AUTHOR COPY
Five gonadotrophin-releasing hormone receptors in a teleost fish: isolation, tissue distribution and phylogenetic
relationships
Natalia Moncaut, Gustavo Somoza1, Deborah M PowerandAdelino V M Canário
Centre of Marine Sciences, University of Algarve, Campus de Gambelas, 8005-139 Faro, Portugal
1Laboratorio de Ictiofisiologia y Acuicultura, Instituto de Investigaciones Biotecnologicas-Instituto Tecnologico de Chascomus (IIB-INTECH), Camino de Circunvalacion Laguna Km 6 (B7130IWA), Chascomus, Provincia de Buenos Aires, Argentina.
(Requests for offprints should be addressed to A V M Canário; Email: [email protected] )
Abstract
Gonadotrophin-releasing hormone (GnRH) is the main neurohormone controlling gonadotrophin release in all vertebrates, and in teleost fish also of growth hormone and possibly of other adenohypophyseal hormones. Over 20 GnRHs have been identified in vertebrates and protochoordates and shown to bind cognate G-protein couple receptors (GnRHR). We have searched the puffer fish,Fugu rubripes, genome sequencing database, identified five GnRHR genes and proceeded to isolate the corresponding complementary DNAs in European sea bass,Dicentrachus labrax. Phylogenetic analysis clusters the European sea bass, puffer fish and all other vertebrate receptors into two main lineages corresponding to the mammalian type I and II receptors. The fish receptors could be subdivided in two GnRHR1 (A and B) and three GnRHR2 (A, B and C) subtypes. Amino acid sequence identity within receptor subtypes varies between 70 and 90% but only 50–55% among the two main lineages in fish. All European sea bass receptor mRNAs are expressed in the anterior and mid brain, and all but one are expressed in the pituitary gland. There is differential expression of the receptors in peripheral tissues related to reproduction (gonads), chemical senses (eye and olfactory epithelium) and osmoregulation (kidney and gill). This is the first report showing five GnRH receptors in a vertebrate species and the gene expression patterns support the concept that GnRH and GnRHRs play highly diverse functional roles in the regulation of cellular functions, besides the ‘‘classical’’ role of pituitary function regulation.
Journal of Molecular Endocrinology(2005)34,767–779
Introduction
Gonadotrophin-releasing hormone (GnRH) is a deca- peptide synthesized in the preoptic-hypothalamic area and acts on the pituitary gland where it stimulates the synthesis and release of gonadotrophic hormones in all vertebrates (Millaret al.2004), and growth hormone and prolactin in at least some fish species (Marchant et al.
1989, Weber et al. 1997). In addition to the preoptic- hypothalamic GnRH, one or two additional GnRH forms are synthesized in extra preoptic-hypothalamic areas within the central nervous system (Lethimonier et al. 2004, Millar et al. 2004). The number of known GnRH family members has now reached a total of 24, usually named after the species where they were first isolated (Adams et al.2003, Millar et al. 2004, Somoza et al.2002).
GnRHs exert their actions through GnRH receptors (GnRHRs) which are members of the rhodopsin-like G-protein coupled receptor (GPCR) family. These receptors show three main functional domains: 1) a N-terminal extracellular domain; 2) seven -helical transmembrane (TMs) domains connected by hydro-
philic intra- and extracellular loops and 3) a C-terminal cytoplasmic domain. The extracellular domains and superficial regions of the TMs are usually involved in binding. The TMs are believed to be involved in receptor configuration. The C-terminal mediates effec- tors binding, propagation of signalling events, desensi- tization and internalization (McArdleet al., 2002, Millar et al., 2004). During the last decade several cDNAs for GnRHR have been cloned, often more than one in the same species, e.g. three in bullfrog,Rana catesbiana(Wang et al.2001) and medaka,Oryzias latipes(Okuboet al.2001, 2003) and two in primates (Millaret al.2001, Neillet al.
2001), goldfish, Carassius auratus (Illing et al. 1999) and African catfish, Claria gariepinus (Bogerd et al. 2002). As a result GnRH receptors have recently been grouped in three main subtypes designated GnRHR1, GnRHR2 and GnRHR3, the latter only found in teleost fishes and amphibians (Millar et al.2004). In addition, duplicated genes within these subtypes have been also described in teleosts, e.g. Oncorhynchus masou (Jodo et al. 2003).
The presence of multiple GnRH ligands for several receptors suggests complex regulatory mechanisms and raises the question of whether new functions, more
767
Journal of Molecular Endocrinology(2005)34,767–779 DOI: 10.1677/jme.1.01757
AUTHOR COPY
specialization, or both, have been acquired by the duplicated genes.
Data mining of model fish genome sequences has facilitated the identification of novel genes and in this paper we have used the GnRHRs DNA sequences identified in theFugu rubripes genome database to isolate the corresponding cDNAs in the European sea bass, Dicentrarchus labrax. Like most perciform species, the European sea bass synthesizes three GnRH ligands:
sGnRH, sbGnRH and cGnRHII (González-Martínez et al. 2001, 2002, Zmora et al., 2002). However, until now only a single GnRHR cDNA from European sea bass has been cloned and its expression profile in the brain and pituitary suggests it may mediate gonado- trophin release (González-Martínez et al. 2004). In the current study we report the cloning of four addi- tional European sea bass cDNAs encoding GnRHRs (dlGnRHR), examine their tissue distribution and reassess their classification based on the phylogenetic analysis of available sequences.
Materials and methods
Animals and tissue sampling
Sexually mature males and females from European sea bass were obtained from TIMAR Cultura de Águas (Livramento, Portugal) and maintained at the Ramalhete Experimental Station (University of Algarve, Faro, Portugal) prior to sampling, in through-flow seawater tanks at 17 2C under natural photoperiod.
Animal care was in accordance with the ethical guidelines of the Animal Behaviour Society (ASAB 2003) and national legislation. Fish were killed with an overdose of 2-phenoxyethanol (1:10000, Sigma–Aldrich, Madrid, Spain), tissues were dissected and immediately frozen in liquid nitrogen and stored at -80C until used.
In silicoanalysis and cloning of dlGnRHRs
The puffer fish (Fugu rubripes)Fugu Consortium Genome Database (http://fugu.hgmp.mrc.ac.uk) was interro- gated with the amino acid sequences of available fish GnRH receptors via the tBLASTn programme using the Blosum62 matrix and an expected value of 10 (Altschul et al. 1997). Scaffolds identified to contain GnRHR sequences were run on the HGMP Nix interface (G Williams, P Woollard & P Hingamp, unpublished data;
http://www.hgmp.mrc.ac.uk/NIX/) providing, as out- put, putative gene organization, coding sequence, amino acid translation and neighbouring genes. Five different loci were found with putative open reading frames (ORFs) for GnRHR located in scaffolds FS2243, FS553, FS686, FS3910 and FS1435. The putative coding sequences of Fugu genes together with other available fish sequences were used to design five primer pairs to
amplify the corresponding cDNAs in European sea bass (Table 1) and the amino acid translations were used in the phylogenetic analysis.
Total RNA was extracted from brain and pituitary of European sea bass using TRI Reagent (Sigma-Aldrich) according to the manufacturer’s protocol. Five micro- grams of total RNA was retro transcribed using Moloney murine leukaemia virus (MMLV-RT; Invitrogen, Carlsbad, CA, USA) and oligo(dT)12–18in a final volume of 30 µl for 1·5 h at 37C. Each PCR was carried out using 1–2µl cDNA, 2·5 U Taq polymerase (Promega, Biocontech, Lisbon, Portugal) and 1 pmol/µl of each different pair of primers. Thermocycling parameters were the same for all primer pairs, except for the annealing temperatures: 4 min at 94C, 35 cycles of 1 min at 94C, 1 min 50–56C and 1 min at 72C, with 5 min extension at 72C. PCR products were visualized in 1% agarose gel stained with ethidium bromide and bands of expected size purified using GFX PCR and Gel Band Purification Kit (Amersham Biosciences, Buckinghamshire, UK) and cloned using the pGEM-T easy Vector Systems (Promega). The cloned inserts were used to transformE. coli XL1-Blue and positive colonies were isolated and plasmid DNA extracted using the alkaline lyses method and sequenced (Sistemas Genómicos, Valencia, Spain; Macrogen, Seoul, South Korea).
Construction and screening of cDNA libraries cDNA libraries from European sea bass brain (pituitary included) and testis were constructed using UNI-ZAP XR Vector (Strategene, Amsterdam, The Netherlands) with reverse-transcribed cDNA obtained from 4–5 µg of poly(A)+ RNA and using UNI-ZAP XR cDNA synthesis kit (Stratagene) according to the supplier’s instructions. Library screening was carried out under high stringency conditions using the five specific dlGnRHR probes obtained by PCR amplification.
Duplicate membranes (Hybond NX- Amersham Bio- sciences, Buckinghamshire, UK) were hybridized with each of the [32P]dCTP-labelled dlGnRHR probes (Rediprime Random Labelling kit, Amersham Bio- sciences) overnight at 56C in a solution containing EDTA 1 mM, SDS 7% and sodium phosphate 0·25 M (Church–Gilbert hybridization solution; Church &
Gilbert 1984). Stringency washes were carried out at 56C for 5 minutes with 2SSC, 1SSC (150 mM NaCl, 15 mM sodium citrate, pH 7·0) and 0·1SSC containing 0·1% SDS.
Tissue distribution of GnRHRs by RT-PCR and Southern blotting
The distribution pattern of dlGnRHRs expression was investigated by RT-PCR on anterior brain (olfactory
N MONCAUTand others · Novel fish GnRH receptors 768
AUTHOR COPY
Table1PrimerpairsusedforinitialPCRcloningofdlGnRHRsandforRT-PCR InitialcloningProduct sizeRT-PCRProduct size Gene dlGnRHR-1AdlgnrhR-F:58CGTGATGCCTGTGGATGC38342dlgnrhR-F342 dlgnrhR-R:58TTGTAGGCCGTTTC(G/C)T(G/C)CCA38dlgnrhR-R dlGnRHR-1B1gnrhF2:58CCGCTGGCAGGAAACTGT381821gnrhF2182 1gnrhR2:58TCCGAGCCTTTGGGATGA381gnrhR2 dlGnRHR-2AdlgnrhR-F:58CGTGATGCCTGTGGATGCC38411dlgnrhR-F586 dlgnrhR-R:58TTGTAGGCCGTTTC(G/C)T(G/C)CCA383gnrhR-R:58CCACAGTCCCAGCAGGTAG38 dlGnRHR-2B4gnrhR-F2:58CCCGAGAACTTCACCCAG384064gnrhR-F2490 3gnrhR-R:58CCACAGTCCCAGCAGGTAG38sqR1Brev:58TCTAATTCAGTCCGCGTGTTTG38 dlGnRHR-2C2gnrhR-F:58TCACGGTACAGTGGTTGGC38353R1Csqfw3:58GCTGTGCTGTGGGCAGCCAATG38587 2gnrhR-R:58TGAGCGGCAGAAGGAAGAG38R1Csqrev:58TTGAGCAACGGAGATGTAG38
Novel fish GnRH receptors · N MONCAUTand others 769
AUTHOR COPY
bulb and telencephalon), middle brain (optic tectum and diencephalons), posterior brain (cerebellum, medulla oblongata and part of the spinal cord), pituitary gland, eye, olfactory epithelium, gonads, kidney, head kidney, spleen, liver, heart, midgut, gills and muscle. cDNA (40 µl) was prepared from 5 µg total RNA extracted with TRI Reagent and reverse transcribed with MMLV-RT and random hexamers. PCR was performed on 1 µl of cDNA with specific primers (Table 1) designed to span two exon–intron boundaries. Only single RTP-PCR products of the size of the expected cDNA were obtained, indicating the absence of genomic DNA contamination. Thermocycling conditions were opti- mized for each primer to be on the linear region of amplification and were 4 min at 94C, 27–30 cycles of 45 sec at 94C, 45 sec at 56–59C and 45 sec extension at 72C, with a final 5 min extension at 72C. A 540 bp fragment of European sea bass 18S was amplified using oligonucleotides 18S-fw 5 TCA AGA ACG AAA GTC GGA GG 3 and 18S-rev 5 GGA CAT CTA AGG GCA TCA CA 3 (3 min at 94C, 16 cycles of 45 sec at 94C, 45 sec at 48C and 45 sec at 72C, followed by 5 min extension at 72C) and used as an internal control for the amount of cDNA per reaction. Each PCR product was transferred onto a nylon membrane (Hybond N; Amersham Biosciences) and hybridized overnight at 64C with Church–Gilbert hybridization solution with the corresponding probe labelled with [32P]dCTP by random priming (RediPrime Random Labelling kit, Amersham Biosciences). Stringency washes were carried out at 64C with 2SSC, 1SSC and 0·1SSC containing 0·1% SDS.
Sequence comparison and phylogenetic analysis The following sequences with accession numbers and abbreviations were used: buffalo, Bubalus bubalis (Bb, CAF21711), cow,Bos taurus, (Bt, NP803480), sheep,Ovis aries (Oa, CAA50978), human, Homo sapiens (R1, AAA35917; R2, Q96P88), Rhesus macaque, Macaca mulata (Mm2, AAK52745), Bonnet macaque, Macaca radiata (Mr, AAG43378), green monkey, Aethiops sabeus (As, AAK52746), marmoset, Callitrix jacchus (CjII, AAK60927), horse, Equus caballus (Ec, O18821), dog, Canis canis (Cc, Q9 MZI6), Norwegian rat, Rattus norvegicus (Rn, NP112300), mouse, Mus musculus (Mm, Q01776), Guinea pig, Cavia porcellus (Cp, Q8CH60), Chicken, Gallus gallus (Gg, NP989984), leopard gecko, Eublepharis macularius (Em, BAD11150), bullfrog, Rana catesbeiana (RcI AAG42575, RcII AAG42949, RcIII AAG42574), frog, Rana ridibunda (Rr1 AAP15162, Rr2 AAP15163, Rr3 AAP15164), brown frog,Rana dybowskii (Rd1 AAO50198, Rd2 AAO50196, Rd3 AAO50197), African clawed frog, Xenopus laevis, (Xl1 AAF89754, Xl2 AAK49334), rubber eel, Typhlonectes natans (Tn, AAD49750), stripped bass, Morone saxatilis (Ms,
AAF28464), amberjack,Seriola dumerilii(Sd, CAB65407), sea bream, Sparus auratus (Sa, AAS97968), Nile tilapia, Oreochromis niloticus (On1 BAC77241, On2 BAC77240, On3 BAD27389), medaka, Oryzias latipes (Ol1 BAB70506, Ol2 BAB70505, Ol3 BAC97833), African catfish, Clarias gariepinus (Cg1, BAC97836, Cg2, AAM95605), goldfish, Carassius auratus (CaA, AAD20001, CaB AAD20002), masou salmon,Oncorhyn- chus masou (Oma1, BAC98943, Oma4, BAC98946), rainbow trout, Oncorhynchus mykiss (Om, CAB93351), Japanese eel,Anguilla japonica(Aj, BAB11961).
Multisequence alignments of the full-length proteins were carried out using CLUSTAL X (Thompsonet al.
1997). Protein sequence similarities between different forms of GnRHR and between species were calculated with GeneDoc (Nicholaset al.1997) and protein motifs were identified using the Prosite database (Falquetet al.
2002). The putative transmembrane domains (TMs) were determined with TMHMM 2·0 (Kroghet al.2001).
Phylogenetic data analysis was restricted to TMs which were extracted from all identified genes (TMs 1, 2, 3, 4, 5, 6 and 7) and aligned with Clustal X. Parsimonious consensus trees of the TMs of all available GnRHR were generated using PAUP software (version 4·0, Swofford 2002) with the output of Clustal X alignments. Bootstrap values were calculated with 1000 replicates to estimate the robustness of internal branches.
Results
Molecular cloning of dlGnRHRs
Five different loci with putative open reading frames (ORFs) for GnRHR were identified in scaffolds FS2243, FS553, FS686, FS3910 and FS1435 of the sequenced genome of the tetraodontiformFugu rubripes. Analysis of the putative GnRHR gene structure of FS2243 and FS553 showed that their coding regions encompassed four exons and three introns while for FS686, FS3910 and FS1435 there were three exons and two introns (Table 2).
RT-PCR using specific primers for each of the five GnRH identified inFuguand the brain and pituitary of European sea bass led to the amplification of five different cDNAs showing high sequence homology to the corresponding Fugu GnRHR sequences (Table 3). The amplified GnRHRs have been classified as dlGnRHR- 1A, -1B, -2A, -2B and -2C on the basis of phylogenetic analysis (see below). The partial fragments of dlGnRHR isolated by RT-PCR were used as probes to screen brain-pituitary and testis cDNA libraries in order to isolate the full length receptors. Screening of 4105 pituitary plus brain phages with the dlGnRHR-2B probe led to the isolation of clone 3·1·2–1 corresponding to dlGnRHR-2A (accession number AJ419594 already characterized, see González-Martínezet al.2004). From
N MONCAUTand others · Novel fish GnRH receptors 770
AUTHOR COPY
a similar number of phages, but with the dlGnRHR-1A probe clone 4·1·2–5 similar to dlGnRHR-1A (accession number AJ606683) was isolated. It has a 5 untranslated region (UTR) of 264 bp, an ORF of 1155 bp and a 3 -UTR of 1788 bp, including a poly(A)+ tail. The deduced amino acid sequence for dlGnRHR-1A was 384 amino acids (aa). From screening 4105phages of the testis library with the dlGnRHR-2C probe two
positive clones were isolated. Screening a similar number of phages from a testis library with the dlGnRHR-2C probe yielded two positive clones. Clone 5·7·1–1, is similar to dlGnRHR-2B (AJ606686), it is 1240 bp long and by analogy to the (orthologous) Fugu and medaka sequences, this cDNA clone is presumed to be truncated lacking the 5 UTR. The ORF is 1185 bp long coding for a 394 aa protein and the 3 -UTR is
Table 2Number of exons and introns corresponding to the coding region of GnRH type I and type II receptors. Within parenthesis are indicated the number of introns or exons for those genes with an extra intron/exon in the 58UTR. For species abbreviations and accession numbers see Materials and methods
Species No. of exons No. of introns Reference
GnRHR Type 1 Aj 3 2 (Okuboet al.2000)
O12 4 3 (Okuboet al.2000)
Om 3 (4) 2 (3) (Madigouet al.(2002)
FS553 (Fugu1A) 4 3 This study
FS2243 (Fugu1B) 4 3 This study
X11 3 (4) 2 (3) (Troskieet al.2000)
Gg 3 2 (Sunet al.2001)
Em 4 (5) 3 (4) (Ikemotoet al.2004)
Oa 3 2 (Campionet al.1996)
Human 1 3 2 (Kakar 1997)
GnRHR Type 2 O11 3 2 (Okuboet al.2001)
O13 3 (4) 2 (3) (Okubuet al.2003)
FS686 (Fugu2A) 3 2 This study
FS3910 (Fugu2B) 3 2 This study
FS1435 (Fugu2C) 3 2 This study
Mm2 3 2 (Neillet al.2001)
As 3 2 (Neillet al.2001)
Human 2 3 2 (Neillet al.2001)
Table 3Amino acid sequence identity (%) between dlGnRHRs, puffer fish (FS) and other vertebrate GnRHRs. dlGnRHRs were cloned from brain-pituitary and testis cDNA libraries of European sea bass. In the analysis only the segment encompassing the transmembrane domains was included. For species abbreviations and accession numbers see Materials and methods
Sequence identity(%)
dlGnRHR-2A 53 − − −
dlGnRHR-2B 51 77 − −
dlGnRHR-2C 49 82 76 −
FS553 (Fugu1A) 86 52 51 49
FS2243 (Fugu1B) 73 52 49 49
FS686 (Fugu2A) 52 87 76 77
FS3910 (Fugu2B) 51 79 97 74
FS1435 (Fugu2C) 51 84 76 85
O11 51 82 77 86
O12 74 51 49 48
O13 51 76 94 73
CaA 77 53 50 49
CaB 82 52 51 48
RcI 51 73 74 69
RcII 61 53 52 49
RcIII 53 65 65 62
HumanI 41 44 40 41
HumanII 38 44 42 43
Sea bass GnRHRs dlGnRHR-1A dlGnRHR-2A dlGnRHR-2B dlGnRHR-2C
Novel fish GnRH receptors · N MONCAUTand others 771
AUTHOR COPY
55 bp. Clone 3·2·1–1 (dlGnRHR-2C) is 2677 bp long with a 282 bp 5 -UTR and an 1138 bp 3 -UTR, and with a translated protein of 418 amino acids. Until now, only a partial fragment of dlGnRHR-1B (AJ606685) has been cloned (Fig. 1). Hybridization of sea bass genomic DNA in a Southern blot using probes specific for each receptor form resulted in a characteristic pattern of bands, thus confirming that they are encoded by different genes.
Comparison of the different dlGnRHRs and other vertebrates/teleost
A multisequence alignment of the amino acid sequences of dlGnRHRs with that of other vertebrates revealed the presence of conserved features of the class A, rhodopsin- like family of G-protein coupled receptor superfamily, namely the seven transmembrane domains and the N- and C-terminal regions (Fig. 1). Amino acid sequence identity among the dlGnRHRs, including the trans- membrane domains but excluding the highly variable N- and C-terminal tails, ranged between 49% and 82%
(dlGnRHR-1B not included, see Table 3). Across the vertebrates, sequence similarities between the European sea bass receptors ranged between 38% with human GnRHR2 and 97% withFugu.
A phylogenetic analysis of the GnRHR transmem- brane domains shows that there are two main receptor lineages encompassing all vertebrates (designated type I and type II, Fig. 2). Within taxa, gene duplications appear to have occurred in the amphibians and in teleost fishes. Considering that each of the clades which include a European sea bass and a Fugu GnRHR is encoded by a separate gene, the lineage which includes the human GnRHR type 1 appears to contain at least one teleost specific gene duplication encompassing the Cyprinidiformes, Salmoniformes and the modern teleost fishes (Perciformes, Atherinidiformes and Tetraodon- tiformes; Fig. 2). This results in two teleost subtypes.
However, the Japanese eel receptor did not fall unambiguously in either of the two teleost subtypes. In the lineage which includes human GnRHR2, three teleost clades can be identified and their tree topology suggest two gene duplications, with one possibly specific to the modern teleosts. Two clades within this lineage are also present in the amphibians suggesting a duplication event also occurred in this class.
Analysis of the primary structure of the translated proteins grouped according to the the phylogenetic analysis showed, as main features, the presence of a C-terminal tail in all receptors except mammalian type I (Fig. 1). These have the shortest protein sequence with 328 to 362 aa. In ascending order of size the protein is 368–375 aa long from amphibians to birds, 379–390 aa in fish subtype 1A, and 350–375 aa in fish subtype 1B (considering only the second Met in rainbow trout), and
380 aa in Japanese eel. In type II receptors the C-terminal tail is longer in all cases in comparison to type I for the same class of animals. The mammalian receptor ranges from 379–380 aa (excluding human which lacks the N-terminal region). One of the amphibian subtypes has 407 aa in all species studied and the second 410–424 aa. The fish subtype 2A ranges from 412–426 aa (Nile tilapia excluded because it probably lacks part of the C-terminus). The fish subtype 2B from 390–394 aa and the fish subtype C from 387–418 aa.
A comparative analysis of conservation of amino acids that have been implicated in receptor function with reference to the human type I receptor (Millar et al.
2004) show that not all are fully conserved. For those amino acids important for the structure of the receptor or of the binding pocket Cys114, Trp164, Cys196, Trp206, Trp280, Trp291and Pro320are fully conserved through- out the vertebrates. None of the amino acids implicated in G-protein coupling in mammalian receptors are conserved in the fish receptors. Amino acids Asp98, Trp101, Asn102, Lys121 and Asn212implicated in ligand binding are fully conserved but not Tyr290 (modified only in Nile tilapia) and Asp302(conserved only in some mammals). Of the amino acids implicated in receptor activation only Asn87 is not conserved.
Tissue mRNA expression of dlGnRHRs
All dlGnRHRs have a common pattern of medium to high abundance in the anterior and middle brain in the two females and two males that were analysed (Fig. 3).
Of the two GnRHR types (1 and 2), type 1 has the widest distribution among non reproductive tissues, while type 2 is more restricted to the central nervous system. dlGnRHR-1A transcripts are also relatively abundant in the pituitary, olfactory epithelium, ovary and eye. Lower levels of expression are detected in the posterior brain region, gills and kidney. Besides its expression in brain, olfactory epithelium and kidney, dlGnRHR-1B can be detected in the pituitary, eyes, gills, gut and liver. dlGnRHR-2A has higher expression in the anterior and midbrain, pituitary and in both ovary and testis (not shown). Faint expression is found in the olfactory epithelium, eyes and gills. dlGnRHR-2B is mainly expressed along the central nervous system and gonads. Surprisingly, this receptor has no expression in the pituitary gland. dlGnRHR-2C is also expressed in the three brain regions, and in the pituitary, eyes and testis (not shown). Faint expression is found in the ovary and head kidney.
Discussion
In this study we have used sequence information from the model fish Fugu rubripes to isolate five cDNAs for
N MONCAUTand others · Novel fish GnRH receptors 772
AUTHOR COPY
Figure 1Multisequence alignment of deduced amino acid sequences of GnRHRs from European sea bass,Fugu(FS) and representatives from other fish orders and vertebrate classes. The putative seven transmembrane domains are indicated. For species abbreviations and accession numbers see the Materials and methods section.
Novel fish GnRH receptors · N MONCAUTand others 773
AUTHOR COPY
GnRHRs in the European sea bass and demonstrate that they are encoded by five separate genes. The phylo- genetic analysis of the translated amino acid sequences indicates that two major clades, which include, mammalian receptor types I and II, encompass all vertebrates. Within the type I clade a specific gene duplication appears to have occurred in teleosts, whilst in the type II clade, two rounds of gene duplication and
one round of gene duplication appear to have occurred in teleosts (three GnRHR1 genes) and amphibians (two GnRHR2 genes). Among the teleosts the exception appears to be the eels in which at present only a single receptor GnRHR1 has been cloned.
We did not find phylogenetic, structural or functional justification to name, as recently proposed (Okuboet al.
2001, Millar et al. 2004), a third receptor type which
Figure 2Unrooted tree showing the localization of the dlGnRHRs within the vertebrate lineage of GnRH receptors.
The two larger Venn diagrams delimit type I and type II receptors; the included smaller diagrams delimit the fish clades. The tree was generated using PAUP software using the Parsimony criterion. Bootstrap values are indicated in the nodes. Organism abbreviations: Japanese eel, Aj; green monkey, As; buffalo, Bb; cow, Bt; goldfish, CaA, CaB;
dog, Cc; African catfish, Cg1, Cg2; marmoset, CjII; horse, Ec; Guinea pig, Cp; leopard gecko, Em; Chicken, Gg;
mouse, Mm; Rhesus macaque, Mm2; Bonnet macaque, Mr; stripped bass, Ms; sheep, Oa; medaka, Ol1, Ol2, Ol3;
rainbow trout, Om; masou salmon, Oma1, Oma4; Nile tilapia, On1, On, On3; bullfrog, RcI, RcII, RcIII; brown frog, Rd1, Rd2, Rd3; Norwegian rat, Rn; frog, Rr1, Rr2, Rr3; sea bream, Sa; amberjack, Sd; rubber eel, Tn; African clawed frog, Xl1, Xl2.
N MONCAUTand others · Novel fish GnRH receptors 774
AUTHOR COPY
would split mammalian type II and the closest amphibian clade from the other amphibian and, following our designation, fish type II receptors. If a third receptor type were designated the resulting proposed clades would split through a phylogenetic division separating higher from lower vertebrates.
Analysis of gene organization corresponding to the coding region of the cDNAs (Table 2) shows that in both GnRHR1 and GnRHR2 types, genes with three exons and two introns and genes with four exons and three introns (four and five, respectively in gecko) are present, the latter in some but not all fishes (Madigouet al.2000, Okuboet al.2000, 2001, 2003) andXenopus(Troskieet al.
2000). In the genes with more than three exons, the 1st exon appears to have acquired an intron (Okubo et al.
2003). Overall, this indicates that gene organization per seis not diagnostic to classify GnRH receptor types.
The suggestion of three receptor types has been partly fuelled by the fact that ligand evolution appears to have led to three main clades, one of which consisting only of teleost fish (Millar et al. 2004). However, despite extensive studies of different GPCR families and their receptors there is so far no clear evidence supporting the notion that ligand evolution coincides with receptor evolution. Furthermore, similar observations of fish specific duplications have occurred for other genes in fish, including nuclear receptors, developmental genes, enzymes, etc. (Amores et al. 1998, Tchoudakova &
Callard 1998, Robinson-Rechaviet al.2001). It appears that in fishes a specific round of genome duplication with gene loss has occurred (Jaillon et al. 2004) and it is possible that segmentary genomic duplications may have resulted in the larger number of GnRHRs, at least in some fish species. Recent segmentary genome duplica- tions have also been proposed to have occurred in human (5–6% euchromatin; Sheet al.2004) and mouse genomes (2%; Baileyet al.2004). The most parsimonious conclusion is therefore that in vertebrates the GnRH receptor family is composed of two receptor types and that specific duplications have occurred early in the evolution of amphibians and ray-finned fishes (possibly more than once). In the following discussion GnRHR nomenclature in fish will be adapted to the European sea bass notation which is based on the topology of the phylogenetic tree (Fig. 2).
Amino acid sequence comparisons of the TMs of the GnRHRs extracted from the Fugu rubripes genome and from the sea bass cDNAs had highest similarities of between 77% and over 80% between receptors belonging to the same major clade (type I or type II) while across clades sequence similarity was low, between 51 and 55%.
The analyses of amino acids that have been implicated in receptor function show that the highest conservation is present in those associated with ligand binding. An exception is Asp302(numbering in reference
Figure 3Expression of dlGnRHRs in central and peripheral tissues detected by RT-PCR and Southern blotting. Amplification of rRNA 18s was used to standardize the quantity of mRNA. M, muscle; G, gills; L, liver; Gt, gut; H, heart; S, spleen; K, kidney; HK, head kidney; O, ovary; AB, anterior brain; MB, middle brain; PB, post brain; P, pituitary; E, eye; OE, olfactory epithelium.
Novel fish GnRH receptors · N MONCAUTand others 775
AUTHOR COPY
to human GnRHR1) which is often replaced by Glu another negatively charged amino acid in GnRHR1 receptors. The acidic residue in the mammalian receptor is proposed to induce a high affinity conformation of mammalian GnRH that allows it to interact with a final binding pocket (Frommeet al.2001). However, an acidic amino acid at position 302 does not appear to be required for high affinity binding to GnRH II (Millar et al.2004). This is consistent with the lack of conserva- tion of Asp302in GnRHR2 receptors and being replaced by small or hydrophobic amino acids: Pro in mammals and some amphibians, Gln in some amphibians or His in all fishes. Although GnRHR2 in different species generally bind GnRH II, but not mammalian GnRH, with high affinity (Millaret al.2004), the results of ligand binding studies do not show a clear pattern of associa- tion between putative GnRH ligands and GnRHRs types and subtypes (e.g. Illing et al. 1999, Millar et al.
2001, Neill et al. 2001, Okubo et al. 2001, Wang et al.
2001, Bogerdet al.2002).
For those amino acids important for the structure of the receptor or of the binding pocket, Cys114, Trp164, Cys196, Trp206, Trp280, Trp291 and Pro320, are fully conserved throughout the vertebrates. Of interest is the fact that of the two pairs of cysteines which would enable disulfide bond formation in the extracellular domain (Millar et al. 2004), only Cys114–Cys196 is conserved in all receptors, while Cys14–Cys200are only present simultaneously in mammalian GnRH type I receptors. These differences will modify the receptors tertiary structure and add further complexity in trying to deduce the contribution of structural elements for ligand binding.
Analysis of mRNA expression of the dlGnRHRs makes it evident that the action of GnRHs is not limited to the central nervous system and the pituitary gland.
dlGnRHRs are also expressed in the peripheral tissues related to the senses, reproduction and homeostasis: the eyes, olfactory epithelium, gonads, kidney, gut, liver, and gills. The role of GnRHs in peripheral tissues remains to be established.
All the dlGnRHRs are expressed in the brain, especially in the anterior and mid brain which include the olfactory bulb, telencephalon to diencephalon and the optic tectum. An analysis of co-localization in the brain of the three European sea bass GnRH forms (González-Martínez et al. 2002) and the five receptors, may provide an insight on ligand specificity and function. Binding sites have also been described in different pituitary cells in pejerrey, Odontesthes bonariensis (Stefanoet al.1999). Of the European sea bass receptors, dlGnRHR-2A appears to be expressed only in LH- gonadotrophs and the level correlates with the reproductive cycle (González-Martínez et al. 2004).
However, in teleost fishes, hypothalamic GnRH neurones innervate the adenohypophysis to control the
release not only of gonadotrophins (Somozaet al.2002) but also of growth hormone (Marchant et al. 1989, Li et al.2002), prolactin (Weber et al. 1997), somatolactin (Kakizawaet al.1997) and thyroid stimulating hormone (Roy et al.2000). In the goldfish GnRHR-1A and -1B have an overlapping expression and are present mainly in gonadotropes and to a lesser extent in some somatotrophs (Illing et al. 1999). With heterologous antisera in Nile tilapia – immunoreactive GnRHR-1A localized to FSH and LH cells and GnRH-1B to prolactin FSH- and LH-containing cells and as small clusters scattered along the periphery of the pars intermedia of the pituitary (Parhar et al. 2002). Also heterologous antisera to GnRHR-2A and -2C stained GH-containing cells of the Nile tilapia pituitary (Parhar et al.2002). The fact that dlGnRHR-2B is not expressed in the pituitary supports the hypothesis of GnRH peptides possibly having specialized functions not related to gonadotrophin release.
Nevertheless, all European sea bass receptors, apart from dlGnRHR-1B, were strongly expressed in the gonads (i.e. testis and/or ovary). High levels of GnRHRs expression have also been detected in the gonads of other teleosts (African catfish, Bogerd et al.
2002; goldfish, Illinget al.1999; rainbow trout, Madigou et al. 2000) and in mammals (Dong et al. 1996, Kakar
& Jennes, 1995). This has also been confirmed by binding studies (Pati & Habibi 1993), suggesting a direct effect of GnRH on sex steroid synthesis and gametogenesis.
dlGnRHR-2C and dlGnRHR-1A had relatively higher expression in the eye, an observation that has also been made in rainbow trout (GnRHR-1B) and Japanese eel, Anguilla japonica (GnRHR1) (Madigou et al. 2000, Okubo et al. 2000). Furthermore, GnRH immunoreac- tive fibers have been detected in the retina of platyfish, Xyphophorus maculatus (Munz et al. 1981), goldfish (Kah et al.1986) and pejerrey (Mirandaet al.2003) and in the olfactory systems of several teleost species, including the American eel, Anguilla rostrata (Grober et al. 1987) and masu salmon (Kudoet al.1994). Fish olfactory receptors are also highly sensitive to GnRH (Andersen & Doving 1991). Immunoreactive GnRH somata have been identified along the rostro-caudal extent of the olfactory nerve, and clustered within the medial component of the olfactory nerve as it arises from the olfactory epithelium (Nevittet al.1995). Since at least some cells in this cluster project to the retina, possibly being part of a terminal nerve ganglion, it has been suggested that perhaps GnRH facilitates visual and olfactory perception during sexual interactions (Nevitt et al. 1995). A role for olfactory stimuli in the regulation of GnRH secretion has been suggested in sea lamprey, Petromyzon marinus, based on the overlap of olfactory- and GnRH- containing fibres from prolarval stages to metamorphosis (Tobet et al. 1996). It has been recently demonstrated
N MONCAUTand others · Novel fish GnRH receptors 776
AUTHOR COPY
using GnRH-receptor antagonist that GnRH secreted by mammalian olfactory cells promotes the differentiation and migration of the olfactory sensory lineage cells that are committed to become GnRH neurons (Romanelli et al. 2004). The expression of both dlGnRHR-2A and dlGnRHR-2B in the olfactory rosettes suggest that they are likely mediators of these processes.
Of particular interest is the expression of GnRHRs in tissues related to osmoregulation. We show for the first time GnRHR expression in the gills (dlGnRHR-1A, -1B and -2A) and kidney (dlGnRHR-2A and dlGnRHR-2B).
Few species have been also shown to express GnRH peptide. Teleost (Haplochromis burtoni) kidney express at least one form of GnRH (White & Fernald 1998) and human kidneys express two GnRH forms (Kakar &
Jennes 1995). Since GnRH has never been associated with osmoregulation, a possible explanation for the presence of GnRH and its receptor in kidney is that this tissue contains a high concentration of mast cells which express GnRH in high levels (Khalil et al. 2003, Marchettiet al.1996, Rissman 1996).
In conclusion, the existence of five different GnRH receptors to three GnRH forms in this model of vertebrate species indicates a complex interplay occurs between ligands and receptors in the regulation of pituitary and hormone secretion. The fact that GnRHRs show a wide and different pattern of tissue distribution, is suggestive that, in addition to regulating the secretion of gonadotrophins from the anterior pituitary, GnRH and its receptor also play a role in the regulation of a range of cellular functions in an autocrine or paracrine manner (Millar 2003). However, when considering the various species from different phylogenetic positions, in which GnRHRs expression has been studied, it is not possible as yet to identify a specific pattern of expression characteristic of each receptor type or subtype. Gener- ally speaking the common feature is the expression of the various receptors in the central nervous system, but the distribution in other tissues is more variable. This suggests that in any one species (or higher taxonomic group) the GnRHRs receptors are generally involved in some ancestral functions, e.g. those related to reproduc- tion, but at a peripheral level specialization of functions have also evolved independently.
Acknowledgements
This work received the support from a Portugal–
Argentina Science and Technology Cooperation Agree- ment, SECYT-GRICES 472 Program PO/PA02-BI/
001. N P M was in receipt of a fellowship covered by the European Social Fund and National funds under Portuguese National Science Foundation (FCT) POCTI/SFRH/BD/6083/2001.
References
Adams BA, Tello JA, Erchegyi J, Warby C, Hong DJ, Akinsanya KO, Mackie GO, Vale W, Rivier JE & Sherwood NM 2003 Six novel gonadotropin-releasing hormones are encoded as triplets on each of two genes in the protochordate, Ciona intestinalis.
Endocrinology1441907–1919.
Altschul SF, Madden TL, Schaffer AA, Zhang JH, Zhang Z, Miller W & Lipman DJ 1997 Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.Nucleic Acids Research253389–3402.
Amores A, Force A, Yan YL, Joly L, Amemiya C, Fritz A, Ho RK, Langeland J, Prince V, Wang YLet al.1998 Zebrafish hox clusters and vertebrate genome evolution.Science2821711–1714.
Andersen O & Doving KB 1991 Gonadotropin-releasing hormone (GnRH): A novel olfactory stimulant in fish.Neuroreport2458–460.
ASAB 2003 Guidelines for the treatment of animals in behavioural research and teaching.Animal Behaviour65249–255.
Bailey JA, Church DM, Ventura M, Rocchi M & Eichler EE 2004 Analysis of segmental duplications and genome assembly in the mouse.Genome Research14789–801.
Bogerd J, Bas Diepenbroek W, Hund E, van Oosterhaut F, Teves AC, Leurs R & Blomenröhr M 2002 Two gonadotropin-realising hormone receptor in the African catfish: No differences in ligand selectivity, but differences in tissue distribution.Endocrinology143 4673–4682.
Campion CE, Turzillo AM & Clay CM 1996 The gene encoding the ovine gonadotropin-releasing hormone (GnRH) receptor:
cloning and initial characterization.Gene170277–280.
Church GM & Gilbert W 1984 Genomic sequencing.PNAS81 1991–1995.
Dong KW, Duval P, Zeng Z, Gordon K, Williams RF, Hodgen GD, Jones G, Kerdelhue B & Roberts JL 1996 Multiple transcription start sites for the GnRH gene in rhesus and cynomolgus monkeys:
a non-human primate model for studying GnRH gene regulation.
Molecular and Cellular Endocrinology117121–130.
Falquet L, Pagni M, Bucher P, Hulo N, Sigrist CJ, Hofmann K &
Bairoch A 2002 The PROSITE database, its status in 2002.
Nucleic Acids Research30235–238.
Fromme BJ, Katz AA, Roeske RW, Millar RP & Flanagan CA 2001 Role of aspartate7·32(302) of the human gonadotropin-releasing hormone receptor in stabilizing a high-affinity ligand
conformation.Molecular Pharmacology601280–1287.
González-Martínez D, Madigou T, Zmora N, Anglade I, Zanuy S, Zohar Y, Elizur A, Muñoz-Cueto A & Kah O 2001 Differential expression of three different prepro-GnRH (gonadotrophin- releasing hormone) messengers in the brain of the European sea bass (Dicentrarchus labrax).Journal of Comparative Neurology429 144–155.
González-Martínez D, Zmora N, Mañanos E, Saligaut D, Zanuy S, Zohar J, Elizur A, Kah O & Muñoz-Cueto JA 2002
Immunohistochemical localization of three different prepro- GnRHs in the brain and pituitary of the European sea bass (Dicentrarchus labrax) using antibodies to the corresponding GnRH- associated peptides.Journal of Comparative Neurology44695–113.
González-Martínez D, Madigou T, Mananos-Sanchez E, Cerdá-Reverter JM, Zanuy S, Kah O & Muñoz-Cueto JA 2004 Cloning and expression of gonadotrophin-releasing hormone receptor in the brain and pituitary of the European sea bass: anin situhybridization study.Biology of Reproduction701380–1391.
Grober MS, Bass AH, Burd G, Marchaterre MA, Segil N, Scholz K
& Hodgson T 1987 The nervus terminalis ganglion inAnguilla rostrata: an immunocytochemical and HRP histochemical analysis.
Brain Research436148–152.
Ikemoto T, Enomoto M & Park MK 2004 Identification and characterization of a reptilian GnRH receptor from the leopard gecko.Molecular and Cellular Endocrinology214137–147.
Novel fish GnRH receptors · N MONCAUTand others 777
AUTHOR COPY
Illing N, Troskie BE, Nahorniak C, Hapgood JP, Peter R & Millar RP 1999 Two gonadotropin-releasing hormone receptor subtypes with distinct ligand selectivity and differential distribution in brain and pituitary in the Goldfish (Carassius auratus).PNAS96 2526–2531.
Jaillon O, Aury JM, Brunet F, Petit JL, Stange-Thomann N, Mauceli E, Bouneau L, Fischer C, Ozouf-Costaz C, Bernot Aet al.2004 Genome duplication in the teleost fishTetraodon nigroviridis reveals the early vertebrate proto-karyotype.Nature431946–957.
Jodo A, Ando H & Urano A 2003 Five different types of GnRH receptor gene are expressed in the brain of masu salmon (Oncorhynchus masou).Zoological Science201117–1125.
Kah O, Breton B, Dulka JG, Nunez-Rodriguez J, Peter RE, Corrigan A, Rivier JE & Vale WW 1986 A reinvestigation of the Gn-RH (gonadotrophin-releasing hormone) systems in the goldfish brain using antibodies to salmon Gn-RH.Cell and Tissue Research 244327–337.
Kakar SS 1997 Molecular structure of the human gonadotropin- releasing hormone receptor gene.European Journal of Endocrinology 137183–192.
Kakar SS & Jennes L 1995 Expression of gonadotropin-releasing hormone and gonadotropin-releasing hormone receptor mRNAs in various non-reproductive human tissues.Cancer Letters9857–62.
Kakizawa S, Kaneko T & Hirano T 1997 Effects of hypothalamic factors on somatolactin secretion from the organ-cultured pituitary of rainbow trout.General and Comparative Endocrinology10571–78.
Khalil MH, Silverman AJ & Silver R 2003 Mast cells in the rat brain synthesize gonadotropin-releasing hormone.Journal of Neurobiology56113–124.
Krogh A, Larsson B, von Heijne G & Sonnhammer ELL 2001 Predicting transmembrane protein topology with a hidden Markov model: Application to complete genomes.Journal of Molecular Biology305567–580.
Kudo H, Ueda H, Kawamura H, Aida K & Yamauchi K 1994 Ultrastructural demonstration of salmon-type gonadotropin- releasing hormone (sGnRH) in the olfactory system of masu salmon (Oncorhynchus masou).Neuroscience Letters166187–190.
Lethimonier C, Madigou T, Muñoz-Cueto JA, Lareyre JJ & Kah O 2004 Evolutionary aspects of GnRHs, GnRH neuronal systems and GnRH receptors in teleost fish.General and Comparative Endocrinology1351–16.
Li WS, Lin HR & Wong AOL 2002 Effects of gonadotropin- releasing hormone on growth hormone secretion and gene expression in common carp pituitary.Comparative Biochemistry and Physiology B-Biochemistry and Molecular Biology132335–341.
Madigou T, Mananos-Sanchez E, Hulshof S, Anglade I, Zanuy S &
Kah O 2000 Cloning, tissue distribution, and central expression of the gonadotropin-releasing hormone receptor in the rainbow trout (Oncorhynchus mykiss).Biology of Reproduction631857–1866.
Madigou T, Uzbekova S, Lareyre JJ & Kah O 2002 Two messenger RNA isoforms of the gonadotrophin-releasing hormone receptor, generated by alternative splicing and/or promoter usage, are differentially expressed in rainbow trout gonads during gametogenesis.Molecular Reproduction and Development63151–160.
Marchant TA, Chang JP, Nahorniak CS & Peter RE 1989 Evidence that gonadotropin-releasing hormone also functions as a growth hormone-releasing factor in the goldfish.Endocrinology124 2509–2518.
Marchetti B, Gallo F, Farinella Z, Romeo C & Morale MC 1996 Luteinizing hormone-releasing hormone (LHRH) receptors in the neuroendocrine-immune network - Biochemical bases and implications for reproductive physiopathology.Basis for Cancer Management784209–236.
McArdle CA, Franklin J, Green L & Hislop JN 2002 Signalling, cycling and desensitisation of gonadotroping releasing hormone receptors.Journal of Endocrinology1731–11.
Millar RP 2003 GnRH II and type II GnRH receptors.Trends in Endocrinology and Metabolism1435–43.
Millar R, Lowe S, Conklin D, Pawson A, Maudsley S, Troskie B, Ott T, Millar M, Lincoln G, Sellar Ret al.2001 A novel mammalian receptor for the evolutionarily conserved type II GnRH.PNAS989636–9641.
Millar RP, Lu ZL, Pawson AJ, Flanagan CA, Morgan K &
Maudsley SR 2004 Gonadotropin-releasing hormone receptors.
Endocrine Reviews25235–275.
Miranda LA, Strobl-Mazzulla PH, Strussmann CA, Parhar I &
Somoza GM 2003 Gonadotropin-releasing hormone neuronal development during the sensitive period of temperature sex determination in the pejerrey fish,Odontesthes bonariensis.General and Comparative Endocrinology132444–453.
Munz H, Stumpf WE & Jennes L 1981 LHRH systems in brain of platyfish.Brain Research2211–13.
Neill JD, Duck LW, Sellers JC & Musgrove LC 2001 A gonadotropin-releasing hormone (GnRH) receptor specific for GnRH II in primates.Biochemical and Biophysical Research Communications2821012–1018.
Nevitt GA, Grober MS, Marchaterre MA & Bass AH 1995 GnRH-like immunoreactivity in the peripheral olfactory system and forebrain of Atlantic salmon (Salmo salar): A reassessment at multiple life-history stages.Brain Behavior and Evolution45 350–358.
Nicholas KB, Nicholas HB Jr & Deerfield II DW 1997 GeneDoc:
Analysis and visualization of genetic variation.Embnet News41–4.
Okubo K, Suetake H, Usami T & Aida K 2000 Molecular cloning and tissue-specific expression of a gonadotropin-releasing hormone receptor in the Japanese eel.General and Comparative Endocrinology 119181–192.
Okubo K, Nagata S, Ko R, Kataoka H, Yoshiura Y, Mitani H, Kondo M, Naruse K, Shima A & Aida K 2001 Identification and characterization of two distinct GnRH receptor subtypes in a teleost, the MedakaOryzias latipes.Endocrinology1424729–4739.
Okubo K, Ishii S, Ishida J, Mitani H, Naruse K, Kondo M, Shima A, Tanaka M, Asakawa S, Shimizu Net al.2003 A novel third gonadotropin-releasing hormone receptor in the medakaOryzias latipes: evolutionary and functional implications.Gene314 121–131.
Parhar IS, Soga T, Sakuma Y & Millar RP 2002 Spatio–temporal expression of gonadotropin releasing hormone receptor subtypes in gonadotropes, somatotropes and lactotropes in the cichlid fish.
Journal of Neuroendocrinology14657–665.
Pati D & Habibi H 1993 Characterization of gonadotropin-releasing hormone receptors in goldfish ovary: variation during follicular development.American Journal of Physiology264R227–R234.
Rissman EF 1996 Behavioral regulation of gonadotropin-releasing hormone.Biology of Reproduction54413–419.
Robinson-Rechavi M, Marchand O, Escriva H, Bardet PL, Zelus D, Hughes S & Laudet V 2001 Euteleost fish genomes are
characterized by expansion of gene families.Genome Research11 781–788.
Romanelli RG, Barni T, Maggi M, Luconi M, Failli P, Pezzatini A, Pelo E, Torricelli F, Crescioli C, Ferruzzi Pet al.2004 Expression and function of gonadotropin-releasing hormone (GnRH) receptor in human olfactory GnRH-secreting neurons: an autocrine GnRH loop underlies neuronal migration.Journal of Biological Chemistry 279117–126.
Roy P, Datta M, Dasgupta S & Bhattacharya S 2000 Gonadotropin- releasing hormone stimulates thyroid ativity in a feshwater murrel, Channa gachua(Ham.), and carps,Catla catla(Ham.) andCirrhinus mrigala(Ham.).General and Comparative Endocrinology117456–463.
She X, Jiang Z, Clark RA, Liu G, Cheng Z, Tuzun E, Church DM, Sutton G, Halpern AL & Eichler EE 2004 Shotgun sequence assembly and recent segmental duplications within the human genome.Nature431927–930.
Somoza GM, Miranda LA, Strobl-Mazzulla P & Guilgur LG 2002 Gonadotropin-releasing hormone (GnRH): From fish to mammalian brains.Cellular and Molecular Neurobiology22589–609.
N MONCAUTand others · Novel fish GnRH receptors 778
AUTHOR COPY
Stefano AV, Vissio PG, Paz DA, Somoza GM, Maggese MC &
Barrantes GE 1999 Co-localization of GnRH binding sites with gonadotropin-, somatotropin-, somatolactin-, and prolactin- expressing pituitary cells of the pejerrey,Odontesthes bonariensis,in vitro.General and Comparative Endocrinology116133–139.
Sun Y-M, Flanagan CA, Illing N, Ott TR, Sellar R, Fromme BJ, Hapgood J, Sharp P, Sealfon SC & Millar RP 2001 A chicken gonadotropin-releasing hormone receptor that confers agonist activity to mammalian antagonists. Identification of D-Lys6in the ligand and extracellular loop two of the receptor as determinants.
Journal of Biological Chemistry2767754–7761.
Swofford DL 2002 PAUP*. Phylogenetic Analysis Using Parsimony (*and other methods), CD-ROM. Sunderland, Massachusetts:
Sinauer Associates.
Tchoudakova A & Callard GV 1998 Identification of multiple CYP19 genes encoding different cytochrome P450 aromatase isozymes in brain and ovary.Endocrinology1392179–2189.
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F & Higgins DG 1997 The CLUSTAL X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.Nucleic Acids Research254876–4882.
Tobet SA, Chickering TW & Sower SA 1996 Relationship of gonadotropin-releasing hormone (GnRH) neurons to the olfactory system in developing lamprey (Petromyzon marinus).Journal of Comparative Neurology37697–111.
Troskie BE, Hapgood JP, Millar RP & Illing N 2000
Complementary deoxyribonucleic acid cloning, gene expression, and ligand selectivity of a novel gonadotropin-releasing hormone receptor expressed in the pituitary and midbrain ofXenopus laevis.
Endocrinology1411764–1771.
Wang L, Bogerd J, Choi HS, Seong JY, Soh JM, Chun SY, Blomenröhr M, Troskie BE, Millar RP, Yu WHet al.2001 Three distinct types of GnRH receptor characterized in the bullfrog.
PNAS98361–366.
Weber GM, Powell JFF, Park M, Fischer WH, Craig AG, Rivier JE, Nanakorn U, Parhar IS, Ngamvongchon S, Grau EGet al.1997 Evidence that gonadotropin-releasing hormone (GnRH) functions as a prolactin-releasing factor in a teleost fish (Oreochromis mossambicus) and primary structures for three native GnRH molecules.Journal of Endocrinology155121–132.
White RB & Fernald RD 1998 Ontogeny of gonadotropin-releasing hormone (GnRH) gene expression reveals a distinct origin for GnRH-containing neurons in the midbrain.General and Comparative Endocrinology112322–329.
Zmora N, González-Martinez D, Muñoz-Cueto JA, Madigou T, Mañanos-Sanchez E, Zanuy-Doste S, Zohar Y, Kah O & Elizur A 2002 The GnRH system in the European sea bass (Dicentrarchus labrax).Journal of Endocrinology172105–116.
Received 11 February 2005 Accepted 15 February 2005
Novel fish GnRH receptors · N MONCAUTand others 779