Accepted Manuscript
Brain aromatase (Cyp19A2) and estrogen receptors, in larvae and adult pejerrey fish Odontesthes bonariensis. Neuroanatomical and functional relations Pablo H. Strobl-Mazzulla, Christèle Lethimonier, Marie Madeleine Gueguen, Makiko Karube, Juan I. Fernandino, Goro Yoshizaki, Reynaldo Patiño, Carlos A. Strüssmann, Olivier Kah, Gustavo M. Somoza
PII: S0016-6480(08)00270-0
DOI: 10.1016/j.ygcen.2008.07.006
Reference: YGCEN 10166
To appear in: General and Comparative Endocrinology Received Date: 23 April 2008
Revised Date: 14 July 2008 Accepted Date: 17 July 2008
Please cite this article as: Strobl-Mazzulla, P.H., Lethimonier, C., Gueguen, M.M., Karube, M., Fernandino, J.I., Yoshizaki, G., Patiño, R., Strüssmann, C.A., Kah, O., Somoza, G.M., Brain aromatase (Cyp19A2) and estrogen receptors, in larvae and adult pejerrey fish Odontesthes bonariensis. Neuroanatomical and functional relations, General and Comparative Endocrinology (2008), doi: 10.1016/j.ygcen.2008.07.006
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers
we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and
review of the resulting proof before it is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
ACCEPTED MANUSCRIPT
1
Brain aromatase (Cyp19A2) and estrogen receptors, in larvae and adult
1
pejerrey fish Odontesthes bonariensis. Neuroanatomical and functional
2
relations.
3 4
Pablo H. Strobl-Mazzulla1, Christèle Lethimonier2, Marie Madeleine Gueguen2, Makiko 5
Karube3, Juan I. Fernandino1, Goro Yoshizaki3, Reynaldo Patiño4, Carlos A. Strüssmann3, 6
Olivier Kah2, Gustavo M. Somoza1
.
7 8
1Laboratorio de Ictiofisiología y Acuicultura. IIB-INTECH (CONICET-UNSAM), Argentina.
9
2Neurogenesis and Estrogens. Université de Rennes 1, UMR CNRS 6026. IFR 140. Campus 10
de Beaulieu. 35042 Rennes cedex. France.
11
3Faculty of Marine Sciences. Department of Marine Biosciences. Tokyo University of Marine 12
Science and Technology (TUMSAT), Japan.
13
4U.S. Geological Survey Texas Cooperative Fish and Wildlife Research Unit, Texas Tech 14
University - Lubbock (USA).
15 16
Correspondence to: Gustavo M. Somoza. FAX: +54-2241-424048, [email protected] 17
18 19 20 21
Abbreviated title: Brain aromatase and estrogen receptors in pejerrey 22
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 2 ABSTRACT
23
Although estrogens exert many functions on vertebrate brains, there is little information on 24
the relationship between brain aromatase and estrogen receptors. Here we report the cloning 25
and characterization of two estrogen receptors and in pejerrey. Both receptors mRNAs 26
largely overlap and were predominantly expressed in the brain, pituitary, liver, and gonads.
27
Also brain aromatase and estrogen receptors were up-regulated on brain of estradiol treated 28
males.
29
In situ hybridization was performed to study in more detail the distribution of the two 30
receptors in comparison with brain aromatase mRNA in the brain of adult pejerrey. The 31
estrogen receptors mRNAs exhibited distinct but partially overlapping patterns of expression 32
in the preoptic area and the mediobasal hypothalamus, as well as in the pituitary gland.
33
Moreover, the estrogen receptor , but not , were found to be expressed on cells lining the 34
preoptic recess, similarly as observed for brain aromatase.
35
Finally, it was shown that the onset expression of brain aromatase and both estrogen 36
receptors in the head of larvae preceded the morphological differentiation of the gonads.
37
Because pejerrey sex differentiation is strongly influenced by temperature, brain aromatase 38
expression was measured during the temperature sensitive window and was found to be 39
significantly higher at male-promoting temperature.
40
Taken together these results suggest close neuroanatomical and functional relationships 41
between brain aromatase and estrogen receptors, probably involved in the sexual 42
differentiation of the brain and raising interesting questions on the origin (central or 43
peripheral) of the brain aromatase substrate.
44
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 3 INTRODUCTION
47
Although the best known roles of estradiol (E2) are those related with reproductive and 48
developmental functions (Carreau et al., 2002), this hormone is responsible for important 49
behavioural and physiological functions in vertebrates, exerting its actions on a wide variety 50
of target tissues. Estrogen actions are mediated by classical nuclear estrogen receptors (ERs) 51
regulating the expression of target genes. Once bound by the ligand, ERs dimerize and 52
interact with a consensus regulatory palindromic DNA sequence, called the estrogen- 53
responsive element (ERE: AGGTCAnnnTGACCT), on the promoter region of target genes 54
(Nilsson et al., 2001). However, there is increasing evidence that E2 may also act via non 55
genomic pathways interacting with membrane receptors or recognition sites (Toran-Allerand, 56
2005), although such mechanisms are still not fully understood.
57
Until now, two main types of ERs have been described in vertebrates. The first, now 58
known as ER , was cloned from humans, chicken and rainbow trout 59
(Green et al., 1986; Krust et al., 1986; Pakdel et al., 1989) and almost ten years later, a second 60
one, called ER , was discovered in rats (Kuiper et al., 1996). However, in teleost fish, a third 61
receptor (called ER b, ER 2 or ER depending on the species) encoded by a different gene 62
has been reported (Hawkins et al., 2000; Menuet et al., 2000; Sabo-Attwood et al., 2004;
63
Greytak and Callard, 2007; Nagler et al., 2007). ER and ER subtypes are thought to have 64
arisen from a duplication event prior to the emergence of ray-finned fishes, about 450 million 65
years ago (Thornton, 2001) and then the ER gene underwent an ulterior duplication early in 66
the teleost fish lineage, giving rise to the third form of ERs while the second copy of ER has 67
probably been lost (Bardet et al., 2002).
68
The ERs are expressed in a wide variety of tissues and, the analysis of mRNA distribution 69
indicated co-expression of the three receptors in some, but not all analyzed tissues (Halm et 70
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 4 al., 2004; Greytak and Callard, 2007; Nagler et al., 2007). This indicates the possibility of 71
specific or redundant functions, different regulatory mechanisms or dissimilar cellular 72
localization. Whatever the case, the biological significance of multiple ERs in fish and the 73
role of each subtype are far from being elucidated.
74
It is also well known, that E2 acts in the brain as a neural growth or trophic factor 75
regulating the neuroendocrine circuits controlling reproductive functions in vertebrates 76
(McEwen, 2001; Toran-Allerand, 2005). Testosterone can be locally converted to E2 by an 77
enzyme complex formed by the cytochome P450 aromatase and the ubiquitous flavoprotein 78
NADPH cytochrome reductase representing an additional important source of estrogen for the 79
brain (McEwen, 2002).
80
In this frame, the teleost fish brain is interesting due to its well known high aromatase 81
activity, 100 to 1000 times higher than adult brain mammals (Pasmanik and Callard, 1985).
82
Teleost fish are also unique because they present two aromatase genes in their genome:
83
cyp19A1, mainly expressed in the gonads and commonly known as “gonadal aromatase”, and 84
cyp19A2 mainly expressed in brain tissue and also named “brain aromatase” (Pellegrini et al., 85
2005; Cheshenko et al., 2008).
86
The anatomical basis of brain aromatase in teleosts was first documented in the plainfin 87
midshipman, where the highest cyp19A2 messenger and protein signals were mainly detected 88
in the ventricular surface of the telencephalon, preoptic area, and the hypothalamic region.
89
Based on the radial morphology of the cyp19A2-positive cells, and the fact that aromatase co- 90
localized with glial fibrillary acid protein (GFAP) and vimentin (both glial specific markers), 91
cyp19A2 was reported to be almost exclusively expressed in radial glial cells (Forlano et al., 92
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 5 It is well known that cyp19A2 messengers can be up-regulated by E2 and these effects 95
could be blocked by an ER antagonist, suggesting that ERs are involved in the E2-dependent 96
induction of the cyp19A2 gene (Gelinas et al., 1998; Kishida and Callard, 2001; Menuet et al., 97
2005). This idea is in agreement with the presence an ERE and half ERE sites in the 5´- 98
flanking regions of this gene (Kazeto et al., 2001; Tchoudakova et al., 2001; Chang et al., 99
2005). As a consequence, brain aromatase expressing cells should exhibit ER expression.
100
The three ERs are known for being expressed in brain areas related to the control of 101
reproduction: ventral telencephalon, preoptic area and mediobasal hypothalamus (Anglade et 102
al., 1994; Hawkins et al., 2000; Menuet et al., 2000; 2003; Forlano et al., 2005). However, 103
Menuet et al. (2003) and Forlano et al. (2005) failed to observed extensive neuroanatomical 104
co-distribution of ER and cyp19A2 messengers. This fact could be a consequence of low 105
expression levels of ER or the presence of another receptor subtype.
106
Our experimental model, the pejerrey, is a gonochorist fish in which the phenotypic sex is 107
strongly influenced by water temperature during a thermo-sensitive period early in life 108
(Temperature Sex Determination, TSD). In this species, the percentage of females gradually 109
changes from 100% at 15-19ºC to 0% at 29ºC, during a critical period estimated to be 110
between 1-5 weeks depending on the rearing temperature (Strüssmann et al., 1996; 1997). In 111
teleost species, several reports have documented that the estrogen/androgen balance could be 112
the key switch during the phenotypic sex differentiation, being this balance governed by the 113
“gonadal aromatase” form (Kitano et al., 1999; D'Cotta et al., 2001; Karube et al., 2007). On 114
the other side, at least in mammals, it is also known that estrogens play a role in the 115
embryonic organization of the central nervous system and particularly in the organization of 116
sexually dimorphic circuits through a modulation of cell fate (proliferation, differentiation, 117
migration and apoptosis). It is believed that these effects rely on the central expression of 118
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 6 aromatase that converts testosterone into E2 (Simerly, 2002). However, the role of estrogens 119
in fish brain development and differentiation is still an open question, although there are some 120
data suggesting that the brain is involved in the process of sex differentiation in tilapia (Tsai 121
et al., 2003).
122
Pejerrey fish represents an invaluable model to study brain sex differentiation in a fish with 123
a strong TSD. In this framework, the final goal of this work was to characterize the 124
estrogen/estrogen receptor system in the brain of adult pejerrey and study its possible 125
involvement in the sex determination/differentiation process. This manuscript includes the 126
full cloning of two pejerrey ERs (pjER and pjER ), their tissue expression profile, the 127
estrogen regulation and neuroanatomical distribution in relation to brain aromatase expressing 128
cells. Finally, the ontogenetic expression of pjERs and cyp19A2 during the critical period of 129
sex determination/differentiation in developing brains is described.
130
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 7
MATERIALS AND METHODS 131
132
Animals, tissue preparation and RNA extraction 133
Adult male and female pejerrey fish were obtained from the IIB-INTECH and 134
TUMSAT aquatic facilities. The fish were maintained under natural temperature and 135
photoperiod in outdoor tanks. For tissue sampling, fish were anesthetized with benzocaine and 136
sacrificed by decapitation in accordance with the UFAW Handbook on the Care and 137
Management of Laboratory Animals (http://www.ufaw.org.uk) and local regulations.
138
The tissue samples were taken from the eyes, gills, liver, kidney, spleen, gonads, 139
olfactory epithelium, heart, muscle, intestine and brain, quickly removed and stored in 140
RNAlater (Sigma®, St. Louis, USA) at –80ºC until RNA extraction. Total RNA was 141
extracted using TRIzol®Reagent (Invitrogen™, Carlsbad, USA) according to the 142
manufacturer’s instructions. The quality and concentration of RNA was assessed by 143
spectrophotometry and checked by running an aliquot (2 g) on a 1% agarose-formaldehyde 144
gel. The RNA samples were then kept at –80ºC until use.
145 146
Molecular cloning of pjERs 147
Amplification of pjERs cDNA was carried out by RT-PCR using two set of degenerate 148
primers for pjER and pjER designed according conserved regions of teleosts ER and ER : 149
ER DF: GCTTGTCGTCTTAGGAAATGTTACGA 150
ER DR: TACAGTGGCACTTTGTTCTTGCACTTCATGC 151
ER DF: TCCTTGCGCACACCTCCTTTCATC 152
ER DR: TGYGARGGITGYAARGCITTYT 153
The PCR reactions were carried out in a final volume of 25 l containing 1 l of cDNA 154
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 8 dNTPmix, 0.5µl of 25µM solution of each primer, 1.25 units of Taq polymerase 156
(InvitrogenTM) using the following cycle: 5 min denaturing step at 94ºC, 30 cycles of 45 sec at 157
94°C, 45 sec at 62°C (pjER ) or 54°C (pjER ), and 1 min at 72 °C followed by final 5 min 158
elongation period at 72 °C. Each PCR product was then electrophoresed on a 0.7% agarose 159
gel and fragments showing the predicted molecular weight were excised using a Concert 160
Rapid Gel Extraction System (Life Technologies Inc., Rockville, USA), cloned using the 161
pGEM®-T Easy kit (Promega Corporation, Madison, USA), sequenced and submitted to 162
FASTA for comparison to known sequences accessible in GenBank/EMBL.
163
Two specific nested primers were designed in order to amplified the 3´ and 5´ ends for 164
both pjERs:
165
3´end:
166
ER F1: TGCTCCTACTGCTTTCCCACATC 167
ER F2: CATGAAGTGCAAGAACAAAGTG 168
ER F1: CTCACCTTTCGGCAGCAGT 169
ER F2: GCCCACCTGCTCATGCTGCTCTC 170
5´end:
171
ER R1: GATACCGGTCCGTCGCTTGTCAC 172
ER R2: TCCTTGCGCACACCTCCTTTCATC 173
ER R1: AGCGGCCTCTTCGTGTCGTTCAT 174
ER R2: TTGCGGCGGTTCTTGTCTGTAGT 175
Two micrograms of total RNA from ovarian and pituitary tissues were treated with 176
DNase I amplification grade (InvitrogenTM), and the resulting RNA free of DNA was reverse 177
transcribed to cDNA using SMARTTM RACE cDNA Amplification kit (Clontech, Mountain 178
View, USA) following the supplier’s protocol. The PCRs, using the first specific primer for 179
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 9 and 72ºC for 180s; 5 cycles at 94ºC for 5s, 70ºC for 10s and 72 ºC for 180s and a finally 25 181
cycles at 94ºC for 5s, 68ºC for 10s and 72ºC for 180s. Then, nested PCRs, using the second 182
specific primer, were performed following the same conditions using as template a 1:50 183
dilution of previous amplifications. The resulting PCR products having the estimated size for 184
both pjERs were excised, cloned and sequenced.
185 186
Phylogenetical analysis 187
The deduced amino acid sequences corresponding to different vertebrate ERs cDNAs 188
were obtained from the GenBank. The sequences were aligned using the Clustal W method 189
(Thompson et al., 1994) setting the default parameters and then back-translated (Wernersson 190
and Pedersen, 2003).
191
The phylogenetic tree was constructed using the maximal parsimony method with the 192
TNT program (Goloboff et al., 1999). The human progesterone receptor was used as an out- 193
group sequence.
194 195
Tissue distribution 196
Two µg of DNA free total RNA, from two adult pejerrey tissues taken from 197
spermiating males and vitellogenic females were reversed transcribed to cDNA with 198
SuperScript III RNase H- (InvitrogenTM) using oligo(dT)12-18. The PCR analysis for pjER , 199
pjER and cyp19A2 was performed using the primers and conditions listed in Table 1. Three 200
µl from a 1/10 dilution of the PCR reactions were subjected to electrophoresis in a 1.2%
201
agarose gel and transferred onto a nylon membrane by capillarity. The DNA on the membrane 202
was denaturalized by soaking it for 5 min in 1.5M NaCl/0.5M NaOH, neutralized by soaking 203
5min in 0.5M Tris-HCl (pH 8.0)/1.5M NaCl and finally soaked in 6X SSC. The membranes 204
were air dry and UV cross-linked. Membranes containing denatured cDNA from tissues RT- 205
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 10 PCRs were prehybridized for 4h at 42°C, hybridized with their corresponding [ -32P]dATP- 206
labelled cDNA probes at 42ºC overnight. Stringency washes were performed for 30min once 207
at 42ºC and three times at 50ºC with 0.1% SDS and 1X SSC. The blots were exposed to X-ray 208
films (X-OMAT AR-205, Kodak, France) at –80ºC for 4h, and visualized by autoradiography.
209 210
Estradiol treatment 211
Adult pejerrey males were anesthetized, weighed and i.p. implanted with E2 (10 g/g 212
body weight diluted in ethanol/corn oil 1:9; n=6) or vehicle in silastic capsules (n=6). Ten 213
days later, the fish were sacrificed, their brains quickly removed and total RNA was isolated 214
and processed for pjER , pjER and cyp19A2 semi-quantitative RT-PCR. All treated males 215
exhibited high vitellogenin plasma levels as identified by SDS-PAGE and western blot using 216
a pejerrey specific anti-vitellogenin serum (data not shown).
217 218
Brain aromatase and Estrogen receptor ontogeny 219
Fertilized eggs were incubated in an open-flow freshwater system at 18-20°C until 220
hatching and the newly hatched larvae were transferred to two aquaria kept at feminizing 221
(17°C) or masculinizing (29°C) temperatures during the thermolabile period of sex 222
determination according to Strüssmann et al. (1997). Rearing water was kept at a salinity of 223
1.5% (NaCl) and larvae were fed 3 times daily with Artemia nauplii and powdered food ad 224
libitum. Six larvae from each group were sampled weekly from hatching to week 7 and total 225
RNA from the heads were individually extracted and processed for pjER , pjER and 226
cyp19A2 semi-quantitative RT-PCR. At the end of the experiment (week 12), 10 larvae from 227
each group were fixed in Bouin’s solution for histological determination of phenotypic sex.
228
Samples were then embedded in paraffin and sectioned at 6 m and stained with hematoxylin 229
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 11 and eosin for the identification of gonadal sex following the already described criteria (Ito et 230
al., 2005).
231
For both the estradiol treatment and ontogeny experiment, each set of primers was 232
tested in a range from 10 to 40 cycles, using 1:1 to 1:50 dilution of a cDNA mix derived from 233
the samples, in order to know the number of cycles where the product accumulation was in 234
the linear phase of the curve. The PCR primers, the amplification size and PCR conditions are 235
listed in Table 1. The -actin gene was used as a house-keeping control to adjust the cDNA 236
quantity of each sample. All PCR were performed using 1 l of each cDNA samples and the 237
PCR products were resolved using 1.2% agarose gel and then stained soaking the gel in a 1%
238
ethidium bromide solution, in order to avoid differences between gels and staining. Finally, 239
images were captured, digitalized and bands intensity analyzed with “Gel-Pro analyzer”
240
(Media Cybernetics) software.
241 242
In situ hybridization 243
Riboprobes, for radioactive in situ hybridization, were generated following the protocol 244
previously described by Menuet et al. (2003). The pjER (272bp, 32% homology with pjER ), 245
pjER (380pb, 40% homology with pjER ) and cyp19A2 (379bp) riboprobes were 246
synthesized from previously cloned fragments into pGEM-T easy vector. The anti-sense and 247
sense riboprobes were synthesized in vitro with T7 and SP6 RNA polymerase with plasmids 248
linealized with NdeI and ApaI, respectively.
249
The linearized DNA template (0.5 g) was incubated for 1 hour at 37°C in a solution 250
containing transcription buffer (1X), rATP (0.4mM), rCTP (0.4mM), rGTP (0.4mM), 251
[35S]UTP (5 Ci/ l), RNAse inhibitor (1.6U/ l), T7 or SP6 RNA polymerase and adjusted to 252
20 l with sterile water. The template was then digested with 1U RQ-1 DNase (37°C for 15 253
min). After incubation, 10 g yeast tRNA, dissolved in 8% formamide was added. Labelled 254
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 12 riboprobes were purified on a Sephadex G50 column, precipitated with 2vol ethanol 255
(containing 0.1vol. NaAc and 10 g tRNA), and resuspended in DTT 0.1M and stored at -80ºC 256
until use.
257
Each probe was tested in two adult brains previously fixed in 4% paraformaldehyde, 258
dehydrated in a series of alcohols, and embedded in paraffin. Sections (6 m) were collected 259
in two parallels treated slides with 3% (3-Aminopropyl)-triethoxy-saline (Sigma®) in acetone 260
and used with the sense or anti-sense probes. The slides were then deparaffined, rehydrated, 261
postfixed, treated with proteinase K (2 g/ml in Tris-HCl 50mM, EDTA 5mM, pH 8, for 262
7min), acetylated (triethanolamine 0.1M, pH 8, containing 0.25% acetic anhydride), and 263
dehydrated. After air-drying, tissue sections were hybridized with the labelled riboprobes (2 x 264
104 cpm of riboprobe/ml; 60 µl on each slide) and incubated overnight at 55°C in a humid 265
chamber. Following hybridization, the slides were washed with 5X SSC containing 10mM 266
DTT at 55°C for 30min and twice at 65°C with a highly stringent solution (2X SSC/50%
267
formamide, 10mM DTT). After three 10 min wash in NTE buffer (10mM Tris-HCl, 0.5M 268
NaCl, 85mM EDTA, pH 8), the sections were treated with RNAse A (10 g/ml NTE; 37°C for 269
30min) and then rinsed again with NTE buffer. The sections were then rinsed in 2X and 0.1X 270
SSC at room temperature for 15min each and then dehydrated in an ethanol series containing 271
0.3M ammonium acetate and air dried. Slides were then dipped in Ilford (Bron, France) K5 272
nuclear track emulsion and exposed during 2 or 3 weeks at 4°C for cyp19A2 and pjERs, 273
respectively. They were finally developed, counterstained with toluidine blue (0.01%) and 274
mounted. The slides were observed with a Nikon microscope (Eclipse E600, Japan) under 275
bright-field and dark-field illumination and digitally photographed. The nomenclature of 276
different brain areas were adopted from the atlas of the killifish Fundulus heteroclitus (Peter 277
et al., 1975).
278
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 13 Statistical analysis
280
Results are given as mean ± standard error of the mean (SEM). The expression 281
differences on the ontogenetical experiment was determined by one-way ANOVA followed 282
by Bonferroni’s multiple comparison test. The expression differences on the E2 treatment 283
experiment was determined by the Student´s t-test, using the Graphpad Prims4 software.
284
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 14 RESULTS
285 286
Cloning of pjERs cDNA 287
The full-length cDNA of pejerrey ER and ER were cloned from ovarian and 288
pituitary RNA using 5’ and 3’ RACE strategies. The pjER (EU284021) and pjER 289
(EU284022) cDNAs contained open reading frames of 2872bp and 2539bp in length, 290
encoding deduced proteins of 602 and 558 amino acid residues, with estimated molecular 291
weights of 66 and 62KDa, respectively.
292
Both pjERs sequences were found to comprise the characteristics domains: A/B, the 293
DNA binding or C, the D, the ligand binding or E and the F domains. The identity comparison 294
between human and pejerrey ER and ER domains showed that the A/B domain had low 295
amino acid conservation (among 13 to 20% of identity). In this domain, two serine-proline 296
residue motives, potential phosphorylation sites for mitogen-activated protein kinase (MAPK), 297
were found only in the pjER . A similar comparison on the C domain reflected high 298
conservation (82 to 92% of identity), and they were characterized by the presence of cysteine 299
residues involved in the conformation of the two zinc fingers. The D domain presented low 300
identity (14 to 19%), and the E/F domain (51 to 59% of identity) was characterized by the 301
presence of a highly conserved amino acid region known to be involved in the estrogen 302
binding and receptor transactivation.
303
Overall identities of pjER and pjER deduced amino acid sequences were 42.9%.
304
Pejerrey ER and human ER (hER ) had a 45.1% of identity and 44.1% with hER . 305
Similarly, comparison of pjER and hER had 49.7% and 43.5% with hER . This fact 306
together with the major phylogenetic lineages reinforced the idea that both pjERs were the 307
result of two paralogous genes, rather than the alternative splicing of only one gene (Fig. 1).
308
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 15 Tissue distribution of pjERs
310
Qualitative RT-PCR followed by hybridization blot analysis in 11 different tissues 311
(eye, gill, liver, kidney, spleen, gonads, olfactory epithelium, heart, muscle, intestine and 312
brain) from adult males and females were performed for both receptors. A ubiquitous 313
expression in tissues related or not to reproduction was observed for both receptors. The 314
identity of the amplification fragments was evidenced by hybridization with specific 315
radioactive probes (Fig. 2).
316 317
Expression of pjERs and cyp19A2 in brain from E2 treated males 318
The pjERs and cyp19A2 brain expression levels were measured by semi-quantitative 319
RT-PCR in total brain tissue of E2-implanted compared to vehicle implanted fish (Fig. 3). A 320
significant induction was observed for both pjERs and cyp19A2 in the brain of E2 treated 321
males (P<0.001).
322 323
Brain localization of pjERs. Comparison with cyp19A2 324
The brain localization of cyp19A2, pjER and pjER were performed by radioactive in 325
situ hybridization in adjacent tissue sections alternately treated with sense and antisense 326
probes. In all cases, hybridization with sense probes failed to show a preferential 327
accumulation of grain clusters on any particular brain area (data not shown).
328
A strong hybridization signal was observed on transverse sections of the forebrain 329
with the antisense cyp19A2 riboprobe. Such signals were detected over the ependymal cells 330
bordering virtually all aspects of the telencephalic and diencephalic ventricles including the 331
preoptic area and the thalamus (Fig. 4A-F). A much lower signal was detected in the 332
dorsomedial thalamus at the levels of the nucleus dorsomedialis thalami, and the nucleus 333
posterioris periventricularis (Fig. 4G-I). Also, a consistent signal was observed in the entire 334
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 16 mediobasal hypothalamus, i.e: in the nucleus lateral tuberis pars anterioris and posterioris, 335
the nucleus recessus lateralis, the nucleus recessus posterioris and the nucleus saccus 336
vasculosus (Fig. 4G-I). The ependymal cell layer of the tectum opticum was also consistently 337
labelled, as well as those cells directly contacting with the ventricle in the torus semicircularis 338
(Fig. 4J). A weak signal was also observed in the anterior pituitary gland (Fig. 6D). In the 339
same sections the signal was much more consistent in the nucleus lateralis tuberis (Fig. 6A).
340
Adjacent sections were also used to analyze pjER and pjER mRNA distribution and 341
also compared to cyp19A2 mRNA localization. Both pjER and pjER were consistently 342
evidenced in the anterior ventral preoptic area, a region where a strong cyp19A2 signal had 343
also been detected (Fig. 5A-C). A high magnification of this area evidenced that cyp19A2 was 344
almost exclusively expressed in the cells bordering the ventricle, while pjER expression had 345
a broader distribution from the ependyma extending over more laterally-situated brain cells;
346
pjER was not observed in the ependymal cell layer (Fig. 5D-F). In the mediobasal 347
hypothalamus, the nucleus lateralis tuberis exhibited both pjER and pjER mRNA 348
expression, together with a high cyp19A2 signal (Fig. 6A-C). The pituitary gland exhibited 349
grain clusters of cells expressing pjER mRNA in the proximal pars distalis. However, even 350
when pjER and cyp19A2 were less evident a faint expression of both genes in the pituitary 351
gland was detected (Fig. 6D-F). Finally, a weak pjER signal, with no evident pjER 352
expression, was also showed in the nucleus anterioris periventricularis and nucleus 353
preopticus, in good correlation with cyp19A2 expression (Fig. 7A-C). A similar distribution 354
pattern could be evidenced in the NRL bordering the third ventricle (Fig. 7D-F). However, in 355
these areas pjER mRNA did not seem to be present in cells contacting the ventricles.
356 357
Developmental expression of pjERs and cyp19A2 in the head of larvae during thermolabile 358
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 17 Semi-quantitative RT-PCR analyses of both pjERs and cyp19A2 genes were 360
performed on individual RNA samples taken from the head of larvae reared at feminizing or 361
masculinizing temperatures from hatching to week 7. The statistical analyses were performed 362
between the two temperatures on each week (Fig. 8A-C).
363
The expression of both pjERs was consistently detected as early as week 1. The 364
highest expression level of pjER was observed on the 4th week with no differences among 365
temperatures. On the other hand, at feminizing temperature, the expression of pjER failed to 366
evidence a clear profile when compared to masculinizing temperature. Also, the expression 367
remained at low levels from hatching to the 5th week, reaching a significantly higher 368
expression during week 6, compared with those observed at feminizing temperatures. The 369
expression of cyp19A2 was first detected at the 2ndweek at both temperatures. A significantly 370
higher expression level was detected at male-promoting temperature during week 3, when 371
compared to those observed at feminizing temperature. No significant differences were 372
observed among temperatures on the following weeks.
373
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 18 DISCUSION
374
In the present the existence of two different ERs was demonstrated in pejerrey fish.
375
This is based on the low sequence identity among the characterized cDNAs and the 376
phylogenetic analysis showing that both receptors can be grouped with the previously 377
described estrogen receptors and from different vertebrate species. The analysis of both 378
ER and ER clades showed that tetrapod branches segregated from those of bony fish 379
species. Moreover, the teleost fish ER clade was composed by two sub-clades, termed ER 1 380
and ER 2, being pjER clearly grouped in the ER 1 sub-clade.
381
Although different strategies of primers combinations were tested, a third pejerrey ER 382
could not be yet isolated (data not shown). This third ER belongs to the lineage and it is 383
supposed to originate from a gene or whole genome duplication early in the lineage leading to 384
teleosts (Amores et al., 1998). In this context, these paralogous lineages should be named as 385
ER 1 and ER 2 instead of ER as originally proposed (Hawkins et al., 2000). Then, based on 386
the homology with the ER 1 clade, the pjER should be named as pjER 1. Further studies 387
should be performed in order to demonstrate the presence of a third ER form in pejerrey.
388
The analysis of pjERs expression evidenced a broad tissue distribution, as already 389
described in several teleost species. Messengers were detected not only in those tissues 390
classically considered as E2 target, such us the brain, pituitary gland, ovary and liver; but also 391
in the testes, where increasing evidences suggest an important role of estrogens in male 392
reproduction (Miura et al., 1999; Couse et al., 2001). Furthermore, pjER expression was 393
described in other tissues not classically related to E2 (i.e.: eyes, kidney, gills and intestine).
394
This wide and overlapped tissue distribution suggested that pjERs may have different, 395
redundant functions, and/or different tissue specific regulation, giving additional complexity 396
to estrogen actions.
397
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 19 To study the effects of E2 on ER brain expression, pejerrey males were implanted with 398
E2 silastic capsules. The pjERs expression was significantly increased in the brains of E2 399
treated fish compared to controls, concomitantly with cyp19A2 expression. The positive auto- 400
regulatory effects of E2 on cyp19A2 expression was extensively demonstrated in other teleost 401
species (Kazeto et al., 2001; Tchoudakova et al., 2001; Chang et al., 2005) and further 402
supported by the presence of functional EREs in the zebrafish and goldfish cyp19A2 promoter 403
regions (Gelinas et al., 1998; Kishida and Callard, 2001; Menuet et al., 2005). The up- 404
regulation of pjER and pjER by E2 in brain was in agreement with previous results obtained 405
in rainbow trout (Salbert et al., 1993). Similarly in largemouth bass, both ER and ER (ER 1 406
according to the present phylogenetic study) were respectively highly and moderately induced 407
in the liver (Sabo-Attwood et al., 2004). These effects could be the consequence of the 408
presence of EREs in their promoter regions, as already described in the rainbow trout and 409
zebrafish ER genes (Petit et al., 1999; Menuet et al., 2004), and ERE half sites in the 410
promoter of the zebrafish ER gene (Lassiter et al., 2002). Additionally, as shown either by 411
RT-PCR (Kishida and Callard, 2001) or whole-mount in situ hybridization and 412
immunohistochemistry (Menuet et al., 2005), the cyp19A2 gene up-regulation by E2 in the 413
brain could be blocked by an excess of the E2 antagonist (ICI 182-780), indicating that 414
functional ERs were involved in this process. Taking together, all these results suggested the 415
presence of ERs in brain aromatase-containing cells.
416
In order to clarify the relationship between estrogen-sources and targets in pejerrey 417
brain, an in situ hybridization study using riboprobes against cyp19A2 and pjERs was 418
performed. A clear correspondence among the cyp19A2 messenger and protein localization 419
was observed (Strobl-Mazzulla et al., 2005), in agreement with the results obtained in the 420
plainfin midshipman (Forlano et al., 2001), rainbow trout (Menuet et al., 2003) and zebrafish 421
(Menuet et al., 2005; Pellegrini et al., 2007). In all these cases, brain aromatase was clearly 422
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 20 expressed in radial glial cells of the forebrain regions characterized by small nuclei close to 423
the ventricles and long radial processes extending throughout the parenchyma towards the 424
brain surfaces.
425
The analysis of adjacent sections showed a differential, but partly overlapped 426
distribution of both pjERs messengers. They were mainly found in the preoptic region, 427
mediobasal hypothalamus, the pituitary stalk and the pituitary gland itself highlighting the 428
fact that estrogen-targets in pejerrey brain were located in neuroendocrine relevant regions. A 429
similar brain distribution has been documented in many other teleost fish species in the case 430
of ER (Anglade et al., 1994; Hawkins et al., 2000; Menuet et al., 2000; 2003) and in two 431
species in the case of ER (Hawkins et al., 2000; Menuet et al., 2000). Therefore, further 432
studies are necessary to establish the association between ERs and the control of the 433
neuroendocrine function at different gonadal stages in this species.
434
A good association between the neuroanatomical expression sites of cyp19A2 and 435
pjERs was observed at the level of the preoptic area and the mediobasal hypothalamus. In the 436
preoptic area, the pjER , but not ER , seemed to be in the cells lining the ventricles similar to 437
the pattern observed for cyp19A2, suggesting that they are possibly co-expressed by the same 438
cells. Although in rainbow trout, in situ hybridization studies failed to demonstrate obvious 439
co-expression of ER and cyp19A2, RT-PCR on glial cells enriched cell cultures from adult 440
brains demonstrated possible co-expression (Menuet et al., 2003). Thus, it is possible that low 441
ER expression levels would be sufficient to induce the cyp19A2 up-regulation, making 442
difficult to establish a clear co-localization by conventional histological techniques. In this 443
context, subsequently Menuet et al. (2005) clearly demonstrated that the zebrafish cyp19A2 444
promoter was highly inducible by low levels of co-transfected ER in the presence of E2 only 445
under a specific glia-neuron cellular context.
446
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 21 During mammalian brain development, it is well known that locally-produced E2 447
exerts important functions through ERs for the establishment of neuronal circuits (Naftolin, 448
1994; Beyer, 1999), and is also important for the differentiation of sexually dimorphic 449
neuroendocrine areas in mammals (Lephart, 1996).
450
The crucial role of cyp19A1 in ovarian differentiation during early development of 451
teleost fish has been extensively studied (D´Cotta et al., 2001; Devlin and Nagahama, 2002).
452
However, there is some indication that brain aromatase (cyp19A2) and ERs could be involved 453
during early sex specific neural differentiation (D´Cotta et al., 2001; Trant et al., 2001; Tsai et 454
al., 2003; Van Nes et al., 2005; Van Nes and Andersen, 2006). In these studies, cyp19A2 455
expression was evidenced prior to the onset of cyp19A1 expression in the undifferentiated 456
gonadal primordium. According to this, in pejerrey fish the onset expression of cyp19A2 in 457
the head (week 2) preceded the expression of cyp19A1 in the trunk (week 5) before the first 458
signs of gonadal differentiation (Karube et al., 2007). The expression profile of ERs in the 459
head also showed different ontogenetic and temperature/sex-related differences. The 460
expression of pjER reached its highest levels, both at feminizing and masculinizing 461
temperatures on week 4, probably reflecting the activation of the brain-pituitary axis as 462
already described in this species (Miranda et al., 2003). Meanwhile, pjER expression did not 463
evidence a clear variation during the temperature sensitive window, but it appeared to 464
increase during the period of morphological gonadal differentiation. In this context, Tsai et al.
465
(2003) provided evidences showing that the expression of cyp19A2 and ERs, varied in 466
relation to rearing temperature and developmental period in tilapia. Taken together, the 467
present results suggest the involvement of the estrogen system on the brain sexual 468
differentiation in establishing the neuroendocrine circuits that directs the concomitant gonadal 469
differentiation. Then, it is important to note that it has been proposed that in TSD reptiles non- 470
gonadal tissues and principally the brain were the triggers that might direct sexual 471
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 22 differentiation of the gonads (Jeyasuria and Place, 1998). However, the relationship among 472
brain and gonadal sex differentiation is still not clear and needs further investigation.
473
In conclusion, this work provides information regarding estrogen production sites in 474
the brain of adult male and female pejerrey in relation to potential estrogen targets. There is a 475
close anatomical correspondence between the sites of brain aromatase and ERs expression 476
and, in some cases evidence for co-expression in the same cell-types. In addition to these 477
close neuroanatomical relationships, our results also further evidenced the existence of a 478
positive auto-regulatory loop through which estrogen promotes expression of its own 479
synthesis enzyme. Interestingly, we also found evidences that increased estrogens (and 480
probably aromatizable androgens) contents act not only to promote expression of aromatase, 481
but also that of ERs. Finally we showed that brain estrogen production and receptivity seem to 482
be turned on before the period of sexual differentiation raising interesting questions on the 483
role of these estrogens in fish sexual differentiation. Further studies are necessary to 484
investigate if these estrogens could be entirely produced de novo in the brain.
485
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 23 ACKNOWLEDGEMENTS
486
The authors would like to thank Gabriela López for her help in the preparation of histological 487
sections.
488
This study was supported by grants from CNRS French Ministery of Research and Education 489
(O.K.), ECOS-Sud project code A05B03 (O.K. and G.S.), the Ministry of Education, Culture, 490
Sports, Science and Technology of Japan Grant (#15201003 to C.A.S.), Agencia Nacional de 491
Promoción Científica y Tecnológica (ANPCYT, Argentina, Grant # 01-12168 and 15-38206 492
to G.M.S.) and The Texas Cooperative Fish and Wildlife Research Unit is jointly supported 493
by the U.S. Geological Survey, Texas Tech University, Texas Parks and Wildlife Department, 494
U.S. Fish and Wildlife Service, and Wildlife Management Institute.
495 496
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 24
REFERENCES 497
Amores, A., Force, A., Yan, Y-L., Joly, L., Amemiya, C., Fritz, A., Ho, R.K., Langeland, J., 498
Prince, V., Wang, Y.L., Westerfield, M., Ekker, M., Postlethwait, J. 1998. Zebrafish hox 499
clusters and vertebrate genome evolution. Science 282, 1711-1714.
500
Anglade, I., Pakdel, F., Bailhache, T., Petit, F., Salbert, G., Jego, P., Valotaire, Y., Kah, O.
501
1994. Distribution of estrogen receptor-immunoreactive cells in the brain of the rainbow trout 502
(Oncorhynchus mykiss). J. Neuroendocrinol. 6, 573-583.
503
Bardet, P.L., Horard, B., Robinson-Rechavi, M., Laudet, V., Vanacker, J.M., 2002.
504
Characterization of oestrogen receptors in zebrafish (Danio rerio). J. Mol. Endocrinol. 28, 505
153-163.
506
Beyer, C., 1999. Estrogen and the developing mammalian brain. Anat. Embryol. (Berl) 199, 507
379-390.
508
Callard G, Tchoudakova A, Kishida M, Wood, E. Differential tissue distribution, 509
developmental programming, estrogen regulation and promoter characteristics of CYP19 510
genes in teleost fish. J Steroid Biochem 2001; 79:305-314.
511
Carreau, S., Bourguiba, S., Lambard, S., Galeraud-Denis, I., Genissel, C., Levallet, J., 2002.
512
Reproductive system: aromatase and estrogens. Mol. Cell. Endocrinol. 193, 137-143.
513
Chang, X., Kobayashi, T., Senthilkumaran, B., Kobayashi-Kajura, H., Sudhakumari, C., 514
Nagahama, Y. 2005. Two types of aromatase with different encoding genes, tissue 515
distribution and developmental expression in Nile tilapia (Oreochromis niloticus). Gen.
516
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 25 Cheshenko, K., Pakdel, F., Segner, H., Kah, O., Eggen, R.I.L., 2008. Interference of 518
endocrine disrupting chemicals with aromatase CYP19 expression or activity, and 519
consequences for reproduction of teleost fish. Gen. Comp. Endocrinol. 155, 31-62.
520
Couse, J.E., Mahato, D., Eddy, E.D., Korach, K.S., 2001. Molecular mechanism of estrogen 521
action in the male: insights from the estrogen receptor null mice. Reprod. Fertil. Dev. 13, 211- 522
219.
523
D'Cotta, H., Fostier, A., Guiguen, Y., Govoroun, M., Baroiller, J.F., 2001. Aromatase plays a 524
key role during normal and temperature-induced sex differentiation of tilapia Oreochromis 525
niloticus. Mol. Reprod. Dev. 59, 265-276.
526
Devlin, R., Nagahama, Y., 2002. Sex determination and sex differentiation in fish: an 527
overview of genetic, physiological, and environmental influences. Aquaculture 208, 191-364.
528
Forlano, P.M., Deitcher, D.L., Bass, A.H., 2005. Distribution of estrogen receptor alpha 529
mRNA in the brain and inner ear of a vocal fish with comparisons to sites of aromatase 530
expression. J. Comp. Neurol. 483, 91-113.
531
Forlano, P.M., Deitcher, D.L., Myer, D.A., Bass, A.H., 2001. Anatomical distribution and 532
cellular basis for high levels of aromatase activity in the brain of teleost fish: Aromatase 533
enzyme and mRNA expression identify glia as source. J. Neurosci. 22, 8943-8955.
534
Gelinas, D., Pitoc, G.A., Callard, G.V., 1998. Isolation of a goldfish brain cytochrome P450 535
aromatase cDNA: mRNA expression during the seasonal cycle and after steroid treatment.
536
Mol. Cell. Endocrinol. 138, 81-93.
537
Goloboff, P., Farris, J., Nixon, K., 1999. TNT. Tree analysis using new technology.
538
Computer Program.
539
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 26 Green, S., Walter, P., Kumar, V., Krust, A., Bornert, J., Agros, P., Chambon, P., 1986.
540
Human oestrogen receptor cDNA: sequence, expression and homology to v-erb-A. Nature 541
320, 134-139.
542
Greytak, S.R., Callard, G.V., 2007. Cloning of three estrogen receptors (ER) from killifish 543
(Fundulus heteroclitus): differences in populations from polluted and reference environments.
544
Gen. Comp. Endocrinol. 150, 174-188.
545
Halm, S., Martinez-Rodriguez, G., Rodríguez, L., Prat, F., Mylonas, C.C., Carrillo, M., 546
Zanuy, S., 2004. Cloning, characterisation, and expression of three oestrogen receptors (ER , 547
ER 1 and ER 2) in the European sea bass, Dicentrarchus labrax. Mol. Cell. Endocrinol. 223, 548
63-75.
549
Hawkins, M., Thornton, J., Crews, D., Skipper, J., Dotte, A., Thomas, P., 2000. Identification 550
of a third distinct estrogen receptor and reclassification of estrogen receptors in teleosts. P.
551
Nat. Acad. Sci. U.S.A. 97, 10751-10756.
552
Ito, L.S., Yamashita, M., Takashima, F., Strüssmann, C.A., 2005. Dynamics and histological 553
characteristics of gonadal sex differentiation in pejerrey (Odontesthes bonariensis) at 554
feminizing and masculinizing temperatures. J. Exp. Zool. 303A, 504-514.
555
Jeyasuria, P., Place, A., 1998. Embryonic brain-gonadal axis in temperature-dependent sex 556
determination of reptiles: a role for P450 aromatase (CYP19). J. Exp. Zool. 281, 428-449.
557
Karube, M., Fernandino, J.I., Strobl-Mazzulla, P.H., Strüssmann, C.A., Yoshizaki, G., 558
Somoza, G.M., Patiño, R., 2007. Characterization and expression profile of the ovarian 559
cytochrome P-450 (CYP19A1) gene during the thermolabile sex determination period in 560
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 27 Kazeto, Y., Ijiri, S., Place, A.R., Zohar, Y., Trant, J.M., 2001. The 5´-flanking regions of 562
CYP19A1 and CYP19A2 in zebrafish. Biochem. Biophys. Res. Comm. 288, 503–508.
563
Kishida, M., Callard, G.V., 2001. Distinct cytochrome P450 aromatase isoforms in zebrafish 564
(Denio rerio) brain and ovary are differentially programmed and estrogen regulated during 565
early development. Endocrinology 142, 740-749.
566
Kitano, T., Takamune, K., Kobayashi, T., Nagahama, Y., Ibe, S-I., 1999. Suppression of P450 567
aromatase gene expression in sex-reversed males produced by rearing genetically female 568
larvae at a high water temperature during a period of sex differentiation in the Japanese 569
flounder (Paralichthys olivaceus). J. Mol. Endocrinol. 23, 167-176.
570
Krust, A., Green, S., Argos, P., Kumar, V., Walter, P., Bornert, J.M., Chambon, P., 1986. The 571
chicken oestrogen receptor sequence: homology with v-erbA and the human oestrogen and 572
glucocorticoid receptors. EMBO J. 5, 891-897.
573
Kuiper, G., Enmark, E., Pelto-Huikko, M., Nilsson, S., Gustafsson, J., 1996. Cloning of a 574
novel receptor expressed in rat prostate and ovary. P. Nat. Acad.Sci. U.S.A. 93, 5925-5930.
575
Lassiter, C., Kelley, B., Linney, E., 2002. Genomic structure and embryonic expression of 576
estrogen receptor beta a (ERbetaa) in zebrafish (Danio rerio). Gene 299, 141-151.
577
Lephart, E., 1996. A review of brain aromatase cytochrome P450. Brain Res. Rev. 22, 1-26.
578
McEwen, B.S., 2001. Estrogens effects on the brain: multiple sites and molecular 579
mechanisms. J. Appl. Physiol. 91, 2785-2801.
580
McEwen, B.S., 2002. Estrogen actions throughout the brain. Recent Prog. Horm. Res. 57, 581
357-384.
582
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 28 Menuet, A., Anglade, I., Le Guevel, R., Pellegrini, E., Pakdel, F., Kah, O., 2003. Distribution 583
of aromatase mRNA and protein in the brain and pituitary of female rainbow trout:
584
Comparison with estrogen receptor . J. Comp. Neurol. 462, 180–193.
585
Menuet, A., Le Page, Y., Torres, O., Kern, L., Kah, O., Pakdel, F., 2004. Analysis of the 586
estrogen regulation of the zebrafish estrogen receptor (ER) reveals distinct effects of ER , 587
ER 1 and ER 2. J. Mol. Endocrinol. 32, 975-986.
588
Menuet, A., Pellegrini, E., Anglade, I., Blaise, O., Laudet, V., Kah, O., Pakdel, F., 2000.
589
Molecular characterization of three estrogen receptor forms in zebrafish: binding 590
characteristics, transactivation properties, and tissue distributions. Biol. Reprod. 66, 1881- 591
1892.
592
Menuet A, Pellegrini E, Brion F, Gueguen MM, Anglade I, Pakdel F, Kah O., 2005.
593
Expression and estrogen-dependent regulation of the zebrafish brain aromatase gene. J.
594
Comp. Neurol. 485, 304-320.
595
Miranda, L.A., Strobl-Mazzulla, P.H., Strüssmann, C.A., Parhar, I.S., Somoza, G.M., 2003.
596
Gonadotropin-releasing hormone neuronal development during the sensitive period of 597
temperature sex determination in the pejerrey fish, Odontesthes bonariensis. Gen. Comp.
598
Endocrinol. 132, 444-453.
599
Miura, T., Miura, C., Ohta, T., Nader, M., Todo, T., Yamauchi, K., 1999. Estradiol-17beta 600
stimulates the renewal of spermatogonial stem cells in males. Biochem. Bioph. Res. Co. 264, 601
230-234.
602
Naftolin, F., 1994. Brain aromatization of androgens. J. Reprod. Med. 39, 257-261.
603
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 29 estrogen receptor family in the rainbow trout: Discovery of the novel ER 2 and both ER 605
isoforms. Gene 392, 164-173.
606
Nilsson, S., Makalena, S., Treuter, E., Tujague, M., Thomsen, J., Andersson, G., Enmark, E., 607
Pettersson, K., Wariner, M., Gustafsson, J., 2001. Mechanisms of estrogen action. Physiol.
608
Rev. 81, 1536-1554.
609
Pakdel, F., Le Guellec, C., Vaillant, C., Le Roux, M.G., Valotaire, Y. 1989., Identification 610
and estrogen induction of two estrogen receptors (ER) messenger ribonucleic acids in the 611
rainbow trout liver: sequence homology with other ERs. Mol. Endocrinol. 93, 44-51.
612
Pasmanik, M., Callard, G.V., 1985. Aromatase and 5 -reductase in the teleost brain, spinal 613
cord, and pituitary gland. Gen. Comp. Endocrinol. 60, 244-251.
614
Pellegrini, E., Menuet, A., Lethimonier, C., Adrio, F., Gueguen, M.M., Tascon, C., Anglade, 615
I., Pakdel, F., Kah, O., 2005. Relationships between aromatase and estrogen receptors in the 616
brain of teleost fish. Gen. Comp. Endocrinol. 142, 60-66.
617
Pellegrini E, Mouriec K, Anglade I, Menuet A, Le PY, Gueguen M, Marmignon M, Brion F, 618
Pakdel F, Kah O., 2007. Identification of aromatase-positive radial glial cells as progenitor 619
cells in the ventricular layer of the forebrain in zebrafish. J. Comp. Neurol. 501, 150-167.
620
Peter, R., Macey, M., Gill, E., 1975. A stereotaxic atlas of technique for forebrain nuclei of 621
the killifihs, Fundulus heteroclitus. J. Comp. Neurol. 159, 103-128.
622
Petit, F., Metivier, R., Valotaire, Y., Pakdel, F., 1999. Synergism between a half-site and an 623
imperfect estrogen-responsive element, and cooperation with COUP-TFI are required for 624
estrogen receptor (ER) to achieve a maximal estrogen-stimulation of rainbow trout ER gene.
625
Eur. J. Biochem. 259, 385-395.
626
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 30 Sabo-Attwood, T., Kroll, K.J., Denslow, N.D., 2004. Differential expression of largemouth 627
bass (Micropterus salmoides) estrogen receptor isotypes alpha, beta, and gamma by estradiol.
628
Mol. Cell. Endocrinol. 218, 107-118.
629
Salbert, G., Atteke, C., Bonnec, G., Jego, P., 1993. Differential regulation of the estrogen 630
receptor mRNA by estradiol in the trout hypothalamus and pituitary. Mol. Cell. Endocrinol.
631
96, 177-182.
632
Simerly RB. Wired for reproduction: organization and development of sexually dimorphic 633
circuits in the mammalian forebrain. Ann Rev Neurosci 2002; 25:507-536.
634
Strobl-Mazzulla, P.H., Moncaut, N.P., Lopez, G.C., Miranda, L.A., Canario, A.V.M., 635
Somoza, G.M., 2005. Brain aromatase from pejerrey fish (Odontesthes bonariensis): cDNA 636
cloning, tissue expression, and immunohistochemical localization. Gen. Comp. Endocrinol.
637
143, 21-32.
638
Strüssmann, C.A., Moriyama, S., Hanke, E.F., Calsina Cota, J.C., Takashima, F., 1996.
639
Evidence of thermolabile sex determination in pejerrey. J. Fish Biol. 48, 643-651.
640
Strüssmann, C.A., Saito, T., Usui, M., Yamada, H., Takashima, F., 1997. Thermal thresholds 641
and critical period of thermolabile sex determination in two atherinid fishes, Odontesthes 642
bonariensis and Patagonina hatcheri. J. Exp. Zool. 278, 167-177.
643
Tchoudakova, A., Kishida, M., Wood, E., Callard, G.V., 2001. Promoter characteristics of 644
two cyp19 genes differentially expressed in the brain and ovary of teleost fish. J. Biochem.
645
Mol. Biol. 78, 427-439.
646
Thompson, J., Higgins, D., Gibson, T., 1994. CLUSTAL W: improving the sensitivity of 647
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 31 penalties and weight matrix choice. Nucleic Acids Res. 22, 4673-4680.
649
Thornton, J.W., 2001 Evolution of vertebrate steroid receptors from an ancestral estrogen 650
receptor by ligand exploitation and serial genome expansions. P. Natl. Acad. Sci. U.S.A. 98, 651
5671-5676.
652
Toran-Allerand C.D., 2005. Estrogen and the brain: beyond ER- , ER- , and 17 -estradiol.
653
Ann NY Acad Sci 1052, 136-144.
654
Trant, J., Gavasso, S., Ackers, J., Chung, B-C., Place, A., 2001. Developmental expression of 655
cytochrome P450 aromatase genes (CYP19a and CYP19b) in zebrafish fry (Danio rerio). J.
656
Exp. Zool. 290, 475–483.
657
Tsai, C.L., Chang, S.L., Wang, L.H., Chao, T.Y., 2003. Temperature influeces the 658
ontogenetic expression of aromatase and oestrogen receptor mRNA in the developing tilapia 659
(Oreochromis mossambicus) brain. J. Neuroendocrinol. 15, 97-102.
660
Van Nes, S., Andersen, O., 2006. Temperature effects on sex determination and ontogenetic 661
gene expression of the aromatases cyp19a and cyp19b, and the estrogen receptors esr1 and 662
esr2 in atlantic halibut (Hippoglossus hippoglossus). Mol. Reprod. Dev. 73, 1481-1490.
663
Van Nes, S., Moe, M., Andersen, O., 2005. Molecular characterization and expression of two 664
cyp19 (P450 aromatase) genes in embryos, larvae, and adults of Atlantic halibut 665
(Hippoglossus hippoglossus). Mol. Reprod. Dev. 72, 437-449.
666
Wernersson, R., Pedersen, A.G., 2003. RevTrans. Multiple alignment of coding DNA from 667
aligned amino acid sequences. Nucleic Acids Res. 31, 3537-3539.
668 669
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 32 TABLE AND FIGURE LEGENDS
670
671
Table 1: Characteristics of the PCR primers: name of the primers, sequence, gene position, 672
anneling temperature (AT) and size of the amplification products.
673 674
Figure 1: Phylogenetic tree from the deduced amino acid sequences from vertebrate ERs 675
obtained from the GenBank database. The alignment was carried out by the ClustalW method.
676
The numbers in the different nodes represent the robustness values of the internal branches 677
calculated by re-sampling (bootstrap) with 1,000 replicates. The human progesterone receptor 678
was used as an out group.
679 680
Figure 2: Expression profile of pjERs in different organs and tissues detected by RT-PCR 681
and hybridization blotting. E, eyes; Gi, gills; L, liver; K, kidney; S, spleen; G, gonads; OM, 682
olfactory mucosa; H, heart; M, muscle; I, intestine; and B, brain.
683 684
Figure 3: Expression of cyp19A2 and pjERs in male brains (n=6) ten days after the E2 pellet 685
implantation. All values are presented as mean ± SEM. Significant differences (**) between 686
control and treated fish were determined by Student’s t-test (P <0.001).
687 688
Figure 4: Neuroanatomical distribution of cyp19A2 by in situ hybridization. Each micrograph 689
shows the bright-field (left) and dark-field (right) of successive brain transversal sections. For 690
abbreviations see the abbreviation list. Scale bars indicate 125 µm.
691 692
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 33 and bright-field high magnification of boxed areas (D-F). Scale bars indicate 100 (A-C) and 695
50 (D-F) µm.
696 697
Figure 6: Co-regionalization of cyp19A2 (A, D), pjER (B, E) and pjER (C, F) in the 698
nucleus lateralis tuberis (NLTa) and pituitary gland (Pit) by in situ hybridization. Scale bars 699
indicate 100 µm.
700 701
Figure 7: Co-regionalization of cyp19A2 (A, D), pjER (B, E) and pjER (C, F) in the 702
posterior preoptic area (NPP and NPO) and the third ventricle and recesses (NRL) by in situ 703
hybridization. Scale bars indicate 100 µm.
704 705
Figure 8: Semi-quantitative RT-PCR analysis of cyp19A2 and pjERs expression on 706
individual head of pejerrey larvae during the sex determination/differentiation period (0-7 707
weeks after hatching) at female (17°C) and male (29°C) promoting temperatures. All values 708
are presented as mean ± SEM. Significant differences (**) between temperatures were 709
determined by one way ANOVA followed Bonferroni’s multiple comparison test (P <0.05).
710 711
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 34 ABBREVIATION LIST
712 713
Dm Area dorsalis telencephali pars medialis 714
NAPv Nucleus anterioris periventricularis 715
NDM Nucleus dorsomedialis thalami 716
NLTa Nucleus lateral tuberis pars anterioris 717
NLTp Nucleus lateral tuberis pars posterioris 718
NPO Nucleus preopticus 719
NPP Nucleus preopticus periventricularis 720
NPPv Nucleus posterioris periventricularis 721
NRL Nucleus recessus lateralis 722
NRP Nucleus recessus posterioris 723
NSV Nucleus saccus vasculosus 724
NVM Nucleus ventromedialis thalami 725
OC Optic chiasma
726
OT Optic tract 727
OTec Optic tectum 728
P or Pit Pituitary 729
TL Torus longitudinalis 730
TS Torus semicircularis 731
VCe Valvula cerebelli 732
Vd Area ventralis telencephali pars dorsalis 733
Vp Area ventralis telencephali pars postcommisuralis 734
Vv Area ventralis telencephali pars ventralis 735
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 35 Fig.1
736
737
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 36 Fig.2
738
739
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 37 Fig.3
740
741
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 38 Fig.4
742
743
ACCEPTED MANUSCRIPT
Brain aromatase and estrogen receptors in pejerrey 39 Fig.5
744
745
