55
56 A PATHOGENICITY MECHANISM MODEL BY COMPARATIVE
GENOMICS OF NECROTIZING HEPATOPANCREATITIS BACTERIUM
Juan Manuel Leyva1, Teresa Gollas-Galván1, Jorge Hernández-López2, Francisco Vargas-Albores1, Marcel Martínez-Porchas1*
1Centro de Investigación en Alimentación y Desarrollo, A.C. PO Box 1735, Hermosillo, Sonora, México
2 Centro de Investigaciones Biológicas del Noroeste, Avenida Centenario # 53, Hermosillo, Sonora, México
Corresponding author:
Dra. Teresa Gollas-Galvan [email protected]
57 ABSTRACT
The bacterium of hepatopancreatitis necrotizing (NHP-B) is intracellular, therefore, its mechanism of pathogenicity is unknown. The genome sequence and comparative genomics allow genes related to the infection processes of this bacterium. Shrimp hepatopancreas with clear signs of NHP was used as an infectious inoculum. The disease reproduced and the causative agent was isolated to extract the genomic DNA, it was converted into a high-throughput sequence and assembled de novo, and by comparative genomics the genes were identified. We identified genes related to the flagellar system and pili type IV responsible for the motility of the bacteria, adhesins such as OmpA, pili type I. the secretion systems type I, type II, Type VI; and the presence of phospholipase, hemolyside, VapD. The identification of these genes in NHP-B extends the knowledge regarding the pathogenicity processes carried out by this bacterium, which can lead to strategies for the control of this.
Keywords: Secretion system; Virulence; intracellular bacteria; Next generation sequencing; genome.
58 1 INTRODUCTION
Bacterial and viral diseases have historically been a drag on the development of shrimp aquaculture. Epizootic events were usually associated to viral diseases; however bacterial pathogens have emerged during the last decade devastating entire shrimp aquaculture parks (Martinez-Porchas and Martinez-Cordova 2012).
Among the bacteria species affecting penaeid shrimp, intracellular pathogens such as the necrotizing hepatopancreatitis bacterium (or Candidatus Hepatobacter penaei) are considered among the most important and capable to cause mass mortalities if antibiotics are not used when detected (Martínez-Córdova et al. 2016).
This bacterium is characterized by being extremely aggressive with the host, particularly during the acute phase of the disease. Observable symptoms include anorexia, lethargy and erratic behavior, abdominal muscular atrophy, soft exoskeleton, gill darkening, cuticle lesions, pale and gelatinous hepatopancreas, melanization, erosion of appendages, expanded chromatophores, empty intestines, decreased growth rate and recurring mortalities (Briñez et al. 2003, Gollas‐Galván et al. 2014).
Several studies have provided information about the biological characteristics of the pathogen, however most of these are limited to simple observations through the microscope (Lightner et al. 1992, Gollas‐Galván et al. 2014), basically because there are currently not culture media for this intracellular bacterium and isolation methods do not provide enough bacterial biomass to perform other studies; however, it is possible to obtain DNA allowing to assemble its genome sequence, providing better insights into the biological characteristics (Leyva et al. 2017). This is perhaps the best approach so far to study these kinds of unculturable bacteria.
Some experiments to eradicate the Candidatus Hepatobacter penaei through the use of antibiotics have been successful; however, these have been made based on trial and error approaches (Reed et al. 2004, Martínez-Córdova et al. 2016). So knowing the mechanism of pathogenicity of this bacterium, represents core information not only to learn more about its life cycle, but would provide detailed information on each of the components of this mechanism which could be manipulated.
59 Comparative genomics allow to infer the metabolic pathways, infection mechanisms and several other functions of any organism by studying its genome sequence. Therefore, the aim of this study was to identify genes related to the pathogenicity mechanism of the etiological agent of necrotizing hepatopancreatitis disease in shrimp by genome analysis.
60 2 MATERIALS AND METHODS
2.1 Inoculum
The bacterium causing NHP (NHPB) was isolated from the hepatopancreas of infected white shrimp (Litopenaeus vannamei). These organisms were previously collected from a commercial shrimp farm located in Sonora, Mexico, and the infection was confirmed by using a PCR diagnosis protocol recommended by Nunan et al. (2008)(Nunan et al. 2008).
Thereafter, NHP-B positive hepatopancreas were homogenized using a FastPrep 5G apparatus (MP Biomedicals) and the homogenate was used as infective inoculum through the per os technique reported (Gracia-Valenzuela et al. 2011)
Apparently healthy shrimp weighing 10-13 g were maintained under the following laboratory conditions during 40 d: constant aeration (dissolved oxygen ≥ 5 mg·L-1), temperature 27 °C, salinity 35 practical salinity units (PSU), pH 7.6-7.8, water exchange rate 25%·day-1, feeding rate 4%·day-1. These shrimps were treated with oxytetracycline (3 mg kg-1 of shrimp biomass) during the first three acclimation days to eradicate possible pathogenic bacteria.
The absence of viral and bacterial pathogens as white spot syndrome virus, taura syndrome virus, infectious hypodermal and hematopoietic necrosis virus and NHP-B were confirmed by PCR assays, using commercial kits (IQ200™ and DiagXotics, Co). After disease-free confirmation, organisms were orally infected with 40 μL of above NHPB- positive homogenate, using a catheter. After 20 d, the hepatopancreas of each shrimp was removed and the presence of NHPB in the tissue was again confirmed by PCR.
2.2 PCR Detection
All NHPB-positive hepatopancreas from infected shrimp were homogenized (FastPrep 5G; MPBiomedicals, USA), and the DNA was extracted from the homogenate by
61 following the specifications of a commercial kit (FastDNA spin Kit for Soil, MP Biomedicals, USA). Thereafter PCR reactions were performed using the following primers reported for 16S ribosomal RNA gene (Accession number U65509):
NHPB_Fw:5′ CGTTGGAGGTTCGTCCTTCAGT 3′ and NHPB_Rv:5′
GCCATGAGGACCTGACATCATC 3′ (Nunan et al. 2008).
Reactions were performed using 7.5 uL SYBR Green Master Mix, 1 uL (10 ng ·L-1) Fw and Rv primers, 4.5 uL nuclease-free water and 1 uL gDNA (10 ng ·L-1), under the following thermal cycling conditions: 1 cycle at 95°C – 5 min, 35 cycles 94°C – 1 min, 60°C – 1 min, 72°C – 1 min, and one final extension cycle at 72°C – 5 min. Subsequently, 10 uL of the reaction were electrophoresed through 1.2 % agarose gels. PCR amplicons with the expected size (379 bp) were visualized using UV light, cut, and purified by performing the QIAquick PCR Purification Kit protocol (QIAGEN, 28104). Finally, the product was sequenced by Sanger at Centro de Investigaciones Sobre Enfermedades Infecciosas, as a service.
2.3 NHPB Isolation
After PCR confirmation, NHPB was isolated from the homogenates by performing a Percoll gradient technique, e.g. establishing a low viscosity and low osmolarity density gradient consisting of colloidal silica particles and water, to isolate bacterial cells. Briefly, a 1:1.5 percoll:homogenate mixture was centrifuged at 25,000 xg for 70 min at 4°C (Percoll®, Sigma-Aldrich, USA). Thereafter, a band formed in the interphase zone was separated and the gDNA was extracted with a commercial kit (FastDNA spin Kit for Soil, MP Biomedicals, USA) and confirmed as NHPB-positive by following the above PCR method.
62 2.4 DNA Sequencing and ORF´s Identification
The NHPB genome sequencing was performed by using the MiSeq platform (Illumina, CA, USA) with a 2 × 75-bp paired-end run after library preparation with the Nextera XT sample preparation kit (Illumina, USA). The de novo genome assembly was performed using the CLC Genomics Workbench 9.0.1 (QIAGEN Bioinformatics, Aarhus, Denmark).
Thereafter, prediction of open reading frames (ORF´s) and annotation were performed by the public server GeneMark (http://exon.gatech.edu/GeneMark/) (Besemer et al. 2001).
2.5 Genome Annotation
Genome annotations consisted of identifying open ORF´s by comparing with genes from other species by BLAST. To do this, the Blast2Go free access software (Götz et al. 2008).
2.6 Identification of Virulence Factors
Each ORF from the NHPB genome was used as the query in a FASTA protein search against the complete set of ORF from 10 fully annotated genomes of bacteria similar to NHPB obtained from the National Center for Biotechnology Information. The resulting top hit was aligned with the query over at least 80% of its length to >30% identity, it was used as the query in a search against the NHPB genome (Leyva et al. 2017).
63 3 RESULTS AND DISCUSSION
After sequencing, a total of 555,220 readings were obtained, with 40,817,214 bases sequenced and a Q score of 38, which turned out to be a base call accuracy of 99.47%.
The Q score is suggested for a de novo assembly is 30, therefore, the sequences with Q>
30 score were considered for the assembly. Contigs greater than 200 bases are considered according to the NCBI database, so 486,823 sequences were aligned with a total of 36,008,645 bases forming 171 contigs. The contigs sizes ranged from 201 to 165,091 bases, with an average length (N50) of 68,511 bases. The genome size was 1,194,510 bases in length with a GC content of 49.6%, a genome coverage of 30 X and Qscore = 38.
The readings obtained were mapped in different genomes in order to rule out the possible contamination; the parameters for local mapping were established at a minimum percentage of similarity of 80%. For example, 0.85%, 0.67% and 0.63% of the total nucleotide bases sequenced, corresponding to Vibrio parahaemolyticus, Rickettsia prowazekii and Wolbachia endosymbiont of Drosophila melanogaster, respectively;
while 83.07% of the total bases sequenced were similar to those of Candidatus Hepatobacter penaei.
Although NHP-B is a gram-negative, intracellular and rickettsial bacteria, as described by several authors since its first reports in America. (Krol et al. 1991, Frelier et al. 1992, Lightner et al. 1992, Lightner 1996) , its GC content does not correspond to that of other Rickettsial bacteria (Fournier et al. 2009).
In general, the content of GC in the bacterial genome varies from 13% to 75%, and has been described as a molecular factor in the theory of evolution (Muto and Osawa 1987).
Different studies have evaluated the change in GC content in the genome of different bacterial species over generations, and describe a change in GC content from about 1x10-
8 to 1x10-11 per base per generation (Wang et al. 1998, Moran et al. 2008, Swan et al.
2013). These variations in the GC content in the genome from one species to another have been described by the type of environment in which the intracellular or extracellular bacteria develop, the type of endosymbiosis with the host mainly(Silva et al. 2007). The intracellular bacteria are characterized by having a low GC content, however, this can be
64 mutated by different extrinsic factors increasing their GC content (Agashe and Shankar 2014), for example, temperature, salinity, nutrient limitation, aerobiosis, etc.
Twenty-two genes of the flagellar system were found (Table 1), mainly those corresponding to the internal structure of the flagellum. With this, the presence of a flagellum as described for this bacterium during a stage of its development is evidenced.
Leyva et al. (2017), carried out a search for flagellar system genes in the genome reported for Candidatus Hepatobacter penaei, twelve flagellar system genes were reported, however, they were described as the basis for the flagella assembly (Leyva et al. 2017).
As described in previous studies, the flagellum is responsible for motility, favoring the movement of bacteria in the intercellular environment of the host organism until adhesion with the host cell(Uchiyama 2012, Duan et al. 2013, Wang and Wu 2014).
The type I and type IV pili genes were identified. Both types of pili are related to the adhesion of the host cell. The pili type 1 is related to the adhesion and the formation of the accessory (Pratt and Kolter 1998, Schilling et al. 2001). On the other hand, pili type IV is related to a type of motility called twichinwg, which occurs in the adhesion to the solid surface and especially in the biofilm formation (Pratt and Kolter 1998). Likewise, pili type IV have also described functions such as adherence, motility, microcolonial formation and secretion of proteases and colonization factors (Craig and Li 2008).
Genes related to different secretion systems were found, such as type I (TISS), type II (TIISS), type VI (TVISS), and the Sec-type translocon. For the TISS the TolC gene was found, responsible for the production of a protein that forms a pore in the outer membrane (Costa et al. 2015) and the HlyD gene, which codes for a Hemolysin D protein, which has the function of forming a barrel in the periplasmic space connecting with TolC. This allows the passage of other virulence factors such as toxins, proteases, and lipases (Costa et al. 2015). These identified TISS genes correspond to bacteria of phylogenetically close genera such as Wolbachia, Rickettsia, Anaplasma, Ehrlichia, among others, compared to the KEGG database. (http://www.genome.jp/kegg/pathway.html). On the other hand, genes related to the type II secretion system (TIISS) GspD, GspE, GspF were also identified. These genes identified in the TIISS correspond with those identified for the TIISS of Chlamydia spp. reported in the KEGG database. The genes identified correspond to proteins that form a pore in the outer membrane, for the case of the GspD gene. And
65 GspE and GspF are found in the intermembrane space forming a structure that allows the secretion of proteins from the intermembrane space to the extracellular medium(Costa et al. 2015). For this, it is necessary a previous step in which the proteins are translocated from the cytosol to the intermembrane space by means of the translocon Sec located in the inner membrane (Gillespie et al. 2014). In this study the genes corresponding to the translocon were found as SecA, SecB, SecD, SecF, SecY, SecG, YajC, YidD, FtsY. The presence of these genes corresponds to the genes identified in bacteria similar to this one such as Wolbachia, Rickettsia, Anaplasma, Ehrlichia, Chlamydia.
Genes del sistema de secreción tipo VI (TVISS) fueron identificados, EvpB, ImpK, protein, other protein, establecieron identidad con el SSTVI. Este sistema de secreción tiene un rol muy importante en la invasión al permitir la interacción con la célula hospedera (Costa et al. 2015). Su principal función consiste en la secreción de efectores que permitan el cambio en la expresión génica del hospedero, favoreciendo la fagocitosis de la bacteria (Ho et al. 2014, Hachani et al. 2016). El TVISS
Hemolysin C is responsible for forming pores in the membrane damaging the membrane and causing the content to escape (Zipfel et al. 2007, Uchiyama 2012). In this case, hemolysin is secreted inside the phagosome, which is damaged and causes an arupture allowing NHP-B to escape and avoid being degraded by the lysosome that binds to the phagosome. This similar function is also caused by phospholipase, which together with hemolysin are responsible for that damage to the phagosome membrane.
66 4 REFERENCES
Agashe, D. and Shankar, N. (2014). The Evolution of Bacterial DNA Base Composition.
Journal of Experimental Zoology Part B: Molecular and Developmental Evolution 322.(7), 517-528.
Besemer, J., Lomsadze, A. and Borodovsky, M. (2001). Genemarks: A Self-Training Method for Prediction of Gene Starts in Microbial Genomes. Implications for Finding Sequence Motifs in Regulatory Regions. Nucleic acids research 29.(12), 2607-2618.
Briñez, B., Aranguren, F. and Salazar, M. (2003). Fecal Samples as DNA Source for the Diagnosis of Necrotizing Hepatopancreatitis (Nhp) in Penaeus Vannamei Broodstock. Diseases of Aquatic Organisms 55.(1), 69-72.
Costa, T. R., Felisberto-Rodrigues, C., Meir, A., Prevost, M. S., Redzej, A., Trokter, M.
and Waksman, G. (2015). Secretion Systems in Gram-Negative Bacteria:
Structural and Mechanistic Insights. Nature Reviews Microbiology 13.(6), 343- 359.
Craig, L. and Li, J. (2008). Type Iv Pili: Paradoxes in Form and Function. Current opinion in structural biology 18.(2), 267-277.
Duan, Q., Zhou, M., Zhu, L. and Zhu, G. (2013). Flagella and Bacterial Pathogenicity.
Journal of Basic Microbiology 53.(1), 1-8.
Fournier, P.-E., El Karkouri, K., Leroy, Q., Robert, C., Giumelli, B., Renesto, P., Socolovschi, C., Parola, P., Audic, S. and Raoult, D. (2009). Analysis of the Rickettsia Africae Genome Reveals That Virulence Acquisition in Rickettsia Species May Be Explained by Genome Reduction. BMC genomics 10.(1), 166.
Frelier, P., Sis, R., Bell, T. and Lewis, D. (1992). Microscopic and Ultrastructural Studies of Necrotizing Hepatopancreatitis in Pacific White Shrimp (Penaeus Vannamei) Cultured in Texas. Veterinary Pathology 29.(4), 269-277.
Gillespie, J. J., Kaur, S. J., Rahman, M. S., Rennoll-Bankert, K., Sears, K. T., Beier- Sexton, M. and Azad, A. F. (2014). Secretome of Obligate Intracellular Rickettsia.
FEMS microbiology reviews 39.(1), 47-80.
Gollas‐Galván, T., Avila‐Villa, L. A., Martínez‐Porchas, M. and Hernandez‐Lopez, J.
(2014). Rickettsia‐Like Organisms from Cultured Aquatic Organisms, with Emphasis on Necrotizing Hepatopancreatitis Bacterium Affecting Penaeid Shrimp: An Overview on an Emergent Concern. Reviews in Aquaculture 6.(4), 256-269.
Götz, S., García-Gómez, J. M., Terol, J., Williams, T. D., Nagaraj, S. H., Nueda, M. J., Robles, M., Talón, M., Dopazo, J. and Conesa, A. (2008). High-Throughput Functional Annotation and Data Mining with the Blast2go Suite. Nucleic acids research 36.(10), 3420-3435.
67 Gracia-Valenzuela, M. H., Ávila-Villa, L. A., Yepiz-Plascencia, G., Hernández-López, J., Mendoza-Cano, F., García-Sanchez, G. and Gollas-Galván, T. (2011). Assessing the Viability of Necrotizing Hepatopancreatitis Bacterium (Nhpb) Stored at− 20°
C for Use in Forced-Feeding Infection of Penaeus (Litopenaeus) Vannamei.
Aquaculture 311.(1-4), 105-109.
Hachani, A., Wood, T. E. and Filloux, A. (2016). Type Vi Secretion and Anti-Host Effectors. Current opinion in microbiology 29. 81-93.
Ho, B. T., Dong, T. G. and Mekalanos, J. J. (2014). A View to a Kill: The Bacterial Type Vi Secretion System. Cell host & microbe 15.(1), 9-21.
Krol, R. M., Hawkins, W. E. and Overstreet, R. M. (1991). Rickettsial and Mollicute Infections in Hepatopancreatic Cells of Cultured Pacific White Shrimp (Penaeus Vannamei). Journal of invertebrate pathology 57.(3), 362-370.
Leyva, J. M., Martinez-Porchas, M., Vargas-Albores, F., Hernandez-Lopez, J. and Gollas- Galvan, T. (2017). Bioinformatic Analysis of the Flagellar System of the Rickettsia-Like Alphaproteobacteria Candidatus Hepatobacter Penaei. REVISTA DE BIOLOGIA MARINA Y OCEANOGRAFIA 52.(1), 121-130.
Lightner, D., Redman, R. and Bonami, J. (1992). Morphological Evidence for a Single Bacterial Etiology in Texas Necrotizing Hepatopancreatitis in Penaeus Vannamei (Crustacea: Decapoda). Diseases of Aquatic Organisms 13.(3), 235-239.
Lightner, D. V. (1996). A Handbook of Shrimp Pathology and Diagnostic Procedures for Diseases of Cultured Penaeid Shrimp.
Martínez-Córdova, L. R., Gollas-Galván, T., Garibay-Valdez, E., Valenzuela-Gutiérrez, R., Martínez-Porchas, M., Porchas-Cornejo, M. A., Sánchez-Paz, A. and Mendoza-Cano, F. (2016). Physiological and Immune Response of Litopenaeus Vannamei Undergoing the Acute Phase of the Necrotizing Hepatopancreatitis Disease and after Being Treated with Oxytetracycline and Ff. Latin American Journal of Aquatic Research 44.(3), 535-545.
Martinez-Porchas, M. and Martinez-Cordova, L. R. (2012). World Aquaculture:
Environmental Impacts and Troubleshooting Alternatives. The Scientific World Journal 2012. Article ID 389623.
Moran, N. A., McCutcheon, J. P. and Nakabachi, A. (2008). Genomics and Evolution of Heritable Bacterial Symbionts. Annual review of genetics 42. 165-190.
Muto, A. and Osawa, S. (1987). The Guanine and Cytosine Content of Genomic DNA and Bacterial Evolution. Proceedings of the National Academy of Sciences 84.(1), 166-169.
Nunan, L. M., Pantoja, C. and Lightner, D. V. (2008). Improvement of a Pcr Method for the Detection of Necrotizing Hepatopancreatitis in Shrimp. Diseases of aquatic organisms 80.(1), 69-73.
Pratt, L. A. and Kolter, R. (1998). Genetic Analysis of Escherichia Coli Biofilm Formation: Roles of Flagella, Motility, Chemotaxis and Type I Pili. Molecular microbiology 30.(2), 285-293.
68 Reed, L. A., Siewicki, T. C. and Shah, J. C. (2004). Pharmacokinetics of Oxytetracycline
in the White Shrimp, Litopenaeus Setiferus. Aquaculture 232.(1), 11-28.
Schilling, J. D., Mulvey, M. A. and Hultgren, S. J. (2001). Structure and Function of Escherichia Coli Type 1 Pili: New Insight into the Pathogenesis of Urinary Tract Infections. The Journal of infectious diseases 183.(Supplement_1), S36-S40.
Silva, F. J., Latorre, A., Gómez-Valero, L. and Moya, A. (2007). Genomic Changes in Bacteria: From Free-Living to Endosymbiotic Life. Structural approaches to sequence evolution, 149-165.
Swan, B. K., Tupper, B., Sczyrba, A., Lauro, F. M., Martinez-Garcia, M., González, J.
M., Luo, H., Wright, J. J., Landry, Z. C. and Hanson, N. W. (2013). Prevalent Genome Streamlining and Latitudinal Divergence of Planktonic Bacteria in the Surface Ocean. Proceedings of the National Academy of Sciences 110.(28), 11463-11468.
Uchiyama, T. (2012). Tropism and Pathogenicity of Rickettsiae. Frontiers in microbiology 3.
Wang, D., Kreutzer, D. A. and Essigmann, J. M. (1998). Mutagenicity and Repair of Oxidative DNA Damage: Insights from Studies Using Defined Lesions. Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis 400.(1), 99- 115.
Wang, Z. and Wu, M. (2014). Phylogenomic Reconstruction Indicates Mitochondrial Ancestor Was an Energy Parasite. PLoS One 9.(10), e110685.
Zipfel, P. F., Würzner, R. and Skerka, C. (2007). Complement Evasion of Pathogens:
Common Strategies Are Shared by Diverse Organisms. Molecular immunology 44.(16), 3850-3857.
69 Table 1. Genes related to the pathogenicity of NHP-B.
Genes Length
(bases)
Blast results
Hits E-value Sim (%) Flagellar system
L-ring protein FlgH 735 10 0 67.4
M-ring protein FliF 1602 10 0 67.9
Basal-body protein FliL 459 10 4.05E-105 66.8
Basal-body rod protein FlgF 735 10 0 54.1
Basal-body rod protein FlgC 432 10 6.52E-103 60.4
Basal-body rod protein FlgG 813 10 6.71E-176 55.1
Biosynthesis protein FlhB 1089 10 0 61
Biosynthesis protein FliR 741 10 2.17E-159 57
Biosynthesis protein FliQ 279 10 4.64E-46 77.5
Biosynthesis protein FlgA 1293 10 0 76
Biosynthesis protein FlhA 2088 10 0 71.3
Biosynthesis protein FliP 750 10 1.49E-126 80.5
Protein export ATPase FliI 1338 10 0 74.7
Biosynthesis protein FlgE 1728 5 0 54.6
Hook protein FlgK 1896 10 0 48.6
Hook-length control protein FliK 951 1 0 99
Motor protein Mot A 843 10 0 53.5
Motor protein Mot A 858 10 0 74.9
Motor rotation protein Mot B 882 10 0 63.5
Motor switch protein FliM 1035 10 0 54.6
Motor switch protein FliG 1023 10 0 66.4
Motor switch protein FliN 390 10 6.6E-74 71
TISS
TolC 1401 10 0 53.8
HlyD 336 7 1.98E-14 72.43
TIISS
GspD 1599 10 0 60.7
GspE 1674 10 0 60.8
GspF 1098 10 0 49.8
TVISS
EvpB 2037 10 0 60.6
ImpK 852 10 0 56.5
Protein release 1341 10 0 53.5
Other protein release 282 10 3.22E-19 64.3
Sec-translocase
SecA 2649 10 0 75.7
SecE 201 10 1.14E-30 77
SecD 1581 10 0 70.5
SecF 927 10 0 68.2
SecG 378 1 2.57E-67 100
SecY 1332 10 0 81