[PDF] Top 20 A promoção de competências de aprendizagem em ambientes online no ensino da matemática
Has 10000 "A promoção de competências de aprendizagem em ambientes online no ensino da matemática" found on our website. Below are the top 20 most common "A promoção de competências de aprendizagem em ambientes online no ensino da matemática".
Targeting Promyelocytic Leukemia Protein: A Means to Regulating PML Nuclear Bodies
... of PML Expression Transcriptional induction of PML is an impor- tant mechanism by which extracellular signals can orchestrate a response involving PML ...activate PML tran- scription, leading ... See full document
31
Epstein Barr virus latent membrane protein 1 suppresses reporter activity through modulation of promyelocytic leukemia protein nuclear bodies
... the nuclear fraction (supernatant) was removed. Nuclear (PML and mem- brane (LMP1) fractions were combined with 4X Laemmli Buffer ( 240 mM Tris, 8% SDS, 40% glycerol, 10% 2-mercaptoethanol, ...of ... See full document
130
Promyelocytic Leukemia Isoform IV Confers Resistance to Encephalomyocarditis Virus via the Sequestration of 3D Polymerase in Nuclear Bodies
... blotting (Fig. 3A) and in CHO cells by immunofluorescence anal- ysis is shown (Fig. 3C). These cells were infected with EMCV, and their extracts were tested by Western blotting for viral proteins (Fig. 3A and C) and for ... See full document
45
The Alphaherpesvirus Serine/Threonine Kinase Us3 Disrupts Promyelocytic Leukemia Protein Nuclear Bodies
... of PML-NBs, Vero cells transfected with a plasmid encoding HSV-2 Us3 were stained with a rabbit polyclonal antiserum that detects all known nu- clear isoforms of ...of PML-NBs was diminished in cells ... See full document
299
Adenovirus E1B 55-Kilodalton Protein Is a p53-SUMO1 E3 Ligase That Represses p53 and Stimulates Its Nuclear Export through Interactions with Promyelocytic Leukemia Nuclear Bodies
... with PML-nb and efficient p53 nuclear export and ...E1B-55K nuclear localization (22). But since nuclear E1B-55K is associated with PML-nb (19, 48) ...with PML-nb association for ... See full document
293
The PML/RARalpha fusion protein inhibits tumor necrosis factor alpha induced apoptosis in U937 cells and acute promyelocytic leukemia blasts
... the promyelocytic stage of ...the PML/RAR a fusion gene, generated by the t(15;17) translocation ...10); PML encodes a protein of unknown function localized in nuclear structures called ... See full document
7
Components of Promyelocytic Leukemia Nuclear Bodies (ND10) Act Cooperatively To Repress Herpesvirus Infection
... hDaxx, PML, and ...and PML together, than in the controls ...viral protein expression in depleted and nondepleted ...of PML, Sp100, and hDaxx that might occur during ICP0-null mutant HSV-1 ... See full document
82
The ND10 Component Promyelocytic Leukemia Protein Relocates to Human Papillomavirus Type 1 E4 Intranuclear Inclusion Bodies in Cultured Keratinocytes and in Warts
... with nuclear HPV1 E4 inclusion ...various nuclear structures: coiled bodies, nucleoli, and ND10 ...Coiled bodies were visualized by using a MAb to coilin (3) (a gift from Maria Carmo-Fonseca, ... See full document
20
Promyelocytic Leukemia Protein (PML) Controls Listeria monocytogenes Infection
... that PML does not control infection by Salmonella Typhi- murium, even though this pathogen was also shown to induce a decrease in the Ubc9 level ...putative PML-regulated genes induced during Salmonella ... See full document
96
The Heteroaryldihydropyrimidine Bay 38-7690 Induces Hepatitis B Virus Core Protein Aggregates Associated with Promyelocytic Leukemia Nuclear Bodies in Infected Cells
... although PML NBs have been reported to contain proteasomal subunits ...of nuclear Cp is dependent on cell division, likely due to exposure of the aggregates to cytoplasmic proteasomes after breakdown of the ... See full document
22
The ND10 Component Promyelocytic Leukemia Protein Acts as an E3 Ligase for SUMOylation of the Major Immediate Early Protein IE1 of Human Cytomegalovirus
... of PML SUMOmut in normal HFFs and PML-kd cells (siPML2) ...endogenous PML (HFFs), the SUMO-deficient mutant (SUMOmut) localized exclusively to ND10 ...the targeting of PML SUMOmut to ... See full document
13
Functional Reorganization of Promyelocytic Leukemia Nuclear Bodies during BK Virus Infection
... many nuclear components, and subnuclear structures such as promyelocytic leukemia nuclear bodies (PML-NBs) are known to play regulatory roles during a number of DNA virus ... See full document
117
Assembly of Epstein-Barr Virus Capsid in Promyelocytic Leukemia Nuclear Bodies
... mutated nuclear localization signal (NLS) was amplified using primers borf1mut-F (5=-CGCGGATCC ATGAAGGTCCAGGGGTCCGTCGATCGCCGCCGTCTGCAAGCCG CAATCGCGGGGCTGCTG) and ...fluorescent protein (GFP)-tagged BFRF3 ... See full document
11
Epstein-Barr Virus Immediate-Early Protein BZLF1 Is SUMO-1 Modified and Disrupts Promyelocytic Leukemia Bodies
... disperse nuclear structures known as promyelocytic leukemia (PML, also called nuclear domain 10 [ND10]) ...for PML body dispersion in HSV-1 and CMV are the immediate-early pro- ... See full document
61
Rearrangements of the retinoic acid receptor alpha and promyelocytic leukemia zinc finger genes resulting from t(11;17)(q23;q21) in a patient with acute promyelocytic leukemia
... cytogenetic data. Similar to t(15;17) APL, all-trans retinoic acid treatment in this patient produced an early leukocytosis which was followed by a myeloid maturation, but the patient died too early to achieve remission. ... See full document
118
Epstein-Barr Virus Nuclear Antigen 1 Hijacks the Host Kinase CK2 To Disrupt PML Nuclear Bodies
... the PML NBs are still largely intact ...and PML, showed that, in cells lacking EBNA1 expression, USP7 gave mostly diffuse nuclear staining and formed a small number of foci that were associated with ... See full document
78
Absolute quantification of the pretreatment PML-RARA transcript defines the relapse risk in acute promyelocytic leukemia
... the PML-RARA fusion gene, as reported ...of promyelocytic leukemic cells in bone marrow aspirate. PML-RARA expression analysis by ddPCR was performed in 76 patients with sufficient available material ... See full document
13
PML RARA requires DNA methyltransferase 3A to initiate acute promyelocytic leukemia
... myeloid leukemia (AML) ...as PML- RARA and RUNX1-RUNX1T1 (also referred to as AML-ETO) and MLL fusion genes such as MLL-AF9 (1, 2), suggesting a possible relationship between these fusion oncogenes and a ... See full document
134
Emerging Role of PML Nuclear Bodies in Innate Immune Signaling
... romyelocytic leukemia (PML) protein, a member of the tri- partite motif (TRIM) protein family, is the key component of subnuclear structures known as PML nuclear bodies ... See full document
4
<p>A rare case of acute promyelocytic leukemia with IRF2BP2-RARA fusion; and literature review</p>
... of leukemia cells revealed the karyotype 45, X, -X (Figure ...myelogenous leukemia including PML-RARA, PLZF-RARA, and ...with PML or other gene ...of PML-RARA, NPM-RARA, NuMA-RARA, ... See full document
27
Related subjects