• No se han encontrado resultados

[PDF] Top 20 Políticas e práticas de recursos humanos na autarquia de Évora

Has 10000 "Políticas e práticas de recursos humanos na autarquia de Évora" found on our website. Below are the top 20 most common "Políticas e práticas de recursos humanos na autarquia de Évora".

Depósitos para gasóleo

Molecular analysis and antimicrobial resistance pattern of distinct strains of Pseudomonas aeruginosa isolated from cystic fibrosis patients in Iran

... CF patients, as a chronic disease, is in agreement with results reported by Feltman et ...P. aeruginosa isolates with an advantage in colonizing or persisting in CF ...P. aeruginosa pulmonary ... See full document

27

Patrones de actividad física semanal: un estudio con población infantil

Evaluation of Reference Dilution Test Methods for Antimicrobial Susceptibility Testing of Pseudomonas aeruginosa Strains Isolated from Patients with Cystic Fibrosis

... of patients with cystic fibrosis (CF) has dramatically increased over the past two decades in parallel with the development of antibiotics with activity against Pseudomonas aeruginosa ... See full document

10

Cambio climático: medidas de adaptación en comunidades de las Regiones Autónomas de la Costa Caribe de Nicaragua

Heterogeneous Antimicrobial Susceptibility Characteristics in Pseudomonas aeruginosa Isolates from Cystic Fibrosis Patients

... of Pseudomonas aeruginosa from patients with cystic fi- brosis (CF) are known to differ from those associated with non-CF hosts by colony morphology, drug susceptibility patterns, ... See full document

85

Metodología adaptativa basada en un modelo de seguridad informática en redes privadas virtuales para mejorar el intercambio de información académica contextualizada en entornos de conexiones públicas

Antimicrobial Resistance Pattern and Presence of Beta-Lactamase Genes in Pseudomonas aeruginosa Strains Isolated from Hospitalized Patients, Babol-Iran

... inherent resistance to many antibiotics, including third- generation cephalosporins, imipenem, and aztreonam ...to molecular structure the subgroup B1 is classified into four categories: blaIMP, blaVIM, ... See full document

171

INFORME DE PASANTÍA EN CÁMARA CHILENA DE LA CONSTRUCCIÓN A.G.

Proteomic Identification of OprL as a Seromarker for Initial Diagnosis of Pseudomonas aeruginosa Infection of Patients with Cystic Fibrosis

... P. aeruginosa OprL and expression and purifi- cation of recombinant OprL from Escherichia ...amplified from PAO1 DNA with 5⬘ (5⬘ GATCGACATATGGAAATGCTGAA ATTCGGCAAATTTGCT 3⬘) and 3⬘ (5⬘ ... See full document

67

Factores psicosociales en la orientación del consumo: hacia un consumo compatible con la sustentabilidad.

Emergence of Pseudomonas aeruginosa cross-infection in children with cystic fibrosis attending an Iranian referral pediatric center.

... ERIC-PCR. ERIC-PCR typing of the clinical and environmental isolates using two oligonucleotide primers, ERIC1 (5’ATGTAAGCTCCTGGGGA- TTCAC3’) and ERIC2 (5’ AAGTAAGTGACTG- GGGTGAGCG 3’) was done as described previously ... See full document

228

Procedimiento para el mejoramiento y la gestión por procesos aplicado a la Empresa de Investigaciones y Proyectos Hidráulicos de Villa Clara (EIPH VC)

Comparative analysis of serum antibody responses to Pseudomonas aeruginosa exotoxin A by cystic fibrosis and intensive care unit patients

... Comparative Analysis of Serum Antibody Responses to Pseudomonas aeruginosa Exotoxin A by Cystic Fibrosis and Intensive Care Unit Patients.. Pulmonary infection with Pseudomonas aeruginos[r] ... See full document

122

La vitamina D y su relacin con algunos elementos del sndrome metablico en poblacin de edad mediana

High incidence of type III secretion system associated virulence factors (exoenzymes) in Pseudomonas aeruginosa isolated from Iranian burn patients

... acquired resistance to the broad range of conventional antibiotics, treatment of the infections caused by ...P. aeruginosa has been limited ...multidrug resistance (MDR) P. aeruginosa ... See full document

13

Diario de acontecimientos referentes a España durante los meses de abril y mayo de 1970

Conversion of Pseudomonas aeruginosa to the phenotype characteristic of strains from patients with cystic fibrosis

... Isolates of Pseudomonas aeruginosa from cystic fibrosis patients are unusual; they are often susceptible to the bactericidal effect of human serum, have a rough lipopolysaccharide, and p[r] ... See full document

40

Determinación de los parametros optimos en la obtención de una bebida funcional a partir de cascarilla de cacao (Theobroma cacao L ) y su nivel de aceptación comercial en la Ciudad de Huánuco

Study of metallo beta lactamase production and biofilm formation of pseudomonas aeruginosa in clinical isolates

... hospitalized patients. In our study most of the isolates were collected from pus ...were from pus and 20% from ...are isolated from pus/swab followed by 16% from urine and ... See full document

82

ENFERMEDAD ARTICULAR DEGENERATIVA DE LOS PERROS

Twenty Five Year Outbreak of Pseudomonas aeruginosa Infecting Individuals with Cystic Fibrosis: Identification of the Prairie Epidemic Strain

... several strains have been shown to have a dele- terious impact on outcome measures of CF as diverse as quality of life, treatment burden, exacerbation frequency, and progression to end-stage lung disease, others ... See full document

35

La educación ecopedagógica y su influencia en la inteligencia emocional de los estudiantes de primaria de la Institución Educativa Parroquial Santa Matilde - 2016

Binding of nonmucoid Pseudomonas aeruginosa to normal human intestinal mucin and respiratory mucin from patients with cystic fibrosis

... (from cystic fibrosis sputum and control intestinal secretions) exhibited specific binding of nonmucoid ...P. aeruginosa to mucins versus bovine serum albumin, casein, gelatin, or a host of ... See full document

184

La contribución territorial en España

The Effect of Sub-MIC β-Lactam Antibiotic Exposure of Pseudomonas aeruginosa Strains from People with Cystic Fibrosis in a Desiccation Survival Model

... 2.4.2. Weibull Model. The Weibull model of bacterial decay is a nonlinear model. It assumes that lethal events are probabilities and that the corresponding survival curves are cumulative forms of a distribution of lethal ... See full document

16

Síntesis y caracterización de copolímeros bloque para el desarrollo de patrones periódicos en la nano-escala

Phenotypic Characterization of Clonal and Nonclonal Pseudomonas aeruginosa Strains Isolated from Lungs of Adults with Cystic Fibrosis

... clonal strains is critical for the development of effective strategies to address this ...clone isolated from patients with microbial keratitis has been characterized by high activi- ties of ... See full document

208

CarsonPresentation_noanim_thisone.pdf

Lytic activity by temperate phages of Pseudomonas aeruginosa in long term cystic fibrosis chronic lung infections

... Morphology of Pseudomonas aeruginosa phages from the sputum of cystic fibrosis patients and from the phage typing set.. An electron microscopy study.[r] ... See full document

82

Impacto acadmico de una estrategia de saln invertido en Anatoma

No benefit of longer eradication therapy of Pseudomonas aeruginosa primoinfections in pediatric cystic fibrosis

... data from 20 primoinfec- tions treated with our eradication protocol since June 1st, 2007, eradication rate of ...60 patients), we estimated a minimum needed of 49 pri- moinfections (confidence interval ... See full document

7

Perfil dos vendedores ambulantes de rua em Díli, Timor-Leste

Prevalence and antibiogram of Pseudomonas aeruginosa isolated from various clinical samples in a tertiary care ICU setting

... P. aeruginosa are frequently life-threatening and difficult to treat as it exhibits intrinsically high resistance to many antimicrobials ...[4]. Resistance to multiple drugs is usually the result of ... See full document

71

Jardín vertical y… ¡lo contamos!

Purification, characterization, and immunological cross reactivity of alginates produced by mucoid Pseudomonas aeruginosa from patients with cystic fibrosis

... Antibody to multiple mucoid strains of Pseudomonas aeruginosa in patients with cystic fibrosis, measured by an enzyme-linked immunosorbent assay.. Aspinall ed., The polysaccharides, vol [r] ... See full document

49

DISEÑO Y CONSTRUCCION DE UN SISTEMA DE CALENTAMIENTO DE AGUA A BASE DE BIOGAS, COMO FUENTE DE ENERGIA./

Population Structure and Antimicrobial Susceptibility of Both Nonpersistent and Persistent Pseudomonas aeruginosa Isolates Recovered from Cystic Fibrosis Patients

... P. aeruginosa isolates representing nonpersistent and persistent clones re- covered from a Spanish CF ...BAPS analysis depicts a deeper picture of the P. aeruginosa population structure ... See full document

59

Planificación financiera

Antibiotic Susceptibility of Pseudomonas Aeruginosa Isolated from Cystic Fibrosis Patients

... 11.West SE1, Zeng L, Lee BL, Kosorok MR, Laxova A, Rock MJ, et al. Respiratory infections with Pseudomonas aeruginosain children with cystic fibrosis: early detection by serology and assessment of ... See full document

8

Show all 10000 documents...