1
2
El hidrógeno (H2) es en la actualidad una de las fuentes de energías renovables más prometedora. Posee el máximo rendimiento energético por unidad de peso, siendo fácil almacenar y de transportar. Además, el H2 es limpio, produce sólo agua cuando se quema, eliminando los problemas de contaminación atmosférica y efecto invernadero que tienen los combustibles fósiles (Mizuno 2000; Khanal et al, 2004; Liu y Shen, 2004; Thong et al, 2008; Jo et al, 2008; Pan et al, 2008; Wang y Wan, 2008; Oztekin et al, 2008). El H2 se genera en la actualidad mediante diferentes procesos: reformado de gas natural, gasificación de carbón y pirólisis, que utilizan combustibles fósiles no renovables y requieren un aporte de energía, o procesos electroquímicos, que tienen un elevado consumo energético. Su producción biológica soslaya ambos inconvenientes. Existen, en efecto, dos mecanismos posibles para producir "biohidrógeno", a saber la foto reducción y la fermentación oscura o ácida.
La fermentación oscura implica la conversión de substratos orgánicos en distintos metabolitos productos de fermentación, lo que va a acompañado por la liberación de H2. Es llevada a cabo por microorganismos anaerobios estrictos, como Clostridium o Syntrophobacter, o facultativos, como Enterobacter y otras bacterias entéricas. Entre las ventajas más importantes de la producción de H2 por fermentación acida, cuando se compara con otros procesos, se encuentran la sencillez del mismo, tasas de producción elevada, y la posibilidad de utilizar residuos de bajo valor como materia prima. Uno de sus principales problemas es que su producción se inhibe debido a la presión parcial del H2 acumulado. En efecto, si esta presión alcanza ciertos valores, las sintrofobacterias se inhiben y las bacterias como Clostridium cambian su metabolismo para consumir los equivalentes redox. Así, Clostridium spp. producen H2, CO2, acetato y butirato durante la fase de crecimiento inicial (fase acidogénica), causando así una disminución del pH del medio. Debido tanto a esta bajada de pH como a la acumulación de H2, el metabolismo microbiano sufre un cambio que se manifiesta en la producción de disolventes, como el etanol y butanol, más reducidos que los ácidos correspondientes.
Durante la digestión anaerobia de la materia orgánica, el H2 producido es eliminado por consumidores de H2, principalmente arqueas metanogénicas. Por ello, si se quiere obtener H2 como lo producto final, éstas deben suprimirse o inhibirse. En resumen,
3
para una producción eficiente de H2 deben evitarse tanto la metanogénesis como su acumulación. Una posible solución para atajar este último problema es su extracción aplicando vacío.
Se han utilizado numerosos inóculos como fuente de microorganismos productores de H2: lodo de digestores de fangos, lodos de alcantarillado, estiércol de diferentes orígenes, compost, suelos agrícolas, depósitos fluviales, etc. Entre ellos, se puede considerar el lodo granular anaerobio, procedente de reactores UASB, como una de las mejores fuentes de bacterias productoras de H2, tanto por su alta biodiversidad, a partir de él se han aislado varios clostridios y sintrofobacterias, como por su enorme concentración bacteriana (Fang et al, 2002; Lee et al, 2004; Hu y Chen, 2007).
Entre los diversos factores que afectan a la producción de H2, el pH y la temperatura juegan un papel crítico, afectando tanto al crecimiento como a la actividad de las hidrogenasas (Wang y Wan, 2008; Tang et al, 2008; Koskinen et al, 2008 Jo et al, 2008). El sustrato empleado es otro factor importante a considerar. Existen múltiples estudios relativos a la fermentación oscura utilizando glucosa y sacarosa, altamente biodegradables (Lin et al, 2006; Chu et al, 2010). Sin embargo, su coste es demasiado elevado para que el proceso sea rentable. Por ello , la conversión microbiana de residuos agrícolas e industriales en H2 resulta sumamente atractiva al reducir los costes de producción (Lee et al, 2010).
Esta Tesis tiene por objeto estudiar la producción de H2 por fermentación acida mediante bacterias aisladas e identificadas en la misma. Para ello se han estudiado diversos factores que la favorecen, tales como el pH, la temperatura y el substrato de modo que puedan alcanzarse mayores rendimientos, determinando el efecto que la aplicación de vacío pueda tener sobre el metabolismo de los productores de H2.
de H2 partiendo de cuatro fuentes diferentes, optimizándose el pH y la temperatura para maximizar la producción H2, tanto por los aislados como por un cultivo enriquecido obtenido a partir de lodo granular. En todos los casos se identificaron y cuantificaron los productos finales de la fermentación. La segunda
4
parte de nuestro estudio parte de la premisa de que algunas bacterias productoras fermentan preferentemente proteínas mientras que otras prefieren azúcares. En el trabajo desarrollado se pretendía comprender el efecto de diferentes sustratos tienen sobre la producción de H2 mediante fermentación acida. Para ello se emplearon siete substratos diferentes: cuatro medios sintéticos y tres aguas residuales reales, utilizando lodo granular anaerobio como inoculo. En el trabajo se estudió, además, el efecto de la extracción del H2 mediante vacio, las rutas metabólicas implicadas y la estructura de comunidades microbianas, determinada mediante electroforesis en gel con gradiente desnaturalizante (DGGE). La tercera parte del trabajo se centró en el estudio de las interacciones entre las diferentes cepas aisladas y, especialmente, en la formación de consorcios microbianos entre las cepas productoras de H2 y una bacteria aerobia, también aislada en el transcurso de la Tesis, capaz de formar gránulos que embeben a las productoras, lo que puede tener alto interés para su aplicación a nivel industrial.
Como inóculo para el aislamiento de bacterias productoras de H2 se utilizaron las siguientes fuentes: i) lodo granular anaerobio de un reactor UASB que trata las aguas residuales de una cervecera (Mahou SA, Alovera); ii) lodo de un digestor de biometanización que trata residuos sólidos urbanos (Valdemingómez, Madrid); iii) lodo de una depuradora de fangos activos que trata aguas residuales domésticas (Universidad Autónoma de Madrid); iv) sedimentos anaerobios de un río (Tinto, Huelva).
A lo largo del trabajo se emplearon múltiples medios con diferente composición en función de lo que se quisiera estudiar. En los trabajos de aislamiento, optimización del pH y temperatura, comportamiento de los consorcios, etc., se empleó un medio sintético [MR] que incluye como fuente de carbono tanto azúcares como proteínas (mg l-1): 280 NH4CL, 328 K2HPO4, 100 MgSO4, 500 NaHCO3, 2000 Sacarosa, 1000 extracto de carne, 500 extracto de levadura y 1 ml de solución micronutriente (Sanz et al., 1996). En otros estudios se han empleado diferentes medios, tanto sintéticos:
medio glucosa [MG], medio extracto de carne [ME], medio con aceite de oliva [MO], como aguas residuales reales: de cervecera [IW1], de una empresa de recuperación de aceites industriales usados [IW2], y aguas residuales domésticas [DW].
5
Por lo que se refiere a las técnicas analíticas empleadas en esta Tesis, el H2
y el CH4 se cuantificaron mediante cromatografía de gases utilizando cromatógrafos Bruker 450GC y GC Varian Star 3400CX, respectivamente. Los azúcares, ácidos grasos volátiles y otros productos de fermentación se analizaron mediante HPLC (Varian Prostar 350). La DQO, pH, etc., se midieron según se describe en el manual Standar Methods for Examination of Water and Wastewater (1988). La comunidad microbiana se analizó mediante DGGE.
A partir de los cuatro tipos de inóculos antes citados, y utilizando el vacío como presión selectiva, se aislaron diez cepas bacterianas altamente productoras del H2. Tras la amplificación y secuenciación del 16S rRNA se vio que todas ellas pertenecían al género Clostridium, reconocido como el más importante productor de H2 mediante fermentación oscura. El pH inicial y la temperatura óptimos para el crecimiento de los aislados y alcanzar la máxima producción de H2 fueron, en muchos pero no todos los casos, de 6,5 y 35 °C. Las variaciones en ambos parámetros tuvieron diferente incidencia sobre las distintas cepas.
En todos los casos la producción de H2 fue concomitante con el crecimiento de las cepas y un descenso del pH hasta valores de 4,5-5. Este descenso es debido a la producción de ácidos orgánicos, principalmente butirato y acetato (en proporciones que dependen de la cepa y condiciones), productos finales de la fermentación butírica, que fue la predominante. La producción de H2 se ve influenciada por múltiples factores, entre los que se incluyen el tipo de inoculo, el pH, la temperatura y el substrato. Por eso, no es fácil de comparar los rendimientos de producción H2 entre los diferentes trabajos publicados. C. roseum H5 y C. diolis RT2 presentaron los rendimientos más altos (120 mL-H2 g-1 CODinicial). Si se considera sólo el sustrato consumido, C. beijerinckii UAM y C. diolis RT2 alcanzaron los 573 y 475 mL-H2 g-1 DQOeliminada, con rendimientos para las diferentes cepas entre 2 y 4 moles de H2 por mol de glucosa, superiores, en muchos casos, a los rendimientos publicados.
Partiendo de la hipótesis de que el lodo granular es una fuente óptima de organismos productores de H2 y que, a partir de él pueden obtenerse cultivos enriquecidos altamente productores, se estudió la respuesta del mismo ante diferentes
6
substratos tanto sintéticos como aguas residuales reales, y el efecto que el vacío podría tener sobre los metabolismos fermentativos de los organismos que lo componen.
Observamos que, dependiendo del sustrato suministrado, las rutas fermentativas dominantes variaban, prevaleciendo las fermentaciones ácido-mixta [MG, IW2], homo [MO] y heteroláctica [MR, MG], butírica [DW], propiónica [IW1, ME] y la reacción de Stikland para la degradación de aminoácidos [ME]. Cuando se aplica vacío, propionato, butirato y etanol pueden ser oxidados a acetato, liberando H2. Si el proceso continúa ambos, acetato e H2, pueden ser convertidos en CH4, con la consiguiente reducción drástica de la DQO final. Por ejemplo, en [MR] la glucosa es convertida en ácido láctico y etanol y dióxido de carbono (ec. 1). Posteriormente el lactato es convertido en en dióxido de carbono y etanol (ec. 2), el cual es oxidado en acetato e hidrógeno (ec. 3) que pueden ser convertidos en metano:
C6H12O6 CH3-CHOH-COOH + CH3-CH2OH + CO2 (ec. 1) CH3-CHOH-COOH CH3-CH2OH + CO2 (ec. 2) CH3-CH2OH + H2O CH3-COOH + 2H2 (ec. 3 )
La biodiversidad microbiana fue analizada por medio de DGGE. Las bacterias predominantes (Clostridium, Klebsiella, Acetobacter, Arcobacter, Desulfovibrio, Dysgonomonas) dependen del sustrato utilizado. Por lo que se refiere al dominio arquea, tan sólo se encontraron dos géneros de metanobacterias, ambas acetoclásticas:
Methanosaeta, que parece estar presente en todos los casos independientemente del sustrato, lo que concuerda con su abundancia en el lodo granular (Diaz et al, 2006), y Methanosarcina.
Considerando que los clostridios pueden ser sacarolíticos, proteolíticos o ambas cosas, nos planteamos estudiar la especificidad de las diferentes cepas aisladas con objeto de ver el efecto sinérgico de co-cultivos sobre la degradación de sustratos mixtos, como una aproximación a la utilización aguas residuales como sustrato para la producción de H2. Los mejores co-cultivos fueron los formados por C. roseum H5 (degradador de proteínas) y C. butyricum R4 ó C. saccharobutylicum H1 (ambos consumidores de glucosa).
7
A partir lodo granular se aisló una bacteria aerobia, identificada como Streptomyces sp., capaz de crecer en determinadas condiciones formando gránulos.
Ante el potencial interés que estos pudieran tener, tanto como consumidores del oxígeno disuelto, lo que elimina la necesidad de añadir agentes reductores al medio, como la posibilidad de acumular grandes cantidades de biomasa en un biorreactor haciendo independiente el tiempo de residencia hidráulico del tiempo de residencia de las bacterias, se estudió la formación de consorcios entre el Streptomyces y los clostridios productores de H2. Se observó un aumento significativo en el rendimiento en H2, y se modificaron ligeramente los patrones de fermentación, si bien el butirato siguió siendo el principal producto de fermentación, seguido de acetato y, en menor cuantía, propionato. Puesto que la acumulación de ácidos y el consiguiente descenso del pH inhibe la posterior formación de H2 y sólo reduce en un 20-30% la carga orgánica, se añadieron al consorcio una bacteria degradadora de butirato (Syntrophobacter wolinii) y una metanógena acetoclástica (Methanosaeta concilii).
Este nuevo consorcio permitiría, en una segunda etapa tras la producción de H2, producir CH4 y reducir la carga orgánica del efluente.
Los resultados obtenidos en esta tesis han permitido redactar tres artículos, enviados para su publicación en destacadas revistas del área, y a una patente presentada en la Agencia Española de Patentes y Marcas. Como continuación del trabajo, los conocimientos adquiridos en el mismo se están aplicando a estudios sobre la producción de H2 en biorreactores. A partir de aguas residuales se espera poder alcanzar buenos rendimientos en la producción de H2, CH4 en una segunda etapa y obtener un efluente limpio que permita la aplicación de los mismos a nivel industrial.
8
9
2.1 THE HYDROGEN AS AN ALTERNATIVE SOURCE ENERGY
In the last 150 years global climate change has rises the global temperature 1°C (Vijayaraghavan et al, 2006). Increasing quantities of wastes, exhaustion of fossil fuel and increasing of energy demand require found fundamental solutions for the humanity (Kawagoshi et al, 2005; Lin et al, 2007; Oztekin et al, 2008).
Nowadays, all government around the world has a policy of developing renewable energy (Chen et al, 2006; Chu et al, 2010). Since 1990, H2 gas has received an important attention because it has been though the ideal energy source for the future (Liu & Shen, 2004; Kawagoshi et al, 2005; Chen el al, 2006). H2 is a promising energy vector with many advantages compared to fossil fuels, including no carbon dioxide emissions. It has 2.75 fold higher energy content than hydrocarbon fuels (Mohan et al, 2007; Masset et al, 2010; Ohnishi et al, 2010). H2 has a maximum energy per unit weight (122 KJ g-1) and it is easy to collect, to store and to transport.
In addition, H2 has been suggested as a fuel which would eliminate most air pollution without contributing to the greenhouse effect because it is clean, thus produce only water when combusted (Mizuno, 2000; Khanal et al, 2004; Oztekin et al, 2008; Lui et al, 2011). Although H2 is the most common element in the universe, it does not exist naturally in earth ´s current in uncombined state; so that there is need to produce it (Kalia & Purohit, 2008; Ray et al, 2010). It can produced by different process such as:
steam reforming of natural gas, steam reforming of methane, coal gasification, pyrolysis of biomass fossil and no catalytic partial oxidation of fossil fuels.
The major drawback of all these processes is its energy demand, requiring high temperatures, above 850 °C. In addition, still dependent on fossil fuels (Oztekin et al, 2008; Kalia & Purohit, 2008; Zhao et al, 2010). Hydrogen can be also produced from water by electrolysis, a highly demand energy process (Oztekin et al, 2008).
Presently 40% of the hydrogen is produced from natural gas, 30% from heavy oils, 18% from coal and 4% from electrolysis (Das & Veziroglu, 2008).
10
Figure 2.1. Hydrogen Molecule
(http://blogs.rsc.org/cy/author/defaverig-ext/)
Biological hydrogen production process can be classified as: (i) biophotolysis of water using algae and cyanobacteria; (ii) photo-fermentation of organic materials by photosynthetic bacteria; and (iii) dark-fermentation by fermentative bacteria.
However, the bio-photolysis of water induced by the first group, has many obstacles. It is rather slow, inhibited by the oxygen, and also it is dependent on the availability of sunlight (Kim et al, 2008; Oztekin et al, 2008)
The second and the third groups of bacteria are heterotrophs which use organic substrates for H2 production, releasing hydrogen under anaerobic conditions either in presence or absence of light. H2 production by fermentative bacteria is simpler and more feasible than production by photosynthetic bacteria because it offers a potential means to produce hydrogen without requiring a significant energy and it can use a variety of cheap carbon sources (Wang et al, 2007; Chu et al, 2010; Liu et al, 2011).
In the dark fermentation, different groups of bacteria are known to be responsible for hydrogen production such as Enterobacter, Clostridium, Syntrophobacteria and Bacillus (Stronach et al., 1986; Chen et al, 2006). However, hydrogen yield from the Clostridium species is generally higher than from
11
Entherobacter species: 2 and 1 mol-H2/mol-hexose, respectively (Vazquez & Varaldo, 2009).
Clostridia are classified as proteolytic or saccharolytic or both, depending on types of organic compounds that they ferment. Proteolytic ones degrade proteins or amino acids, for example C. thiosulfatireducens utilizing proteins compounds and various single amino acids but it is unable to use any carbohydrates as a carbon and energy source (Hernandez-Eugenio et al, 2002). Saccharolytic ones ferment carbohydrate and are widely studied because of their ability to produce higher level of hydrogen. For example, C. butyricum is a saccharolytic clostridium, producing butyrate, acetate CO2, and H2. The hydrogen fermentation reactions for sucrose as organic substrate are showing in the following equations (1) and (2).
C12H22O11 + 5H2O → 4CH3COOH + 4CO2 + 8H2 (eq.1) (Sucrose) (Acetic acid)
C12H22O11 + H2O → 2CH3CH2CH2COOH + 4CO2 + 4H2 (eq. 2) (Sucrose) (Butyric acid)
This pathway is found in approximately 50% of all clostridia isolated to date. Other fermentations pathways found in saccharolytic clostridia are those leading to the production of propionate, by C. arcticum; succinate by C. coccoides; and lactate by C.
barkeri (Khanal et al, 2004; Kim et al, 2008).
2.2 MICROBIOLOGY OF ANAEROBIC DIGESTION AND BIOCHEMISTRY OF HYDROGEN PRODUCTION
For the complete degradation, to CO2 and CH4, of complex organic matter in absence of oxygen, several groups of microorganisms are required. Hydrolytic bacteria hydrolyze macromolecules such as lipids, proteins and carbohydrates. Then, fermenting bacteria and the bacteria of β-oxidation degrade various carbon source to produce volatile fatty acids (VFA) such as acetate, propionate and butyrate, lactate,
12
ethanol, etc., and hydrogen. Later, obligate hydrogen producing acetogens (OHPA bacteria) degrade the former ones to acetate, hydrogen. Finally, acetate, hydrogen and CO2 are used to produce methane by methanogenic archaea (acetoclastic and hydrogenotrophic respectively) (Figure 2.2).
Figure 2.2. Anaerobic digestion diagram. Adapted from Stronach et al., (1986).
In addition, when sulfates or nitrates are present, sulfate-reducing bacteria (SRB) and nitrate-reducing bacteria (NRB) are capable to use hydrogen as electron donors generating sulfides and ammonia, respectively (Stronach et al., 1986; Hu & Chen, 2007).
13
Electrons liberated during the oxidation of the carbonaceous substrates by fermenting and OHPA bacteria are subsequently converted into hydrogen (equations 3, 4 and 5).
C6H12O6 + 2H2O → 2CH3COOH + 2CO2 + 4H2 (eq. 3) C6H12O6 + 2H2O → CH3CH2COOH + CH3COOH + 2CO2 + 3H2 (eq. 4) C6H12O6 + 2H2O → CH3CH2CH2COOH + 2CO2 + 4H2 (eq. 5) The theoretical hydrogen yield is 4 moles H2 mol hexose-1, if acetate is only reduced carbon byproduct during glucose degradation (eq.3). However, the theoretical yield is never achieved in mixed anaerobic microbial systems because of the syntrophic association between hydrogen producing and hydrogen consuming microorganisms.
The major cause for low hydrogen yields is the presence of hydrogen consumers such as hydrogenotrophic methanogenes [HMB], sulfate-reducing bacteria [HSRB] and homoacetogens.
½ H2 + ¼ CO2 → ¼ CH4 + 1/2 H2O (∆G 0´= -32.7 KJ mol H2
-1) (eq.6) H2 + ½ CO2→ ¼ CH3COOH + 1/2 H2O (∆G 0´= -23.7 KJ mol H2
-1) (eq.7) Compared to homoacetogenesis (eq.7), methanogenesis (eq.6), is the more favorable energetic route (Ray et al, 2010). In general, hydrogen can be produced through the pyruvate decarboxylation or the formate cleavage process. In the process hydrogen producing via pyruvate decarboxylation, sugars (including mono-,di, tri-, and polysaccharides) are initially converted to pyruvate via the Embden-Meyerhof pathway (Figure 2.3), in which 1 mol of hexose is metabolized to 2 mol of puryvate with the production of 2 moles of reduced nicotinamide adenine dinucleotide [NADH]
and 2 mol of adenosine triphosphate [ATP].
Clostridia can also use the peptone phosphate pathway for the conversion of 3 mol of peptone to 5 mol of ATP and 5 mol of NADH. Pentose sugars are fermented to pentose 5-phosphate. Then, fructose 6-phosphate and glyceraldehydes 3-phosphate
14
are produced and can enter to glycolytic pathway, by means of the transketolase- transaldolase sequence.
Figure 2.3. The Embden-Meyerhof pathway. Hexose sugars are initially converted to pyruvate.
The enzymes involved: PGK, phosphoglycerate Kinase and PyrK, pyruvate kinase. Adapted from (Madigan et al, 2009).
Later, pyruvate generated from fermented hexose/pentose sugars is cleaved by pyruvate ferredoxin oxidoreductase in the presence of coenzyme A (CoA) to generated acetyl-CoA, reduced ferredoxin and carbon dioxide (eq.8).
Puryvate +CoA+2 Fdox→Acetyl-CoA+2 Fdred+ CO2 (eq.8)
The acetyl-CoA produced is the essential intermediate in both acid-producing and solvent-producing pathways (Figure 2.4).
15
Figure 2.4. Some microbes fermentation (from Prescott et al., 2000). Fermentation of pyruvate by different microorganisms with:
1: Lactic Bacteria (Streptococcus, Lactobacillus), Bacillus.
2: Yeast, Zymomonas.
3: Propionic bacteria (Propionibacterium).
4: Enterobacter, Serratia, Bacillus.
5: Enteric bacteria (Escherichia, Enterobacter, Salmonella, Proteus) 6: Clostridium
Acetyl-CoA can be phosphorylated by the phosphotransacetylase-kinase or phosphotransbutylase-kinase system to generate acetate or butyrate and ATP.
Whereas, the net amounts of ATP generated during the formation of acetate and butyrate differs. The net yield of ATP obtained from acetate production is double that obtained from butyrate production.
16
Theoretically a total of 4 mol of ATP would be generated from 1 mol of glucose if all glucose was fermented completely to acetate, CO2, and H2, whereas only 3 mol of ATP would be generated if 1 mol of glucose was fermented completely to butyrate, CO2 and H2 (Jones, 1986; Jo et al, 2008; Das & Veziroglu, 2008; Vazquez &
Varaldo, 2009).
However, when organic acids are generated, there are not any reductions and reduced ferredoxin is able to transfer electrons to hydrogenase (enzyme directly involved in the metabolism of molecular H2) that permits the use of protons as a final electron acceptor. Thus, ferredoxin is re-oxidized and molecular H2 is released from the cell (eq. 9). The proton reduction is essential in pyruvate fermentation or in the disposal of excess electrons (Vazquez & Varaldo, 2009; Das & Veziroglu, 2008).
2H+ + Fdred → H2 + Fdox (eq. 9)
However, hydrogen production by anaerobic bacteria is reversibly inhibited under flowing conditions: higher hydrogen partial pressure than 0.5 atm and accumulation of un-dissociated acids concentrations (acetic and butyric) between 0.3 and 50 mM. Resulting in decrease of pH below 5.5 (Jones, 1986; Vazquez & Varaldo, 2009; Das & Veziroglu, 2008).
Indeed, under these conditions, the H+/H2 redox potential is lowered and the flow of electron from reduced ferredoxin to molecular hydrogen via the hydrogenase system is inhibited. Thus, the law of mass action limits the formation of H2 and the NADH is usually used to drive the more energetically favorable formation of other metabolites to reduce acetyl-CoA and butyryl-CoA to ethanol (Figure 2.4 and 2.5) and butanol production (solventogenesis pathways).
For this reason, triggering for solventogenesis must be obligatory in these conditions.
Consequently, the culture enters the stationary growth phase and the metabolism of the cells undergoes a shift to solventogenic phase (Jones, 1986; Jo et al, 2008;
Vazquez et al, 2009). Clostridium species can also convert pyruvate to lactate (Figure 2.6) under certain conditions. The lactic acid pathway is not operational under normal conditions, and this pathway only appears to operate as a less efficient alternative to
17
allow energy generation and the oxidation of NADH to continue when mechanisms for the disposal of protons and electrons by the generation of molecular hydrogen is blocked.
Figure 2.5. Fermentation ethanol. Image from Purves et al, Life = The science of Biology, 4th Edition (http://www.emc.maricopa.edu/faculty/farabee/biobk/biobookglyc.html)
Lactate production has been reported to occur when the activity of hydrogenase was inhibited by carbon monoxide or in cells depleted of iron, when reduced levels of ferredoxin and hydrogenase occurred (Jones, 1986; Levin et al, 2004).
18
Figure 2.6. Fermentation of lactate. Image from Purves et al, Life = The science of Biology, 4th Edition (http://www.emc.maricopa.edu/faculty/farabee/biobk/biobookglyc.html).
In addition to hydrogen producing through pyruvate decarboxylation described above, hydrogen can be produced through formate cleavage. The formate was split into hydrogen and carbon dioxide by formate hydrogen lyase, which was the dominant process involved with facultative anaerobes, such as Enterobacter and Klebsiela (Liu et al, 2011).
Hydrogen is also produced during acetogenesis by syntrophobacteria like Syntrophobacter and Syntrophomonas which convert volatile fatty acids (VFA) and other intermediates into H2, CO2 and acetate. The activity of these organisms is necessary to the anaerobic digestion process to degrade the longer-chain fatty acids, which cannot in their original states be utilized by the methanogenic bacteria (Stronach et al, 1986). This group requires a lower partial pressure of H2 to convert the higher volatiles fatty acids to acetate. Thus, under higher partial pressure of the hydrogen, acetate formation is reduced and they appear C3, C4 and an ethanol in the place of CH4. A strict symbiotic relationship exists between acetogens and methanogenic (or a sulfate reducing), because this mentioned help to reduce the partial pressure of H2 required by acetogens. Consider the case of syntrophy involving ethanol fermentation to acetate and eventual production of methane. As seen, the ethanol fermenter carries out a reaction that has unfavorable (that is, positive) standard free energy change (eq.10). However, the H2 produced by ethanol fermenter is a
19
valuable electron donor for methanogen (eq.11), and when the two reactions are summed; the overall reaction is exergonic and supports growth of both partners in the syntrophic mixture (12).
Ethanol fermentation:
2CH3CH2OH + 2H2O → 4H2 + 2CH3COO- + 2H+ ∆G0` = +19.4 KJ (eq.10) Methanogenesis
4H2 + CO2 → CH4 + 2H2O ∆G0` = -130.7 KJ (eq.11) Syntrophic, coupled reaction
2 CH3CH2OH + CO2 → CH4 + 2CH3COO- + 2H+ ∆G0` = -111.3 KJ (eq.12)
Another good example of syntrophy is the oxidation of butyrate to acetate plus H2 by fatty acid-oxidizing syntrophic bacterium Syntrophomonas (eq.13). The free energy change of this reaction is highly unfavorable and in pure culture Syntrophomonas will not grow on butyrate. But if the H2 produced in the reaction is immediately consumed by a partner organism (like a methanogen), Synthrophomonas grows luxuriantly in co- culture with the H2 consumer (Madigan et al, 2009).
Butyrate - + 2H2O → 2 acetate- + H+ + 2H2 ∆G0` = +48.2 KJ) (eq.13)
In summary, many bacteria contain enzymes hydrogenases that can produce hydrogen during the fermentation of variety of substrates. The maximum hydrogen production, 4 mol H2/mol glucose, can be achieved when acetate is the only final product and no microbial growth occurred (eq. 3), 2 mol H2/mol glucose when butyric acid was produced (eq. 5) and zero mol H2/mol glucose when ethanol was produced (eq.10). However, a high propionic acid indicated that hydrogen fermentation was inefficient (Kalia & Purohit, 2008; Das & Veziroglu, 2008; Cheng et al, 2011).
20
2.3. FACTORS AFFECTING HYDROGEN BIOPRODUCTION 2.3.1 INOCULUM
In most studies, anaerobic digestion sludge, aerobic compost, sewage water treatment sludge, agricultural soil, river sediment, sludge compost and isolated bacteria have been used as inocula for hydrogen fermentation (Kawagoshi et al, 2005;
Hawkes et al, 2007; Koskinen et al. 2008; Vazquez et al, 2008; Ohnishi et al, 2010) (Figure 2.7). Previous works have reported different methods for preparation of hydrogen-producing seeds (base, acid, 2-bromoethanesulfonic acid, load shock and heat shock treatments) (Thong et al, 2008).
(A) (B)
Figure 2.7. (A) Aerobic domestic wastewater treatment plant (activated sludge, Universidad Autónoma, Madrid, Spain). (B) Anaerobic industrial (brewery) wastewater treatment (UASB, Mahou SA, Guadalajara, Spain).
In most cases, inocula are conditioned by heating or pH treatment to enhance hydrogen production because hydrogen producing bacteria are commonly tolerant to extreme environmental conditions and methanogens can be rid (Tang et al., 2008).
Thus, the major hydrogen producing microorganisms in anaerobic digestion are the spore-forming clostridia and relatives. Clostridium spp. are very resistant to heat or
21
harmful chemicals, which provided important clues for treating methanogenic sludges to become hydrogen producing sludges (Hu & Chen, 2007).
Anaerobic granular sludge can be considered as one of the best source for hydrogen-producer bacteria. Its specific activity is very high and diverse clostridia and syntrophobacteria have been isolated from granular sludge. In fact, granular sludge has been used as inocula in several studies on H2-production (Fang et al, 2002; Lee et al, 2004; Hu & Chen, 2007).
2.3.2 pH
The control of pH is crucial for hydrogen production due to its effect on FeFe –hydrogenase activity, metabolic pathways and length of lag-time (Lay, 2000).
The activity of hydrogenase is inhibited by low pH, which was reported to be one of the most important factors in the overall hydrogen fermentation (Jones, 1986).
To understand the effect of the pH must be considered that the organic acids are toxics in acid-free state. And the equilibrium between its dissociated and non- dissociated forms depends on the Ka and pH. At pH 7, only 1% of the acetic acid is in the acid-free form, whereas at pH 5, 99% is present in this form. Similarly, at pH 6 only 6% of the total amount of butyric acid is in the un-dissociated form, whereas at pH 4.5 66% occurs in the un-dissociated form (Jones, 1986).
During anaerobic fermentation, hydrogen is consumed mainly by hydrogenotrohic methanogens and homoacetogens until the threshold hydrogen partial pressure is attained. Methanogens grow optimally at pH range from 6.3 to 7.8 (Ray et al, 2010). However, pH (below to 6) is effective for inhibiting methanogenesis activity and obtaining an inoculum rich in hydrogen producers (Khanal et al, 2004; Kawagoshi et al, 2005; Vazquez & Varaldo, 2009). According to several reports, the optimum pH favorable for hydrogen production for mixed culture using starch or sucrose as organic substrate under mesophilic condition range from 5.2 to 7 (Nath et al, 2006 ; Leitao et al 2006; Khanal et al, 2004). Masset et al, 2010 showed that maximum hydrogen yield
22
by Clostrdidium butyricum CWBI1009 using glucose as substrate was observed at pH maintained at 5.2.
However, in experiments conducted to investigate the effect pH on fermentative hydrogen production by different microorganisms using glucose or starch as substrate, the maximum hydrogen yield was obtained at pH 5.5 ( Lay et al, 1999;
Ginkel & Sung, 2001; Fang et al, 2002; Chen et al, 2005; Tang et al, 2008 ).
Maximum hydrogen yield for Clostridium butyricum CGS2 is achieved at pH 6 using glucose as substrate (Lui et al, 2011), whereas a high hydrogen production with Clostridium tyrobutyricum JM1 achieved at pH 6.3 using a complex medium constituted from meat extract, glucose and starch as substrates (Jo et al, 2008). Initial pH also influences the extent of lag-phase in batch hydrogen production. The low initial pH values of 4-4.5 cause longer lag-phase. However, high initial pH values such as 9 decreases lag time (Khanal et al, 2004; Zhang et al, 2003).
In comparable studies reported in the literature described above, the hydrogen yield via dark fermentation varied widely from 7.8 to 5.2, mainly depending on the type of hydrogen producers and carbon substrate used. In most cases, pH control can significantly affect hydrogen production by stimulating the microorganisms to produce hydrogen. However, too low or high pH values lead to inhibition of hydrogenase activity in the overall hydrogen fermentation.
2.3.3 TEMPERATURE
Temperature is an important environmental and operating factor in all biological processes. A change in the temperature might alter the substrate use, the process efficiency, the liquid product distribution and the microbial community (Fang et al, 2002). Regarding hydrogen production, it can affect the activity of hydrogen producing bacteria by influencing the activities of essential enzyme such as hydrogenases (Wang & Wan, 2008).
23
Most of the works have been performed at mesophilic temperatures. An optimum hydrogen yield was got at 35 °C for mixed culture using glucose as substrate (Ray et al, 2010) and Clostridium beijerinckii Famp 3 using glucose and peptone as substrates (Pan et al, 2008). In other studies, 40 °C for mixed culture using glucose as substrate (Wang & Wan, 2008), 45°C for natural mixed microflora seed source using cattle wastewater by sewage sludge as substrate (Tang et al, 2008), 50 °C for sludge compost using glucose as substrate (Morimoto et al, 2004) have been reported. Increasing temperature could increase the ability of hydrogen-producing bacteria to produce more hydrogen, but temperature at much higher levels could decrease it (Lee et al, 2006). While, strains cultivated under strictly anaerobic conditions showed the best growth at temperature of 75-80 °C with maximum hydrogen production of 342 ml H2 gas/L of modified medium containing 7.5 g/l glucose and 4g/l yeast extract was obtained (Nguyen et al, 2008). The possible reasons why these results were different may be explained by the differences among these studies in terms of substrates, seed sludge and range of temperature studied (Wang &
Wan, 2008).
2.3.4 SUBSTRATE (FEEDSTOCK)
Glucose and sucrose, both easily biodegradable, and have been at length used in fermentative hydrogen production studies (Lin et al, 2006; Chu et al, 2010).
But the cost of these substrates is high. Therefore, the microbial conversion of domestic, agricultural and industrial wastes into hydrogen is attracting increasing interest because it can convert organic wastes to more valuable energy resources (Khanal et al, 2004; Datar et al, 2007; Cheng et al, 2011; Ohnishi et al, 2010).
Dark fermentative bacteria are able to use a broad range of substrates (solid and water residues). About solid waste various cheap and abundant alternative feedstocks such as molasses, lignocelluloses, hydrolysate and food or kitchen wastes have been studied in previous works for hydrogen production (Hawkes et al, 2007;
Niu et al, 2010).
24
Concerning water residues, an extensive research is carried out for hydrogen production using wastewater from industrial process such as rice slurry wastewater (Yu et al, 2002), wastewater from a sugar beet refinery (Wang et al, 2006), sewage wastewaters (Cai et al, 2004), citric acid wastewater (Yanga et al, 2006) and cellulose wastewater (Lay & Noike, 1999).
In general, use of waste materials as substrates facilitates both treatment and renewable extraction of hydrogen clean gas.
2.3.5 HYDROGEN PARTIAL PRESSURE
The partial pressure of hydrogen (PH2) in the headspace during the fermentation, which affected the level of dissolved hydrogen gas in the fermentation medium, has been observed to modulate hydrogen production. Under higher concentration of hydrogen, the H+/H2 redox potential is lowered and the electrons flow from reduced ferredoxin to molecular hydrogen via the hydrogenase system is inhibited (Jones, 1986; Madigan et al, 2009). Consequently, it is important to control (PH2) in the liquid phase for enhancement of hydrogen yield. Thus, decrease in hydrogen concentration will favor hydrogen formation and permit bacteria to metabolize acetyl-CoA through the energy-efficient path leading to acetate and ATP production (Jones, 1986).
Since hydrogen accumulates in the medium during dark fermentation, various techniques have been proposed to remove Hydrogen and CO2 from the liquid phase. Gas flushing has been the most common method used to decrease dissolved gas concentrations in fermentative hydrogen-producing reactors, increasing the hydrogen- production by a factor of 1.5-1.7 (Mizuno et al, 2000, Hussy et al, 2003; Lui et al, 2006; Kalia & Purohit, 2008). Gas sparging also delayed the build-up of acetic acid in the bioreactor, suggesting that it serves to inhibit homoacetogenesis thus maintain hydrogen production (Nicolau et al, 2010).
Other techniques to remove hydrogen include increasing the stirring rate and using an immersed membrane to directly remove dissolved gases (Kalia & Purohit,
25
2008). Using polymeric membranes and active membranes technology can separate hydrogen from other gas such as nitrogen, methane, and carbon dioxide at ambient temperatures and pressures (Kalia & Purohit, 2008). Thus, separation of the two process hydrolysis/acidogenesis and methanogenesis, preventing interspecies hydrogen transfer between acidogens/acetogenes and methanogenes, can be a good approach to increase the hydrogen yield (Lui et al, 2006).
26
27
The oxidation of reduced pyridine nucleotides and ferredoxin is associated to the H2
formation by a mechanism which is inhibited by elevated partial pressures of H2. In addition, the metabolism of Clostridium - the more studied H2-producing bacteria by dark fermentation - switches from acidogenesis to solventogenesis releasing much less H2. Consequently, to produce H2 efficiently its accumulation must be avoided. On the other hand, during the anaerobic digestion of organic matter, the H2 released is readily consumed by hydrogen-consumers, mainly methanogenic archaea. For this reason, in order to obtain H2 as the end-product, methanogenesis must be kept away. One innovative approach to avoid H2 accumulation is its removal by the application of a low vacuum on the fermentation system.
Inoculums, temperature, pH and substrate are crucial to end-product formation. In addition, clostridia require strict anaerobic conditions for hydrogen production. In all the case, the fermentation by Clostridium spp. release organic acids which drop the pH and inhibit further hydrogen production.
The major objective of this study was the advancement of bio-hydrogen production process by improvement the hydrogen yield, making the process economically viable.
In order to achieve this goal, the following partial objectives were considered:
- To isolate and characterize effective hydrogen-producing strains from different sources: anaerobic granular sludge from a full-scale Upflow Anaerobic Sludge Bed (UASB) reactor, sludge from an anaerobic digester treating municipal solid wastes, activated sludge from an aerobic domestic wastewater treatment plant, and anaerobic sediments from a river.
- To estimate and investigate the influence of environmental factors, such as initial pH and temperature, on the H2 production by the isolated strains and an enrichment culture obtained from anaerobic granular sludge.
- To investigate the final products of H2-producing fermentations and the metabolic pathways involve.
- To study the effect of vacuum and different substrates - synthetic, industrial and domestic wastewaters - on the fermentative pathways and the microbial communities involved.
28
- To analyze the synergy of several H2-producing strains on the hydrogen production.
After the isolation for our group of an aerobic microorganism, identified as Streptomyces sp., able to growth forming granules that embed the hydrogen-producers, the following objectives were included:
- To form a microbial consortium with the hydrogen-producing Clostridium spp.
and the oxygen-consuming Streptomyces sp.
- To compare the H2 yield and the end-fermentation products for the axenic cultures, co-cultures and consortia.
- To study the effect of the inclusion in the consortia of butyrate-degrading and acetate-consuming microorganisms.
- To integrate the results obtained in order to better understanding and predicting the hydrogen production by dark fermentation.
29
30 4.1 REAGENTS
Most of the chemical reagents used for the preparation of solutions and buffers were obtained from:
Panreac, Barcelona, Spain.
Merck, Darmstadt,Germany.
Sigma, Highland, IL, United States.
Difco, Le Pont de Claix, France.
Excepted
Taq-polimerase Taq DNA Polymerase M1861, Promega,
Madison, WI, EEUU.
Fage φ-29 HindIII Fermentation Service, Centre of Molecular Biotechnology, Madrid, Spain.
Primers (PCR) Isogen, Ljsselstein, The Netherlands.
Restrictions enzymes New England Biolabs, Ipswich, MA, EEUU.
4.2 MICROORGANISMS
The pure cultures used for the acetate and butyrate degradation assays
• Methanosaeta concilii DSM6752
• Syntrophobacter wolinii with co-culture Desulfovibrio DSM 2245A Were obtained from the German microbial collection DSMZ (Deutsche Sammlung von Microorganismen and Zellkulturen GMBH, Braunschweig, Germany).
31 4.3 SOURCE OF BIOMASS
The following sources were used as inocula for the isolation of hydrogen-producing bacteria:
1 Granular sludge from a full-scale UASB reactor treating wastewater from a brewery (Mahou SA, Alovera, Spain).
2 Sludge from an anaerobic digester treating municipal solid wastes (Valdemingómez, Madrid, Spain).
3 Activated sludge from an aerobic domestic wastewater treatment plant (Universidad Autónoma, Madrid, Spain).
4 Sediment from a river (Rio Tinto, Huelva, Spain).
Granular sludge was also used as inocula for isolating the facultative oxygen- consumer microorganism.
32
4.4 CULTURE MEDIA AND COMMON BUFFERS 4.4.1 CULTURE MEDIA
A. Synthetic media. The following synthetic media were used for different purposes throughout this Thesis:
Media Carbon source (L-1)
MR 2000 mg Sucrose, 500 mg Meat extract and 500 mg Yeast extract.
MG 4000 mg Glucose.
ME 3000 mg Meat extract.
MO 1 ml Olive oil.
MA 2000 mg Acetate.
MB 2000 mg Butyrate.
- The mediua reactor [MR] and glucose [MG] were used to isolate microorganisms and the pH, temperature and substrate optimization assays. The solid media was prepared by adding 15 g L-1 of bacteriological agar.
- The media Meat extract [ME] and Oil [MO] were used for substrate optimization assays.
- The media Acetate [MA] and Butyrate [MB] were used for growing acetate- and butyrate-consuming microorganisms, respectively. Initial chemical oxygen demand (CODi) and pH of both media were adjusted to 2 g-COD L-1 and 7, respectively.
33
- CODi and pH were adjusted (according to the proper experiment), then medium sterilized with filtration. Anaerobic conditions were achieved by fluxing the headspace with N2:CO2 (80:20) and adding 40 mg L-1 L-Cysteine. Aqueous L-Cysteine solution was sterilized by filtration in hermetically stopper bottle to prevent its oxidation by ambient air.
• The following mineral media was added to the synthetic media (final concentrations):
Components mg L-1
NH4CL 280
K2HPO4
.3H2O 328
MgSO4 100
NaHCO3 400
Yeast extract 100
Micronutrient solution (Sanz et al, 1996)
1 ml
34
• 1 ml of this flowing Micronutrient stock solution (Sanz et al, 1996) was added to mineral medium
Micronutrient solution
mg L-1
FeCl2⋅4H2O 2000
H3BO3 50
ZnCl2 50
CuCl2⋅2H2O 38 MnCl2⋅4H2O 500 (NH4)6Mo7O24⋅4H2O 50 AlCl3⋅6H2O 90 CoCl2⋅6H2O 2000 NiCl2⋅6H2O 92 Na2SeO3⋅5H2O 164 EDTA (titriplex) 1000
Resazurina 200
H2SO4 1 ml
35 B. Wastewaters
The following wastewaters were used for substrate optimization: wastewater from a brewery (Mahou SA, Alovera, Spain) [IW1]; water from a wastewater treatment plant of recovery industrial oil (SIGAUS SL, Madrid, Spain), [IW2]; and water from a domestic wastewater treatment plant at the Universidad Autónoma, Madrid, Spain [DW].
4.4.2 COMMON BUFFERS
- EDTA (Tris-EDTA): 10 mM Tris-HCl, 1.0 mM EDTA, pH 7.5-8.0.
- TAE (Tris-Acetate-EDTA): 80 mM Tris-HCl, 2.0 mM EDTA, 40 mM Sodium acetate, pH 7.4.
- TBE (Tris-Borate-EDTA): 89 mM Tris-HCl, 89 mM Acid borique, 2.0 mM EDTA, pH 8.0.
- PBS (Phosphate Buffer saline): 130 mM NaCL, 10 Mm Na2HPO4/NaH2PO4, pH 7.2- 7.4.
4.5 ISOLATION OF PURE CULTURE
Cultures were obtained using 120 mL glass serum bottles containing 60 mL of medium. Anaerobic conditions were achieved by fluxing the headspace with N2:CO2 (80:20) and addition of L-Cysteine (40 mg L-1). The medium was inoculated with 1g of homogenized sludge then incubated under partial vacuum at 30 °C for 30 d.
The nutrients were renewed weekly. The cultures producing significant amounts of hydrogen were inoculated in MR agar plates and incubated at 30 °C for 72 h. Single colonies were picked and grown in MR in order to obtain pure cultures of hidrogen- producing microorganisms (see also 4.9.5). An enriched culture (EC) was obtained from granular sludge after five month incubation in the former conditions described above. The medium was periodically renewed.
36
4.6 OPTIMIZATION OF pH AND TEMPERATURE
The pH and temperature optimization tests were conducted in 120-mL serum bottles with 20 mL of MR. The media were inoculated initially to an optical density (OD) of 0.001 with the pure cultures studied grown to exponential phase. The conditions were those described above except for the parameter tested (pH or temperature). The values of pH tested were 5, 5.5, 6.5 and 7.5. The temperature optimization experiment was carried out at 25, 30, 35 and 40 °C. Each test was done in triplicate. Hydrogen production, OD and pH were analyzed at 14, 24 and 48 hours.
The CODi was adjusted to 4.6 g-COD L-1.
4.7 OPTIMIZATION OF SUBSTRATES
Batch experiments were conducted in 1.2 L reactors filled with 1 L of medium. Four synthetic (MR, MG, ME and MO), two industrial (IW1 and IW2) and one domestic wastewater (DW) were used. Anaerobic conditions were achieved by fluxing the headspace with N2:CO2 (80:20) and the addition of L-Cysteine (40 mg L-1).
Anaerobic granular sludge from a full-scale UASB reactor treating brewery wastewater (Mahou SA, Guadalajara, Spain) was used as source of microorganisms.
The medium was inoculated with 0.1 g of homogenized granules then incubated at 30
°C for 30 days. Reactors were prepared by duplicate. Vacuum was applied to seven reactors, remaining the other seven ones as controls. Measures of pH and COD were done weekly. Initial pH and CODi were adjusted to 7 and 4 g-COD L-1 respectively.
Expected CODi of UAM was 1 g-COD L-1.
Four different initial substrate concentrations of MR: 4, 8, 16 and 24 g-COD L-1, with and without buffer solution, was used to study the effect of substrate concentration in hydrogen production.
37
4.8 CO-CULTURES AND MICROBIAL CONSORTIA
Three types of experiments were carried-out:
4.8.1 HYDROGEN-PRODUCING CO-CULTURES
All isolated hydrogen-producing strains were grown in the media MG and ME. The producer strains with the highest yields of hydrogen were selected for the further assays. Different combinations were studied with two, three and four of the selected strains, mixing saccharolytic and proteolytic strains. The tests were conducted in 120-ml serum bottles with 20 ml of medium MR which were flushed with N2:CO2
(80:20 %) to remove the remaining oxygen in the gas phase. Each test was done in triplicate. Hydrogen production and VFA concentration were periodically measured.
4.8.2 HYDROGEN-PRODUCING / OXYGEN-CONSUMING CO-CULTURES
To study the role of the oxygen-consuming Streptomyces sp., co-cultures of Streptomyces sp. with the best hydrogen-producing strains were grown in MR without adding any of the reducing agents commonly used. Streptomyces sp. was aerobically grown in a horizontal shaker at 100 rpm allowing it to form dense granules. Then, the culture was inoculated, to an initial optical density of 0.001, with the hydrogen- producing pure cultures selected grown to exponential phase. The experiment was performed at an initial pH of 6.5. Each test was done in triplicate. Controls without Streptomyces sp. were run in parallel. The hydrogen and VFA production were periodically measured.
38
4.8.3 HYDROGEN-PRODUCING / OXYGEN-CONSUMING / BUTYRATE AND ACETATE-DEGRADING CO-CULTURES
Batch tests were conducted in 120-ml serum bottles with 20 ml of MR. The medium was buffered with 0.05 M phosphate to pH 7.2. Methanosaeta concilii (DSM672) and Syntrophobacter wolinii in co-culture with Desulfovibrio (DSM 2245A), were added to the consortia described above to enhance the complete mineralization of the carbon source. Each test was done in triplicate. The hydrogen production was measured at 24, 48 and 72 h, and the methane and VFA production at 3, 7 and 28 days.
4.9 MOLECULAR TECHNIQUES 4.9.1 DNA EXTRACTION
Total genomic DNA was extracted from samples of each reactor (used to study both effect of substrate and vacuum application) at the end of the experiments, using the commercial Kit FastDNA SPIN Kit for Soil following the manufacturer’
protocol.
4.9.2 POLYMERASE CHAIN REACTION (PCR)
The total genomic DNA was used as templates. PCR was performed in 50 µl of reaction volume with 0.25 mmol dNTPS, 0.5 µM of each primer and 10-3 units Taq-plymerase. Mg2+ concentration and melting temperature in thermo-cycler program were adjusted according to the appropriate primer. Each program contains an initial step of DNA denaturation at 94 °C, followed by X cycles (depending from one program to other), including denaturation, annealing and elongation/extension steps (Table 4.1). A single final elongation step was occasionally performed at a
39
temperature of 72 °C after the last PCR cycle to ensure that any remaining single- stranded DNA is fully extended.
Table 4.1Primers used in this Thesis
Primers (a) Specificit y
Sequences from [5`·to 3`] Ref
1492R Universal TACGGYTACCTTGTTACGACT T
(Lane, 1991)
27F Bacteria AGAGTTTGATCHTGGCTCAG (Lane, 1991) 341F (GC)
b
Bacteria CCTACGGGAGGCAGCAG (Muyz et al,, 1993)
907R Bacteria CCGTCAATTCHTTTGAGTTT (Muyz et al,, 1993)
25F Archaea CYGGTTGATCCTGCCRG (Reysenbach et al.,
1992) 344F
(GC)
Archaea ACGGGGYGCAGCAGGCGCGA Muyzer et al., 1993)
915R Archaea GTGCTCCCCCGCCAATTCCT Muyzer et al., 1993)
IUB Code (International Union of Biochemistry): M= A, C; Y=T, C; R= A, G.
a F (Forward) and R (reverse), indicated the orientation of the primers according to DNA.
b For DGGE, the following GC sequence (GC-clamp) to the primers in the 5´-end was added:
5´CGCCCGCCGCGCCGCGCGGGCGGGGCGGGGCACGGGGGG-3´.
40 Complete 16S rRNA gene
Primers: 27 F/1492 R Target:16S rDNA Bacteria Mg +2 : 2.5 mM
Melting-Temperature: 56 °C Number of cycles: 30
Primers: 25 F/1492 R Target: 16S rDNA Archaea Mg +2 : 3 mM
Melting-Temperature: 52 °C Number of cycles: 35
Partial amplification of the 16S rRNA gene (DGGE) Primers: 341 F/907 R
Target:16S rDNA Bacteria Mg +2 : 1.5 mM
Melting-Temperature: 52 °C Number of cycles: 30
Primers: 344 F/915 R Target:16S rDNA Archaea Mg +2 : 1.5 mM
Melting-Temperature: 54 °C Number of cycles: 32
41
4.9.3 ELECTROPHORESIS IN AGAROSE GEL
Total genomic DNA and fragments of amplified DNA were verified by horizontal electrophoresis through agarose gels. Gel cast with TBE (0.5X) with 0.9%
p/v to 2 % p/v of agarose. Gels were stained with Ethidium bromide and visualized with UV radiation. A molecular weight marker (ϕ29) was used to determine the molecular size and concentration of DNA.
4.9.4 DENATURED GRADIENT GEL ELECTROPHORESIS (DGGE)
The DGGE analysis of the PCR products were performed by electrophoresis in TAE buffer solution for 5 h at 200 V and 60 °C using the DCode TM Universal Mutation Detection System (BioRad, USA). Poly-acrylamide gels 6% (w/v, acrylamide-bisacrylamide 37.5:1) were prepared with denaturanting gradient ranging from 30% to 60%, in which 100% denaturant contained 7 M urea and 40% v/v formamide. Selected bands on the gel were excised, placed in 1.5 ml tubes with 50 µl of distilled water overnight at 4 °C, then they were incubated a one hour at 55 °C to reclaim the DNA. DNA was re-amplified by PCR for sequencing according to PCR conditions described above.
4.9.5 PHYLOGENETIC ANALYSIS
Single colonies from MR agar plates were inoculated into 25 mL serum bottles containing 5 mL of MR and incubated at 37 °C overnight. Cells from the bottles with high hydrogen production were collected for sequencing. 1 mL of liquid culture was centrifuged (10000 rpm, 15 min), the pellet washed with 1 mL of PBS, centrifuged (10000 rpm, 15 min), and re-suspended in 100 µL of distilled water. The suspension was heated at 94 °C for 10 min and centrifuged (15000 rpm, 5 min). 5 µL of the supernatant was amplified by PCR using the primers 27F and 1492R (Lane,
42
1991). The amplicons were assembled and the consensus sequence corrected manually for errors using the DNA Baser v3 program (http://www.dnabaser.com). The sequences where compared to those in the GenBank database of NCBI (http://www.ncbi.nlm.nih.gov) using the Basic Local Alignment Search Tool (BLAST) algorithm and the tool Classifier of the Ribosomal Database Project (http://rdp.cme.msu.edu/).
4. 10 ANALYTICAL METHODS 4.10.1 CHEMICAL ANALYSIS
The pH was monitored with a pH-meter Thermo Scientific- Orion 2STAR.
The cell biomass concentration was estimated measuring the absorbance of the sample at a wavelength of 610 nm (OD610). Chemical oxygen demand (COD) was determined according to Standard Methods (APHA 1998) (method 5220 D: closed reflux and colorimetric method).
4.10.2 HYDROGEN AND CARBON DIOXIDE
Hydrogen production was measured periodically either using a H2 gas detector (MDA Scientific Midas Gas Detector, Honeywell, USA) by making the appropriate dilutions of the gas or a gas chromatograh Bruker 450 GC as described below.
The ratio H2:CO2 was determined using a Bruker 450GC equipped with a thermal conductivity detector (TCD) and a Varian CP81073 0.5x1/8” Ultimetal Hayesep Q 80- 100 mesh column in by-pass. The temperature of the injection, TCD chambers and the oven were maintained at 150 °C, 200 °C and 50 °C respectively. Nitrogen was used as the carrier gas at a flow rate of 25 ml min-1.
43 4.10.3 METHANE
The Methane production was measured through a gas chromatograph GC Varian Star 3400CX equipped with an injector split/splitness (ratio 1:40), a FID detector and a capillary column (Supelco SPB1000, 30 m x 0.32 mm x 0.25 µm).
Nitrogen (30 ml min-1) was used as carrier gas. The temperature for injector and detector was 220 °C and 60° C for the column. (Rojas, 2000)
4.10.4 ENDS FERMENTATION PRODUCTS
Sugars, VFA and other fermentation products were quantified by HPLC coupled with a refraction index detector (Varian Prostar 350 RID, Agilent, USA) using a sulfonated polystyrene resin in the protonated form (67H type) as the stationary phase (Varian Metacarb 67H 300mm) and sulfuric acid (0.25 mM in milliQ water) as the mobile phase at flow rate of 0.8 mL min-1. Column temperature was 65
°C. Identification of non-common metabolites (non-identified metabolites by the HPLC described above), was carried out by HPLC coupled to diode array detector (Varian DAD 330, Agilent, USA) and to a triple quadrupole ion trap mass spectrometry detector with positive and negative ESI and APcl ionization modes (Varian 1200L, Agilent, USA) using the same 67H column described above as stationary phase and formic acid 0.5 M as the mobile phase at 0.6 mL min-1. Column temperature was set at 65 ºC.
44
45
5.1 DARK FERMENTATION: ISOLATION AND CHARACTERIZATION OF HYDROGEN PRODUCING STRAINS FROM DIFFERENT SLUDGES
ABSTRACT
Ten hydrogen-producing strains belonging to Clostridium sp. were isolated from different sludge submitted to low vacuum to improve hydrogen production.
Optimization of hydrogenogenesis was mostly achieved at 35ºC and an initial pH of 6.5, which dropped to around 4 for all strains. C. roseum H5 and C. diolis RT2 had the highest yield (120 mL-H2 g-1 initial COD). Considering substrate consumption, C.
beijerinckii UAM and C. diolis RT2 reached 573 and 475 mL-H2 g-1 consumed COD.
Butyric acid fermentation was predominant, being butyrate and acetate the major by- products and propionate, ethanol and lactate secondary metabolites. The acetate:butyrate ratio and fermentation pathway varied depending on the strain and environmental conditions. Hydrogenogenesis was studied more in deep using C.
saccharobutylicum H1 as a representative strain. Interestingly, acetoacetate was detected as an intermediate metabolite in the butyric fermentation. Hydrogenogenesis was also analyzed by using an enrichment culture, behaving similarly to the pure cultures.
Keywords: Hydrogen; dark fermentation; Clostridium; process optimization;
fermentation pathways.