictogaster. 171080. KU291659. n/a. EF493704. EF493445. EF493506. Heinicke et al., 2007. Pristimantis toftae. 267206. KU215493. n/a. EF493353. n/a. n/a. Heinicke et al., 2007. Pristimantis colomai. 267635. QCAZ17101. n/a. EF493354. EF493440. EF493502. Heinicke et al., 2007. Pristimantis cremnobates. 267878. KU177252. n/a. EF493528. EF493424. EF493486. Heinicke et al., 2007. Pristimantis cruentus. 267876. AMNH12444-448. n/a. EF493697. n/a. n/a. Heinicke et al., 2007. Pristimantis latidiscus. 267219. KU218016. n/a. EF493698. n/a. n/a. Heinicke et al., 2007. Pristimantis ridens. 267877. AMNH-A124551. n/a. EF493355. n/a. n/a. Heinicke et al., 2007. Pristimantis achatinus. 267208. KU217809. n/a. n/a. n/a. Heinicke et al., 2007. Pristimantis actites. 267209. KU217830. n/a. EF493432. EF493494. Heinicke et al., 2007. Pristimantis crenunguis. 267879. KU177730. n/a. n/a. n/a. Heinicke et al., 2007. EF493826. EF493827. EF493664. EF493660. EF493696 EF493693. App. p. -14-. EF493666.

(40) Pristimantis labiosus. 267640. QCAZ19771. n/a. EF493694. n/a. n/a. Heinicke et al., 2007. Pristimantis lanthanites. 267252. KU222001. n/a. EF493695. n/a. n/a. Heinicke et al., 2007. Pristimantis w-nigrum. n/a. n/a. n/a. AY326004. n/a. n/a. Heinicke et al., 2007. Pristimantis duellmani. 267444. KU217998. n/a. EF493438. EF493500. Heinicke et al., 2007. Pristimantis duellmani. n/a. n/a. n/a. AY326003. n/a. n/a. Heinicke et al., 2007. Pristimantis surdus. 267871. KU177847. n/a. EF493687. n/a. n/a. Heinicke et al., 2007. Pristimantis acerus. 267207. KU217786. n/a. EF493678. n/a. n/a. Heinicke et al., 2007. Pristimantis cajamarcensis. 267211. KU217845. n/a. n/a. n/a. Heinicke et al., 2007. Pristimantis calcarulatus. 267868. KU177658. n/a. EF493523. n/a. n/a. Heinicke et al., 2007. Pristimantis celator. 267874. KU177684. n/a. EF493685. n/a. n/a. Heinicke et al., 2007. Pristimantis ceuthospilus. 267198. KU212216. n/a. EF493520. n/a. n/a. Heinicke et al., 2007. Pristimantis chloronotus. n/a. n/a. n/a. AY326007. n/a. n/a. Heinicke et al., 2007. Pristimantis croceoinguinis. 267213. KU217862. n/a. n/a. n/a. Heinicke et al., 2007. Pristimantis dissimulatus. 267867. KU179090. n/a. EF493522. n/a. n/a. Heinicke et al., 2007. Pristimantis euphronides. 266624. BWMC6918. n/a. EF493527. EF493427. EF493489. Heinicke et al., 2007. Pristimantis glandulosus. 267217. KU218002. n/a. EF493676. n/a. n/a. Heinicke et al., 2007. Pristimantis imitatrix. 267205. KU215476. n/a. n/a. n/a. Heinicke et al., 2007. Pristimantis inusitatus. 267218. KU218015. n/a. EF493677. n/a. n/a. Heinicke et al., 2007. Pristimantis lirellus. 267200. KU212226. n/a. EF493521. n/a. n/a. Heinicke et al., 2007. n/a. n/a. EF493823. EF493669. EF493824. App. p. -15-. EF493663. EF493665. EF493667.

(41) Pristimantis luteolateralis. 267863. KU177807. n/a. EF493517. n/a. n/a. Heinicke et al., 2007. Pristimantis nyctophylax. 267869. KU177812. n/a. EF493526. EF493425. EF493487. Heinicke et al., 2007. Pristimantis parvillus. 267864. KU177821. n/a. EF493351. n/a. n/a. Heinicke et al., 2007. Pristimantis petrobardus. 267202. KU212293. n/a. n/a. n/a. Heinicke et al., 2007. Pristimantis phoxocephalus. 267222. KU218025. n/a. EF493349. n/a. n/a. Heinicke et al., 2007. Pristimantis pycnodermis. 267223. KU218028. n/a. EF493680. n/a. n/a. Heinicke et al., 2007. Pristimantis rhodoplichus. 267250. KU219788. n/a. EF493674. n/a. n/a. Heinicke et al., 2007. Pristimantis riveti. 267224. KU218035. n/a. EF493348. n/a. n/a. Heinicke et al., 2007. Pristimantis rozei. 102308. Novoucher. n/a. EF493691. EF493429. EF493491. Heinicke et al., 2007. Pristimantis shrevei. 266036. Novoucher. n/a. EF493692. n/a. n/a. Heinicke et al., 2007. Pristimantis spinosus. 267225. KU218052. n/a. EF493673. n/a. n/a. Heinicke et al., 2007. Pristimantis subsigillatus. 267246. KU218147. n/a. EF493525. n/a. n/a. Heinicke et al., 2007. Pristimantis supernatis. n/a. n/a. n/a. AY326005. n/a. n/a. Heinicke et al., 2007. Pristimantis thymalopsoides. 267873. KU177861. n/a. EF493514. n/a. n/a. Heinicke et al., 2007. Pristimantis unistrigatus. 267227. KU218057. n/a. EF493387. EF493444. EF493505. Heinicke et al., 2007. Pristimantis urichi. 101646. USNM336098. n/a. EF493699. EF493426. EF493488. Heinicke et al., 2007. Pristimantis verecundus. 267646. QCAZ12410. n/a. EF493686. n/a. n/a. Heinicke et al., 2007. Pristimantis versicolor. 267228. KU218096. n/a. EF493389. EF493431. EF493493. Heinicke et al., 2007. Pristimantis walkeri. 267231. KU218116. n/a. EF493518. EF493428. EF493490. Heinicke et al., 2007. EF493825. App. p. -16-. EF493367.

(42) Pristimantis wiensi. 267251. Pristimantis festae. KU219796. n/a. KU218234. n/a. EF493377. EF493668. n/a. n/a. Heinicke et al., 2007. EF493515. n/a. n/a. Heinicke et al., 2007. DQ283423. n/a. DQ283018. Heinicke et al., 2007. EF493362. n/a. Heinicke et al., 2007. Agalychnis callidryas. n/a. n/a. n/a. Agalychnis callidryas. n/a. n/a. n/a. Craugastor daryi. 267858. UTA57940. n/a. EF493531. EF493452. EF493480. Heinicke et al., 2007. Craugastor longirostris. 267853. KU177803. n/a. EF493395. EF493454. EF493482. Heinicke et al., 2007. Litoria caerulea. n/a. n/a. AY883980. AY843692. n/a. AY844131. Heinicke et al., 2007. Litoria caerulea. 267887. novoucher. n/a. EF493446. n/a. Heinicke et al., 2007. Phrynopus auriculatus. 171082. KU291634. n/a. EF493708. n/a. n/a. Heinicke et al., 2007. Phrynopus bracki. 171045. USNM286919. n/a. EF493709. EF493421. EF493507. Heinicke et al., 2007. Rana catesbeiana. n/a. n/a. n/a. DQ283257. n/a. DQ282959. Heinicke et al., 2007. Rana catesbeiana. 266591. N0_voucher. n/a. EF493448. n/a. Heinicke et al., 2007. Lynchius flavomaculatus. 267966. KU218210. n/a. EU186667. EU186745. EU186766. Hedges et al., 2008. Lynchius nebulanastes. 268115. KU181408. n/a. EU186704. n/a. n/a. Hedges et al., 2008. Oreobates cruralis. 267962. KU215462. n/a. EU186666. EU186743. EU186764. Hedges et al., 2008. Oreobates saxatilis. 267960. KU212327. n/a. EU186742. EU186763. Hedges et al., 2008. n/a. n/a. n/a. n/a. n/a. n/a. EU186726. App. p. -17-. EU186708.

(43) FIGURES Figure 1. Major clades of Pristimantis frogs. M P of 80 individuals of frogs in cludin g eight out-group sp ecies. Bootstrap supp orts are p resented. The group s are named accordin g to Hed ges et al., (2008). Figure 2. A time tree of Pristimantis fro gs. The tree top ology is derived from a B ay esian analysis de 80 taxa. Sup p ort values are indicated at nodes (M L/Bay esian p osterior p robability ). Calibration nodes are indicated by an asterisk. Branches with blue color show the Central American sp ecies. Figure 3. Maximum likelihood p hy logeny of 265 individuals of fro gs is p resented. The data set consists of 4279 base p airs of aligned DNA sequences, in cluding mitochondrial DNA (12S rRNA, 16S rRNA, and COI) and nuclear DNA (Rag-1 and Ty r genes). Posterior p robabilities are shown. First segment (top ) of tree. (B) Second segment of tree. (C) Third segment (bottom) of tree. Figure 4. Maximum likelihood p hy logeny of 265 individuals of fro gs is p resented. The data set consists of 4279 base p airs of aligned DNA sequences, in cluding mitochondrial DNA (12S rRNA, 16S rRNA, and COI) and nuclear DNA (Rag-1 and Ty r genes). Posterior p robabilities are shown. The terminal taxa names are collap sed. First segment (top) of tree. (B) Second segment of tree. (C) Third segment (bottom) of tree..