3.2.1
Lichen samples
The Usnea specimens used in this experiment were selected haphazardly from freshly collected specimens (less than three months old) out of the Usnea lichens collected for this project (described in Section 4.2.1). Three lichen specimens were used for each DNA extraction method. The consistency of sample preparation was controlled by using approximately the same amount of lichen sample for each DNA extraction. Because measuring the exact size of each sample was difficult, the thallus sections were kept within 1 to 2 cm long by shortening the branch/sub-branches when required.
3.2.2
Surface sterilisation
To eliminate the number of microorganisms growing on lichen thalli and therefore reduce the risk of contamination, a surface sterilisation protocol was used. Thallus sections, 1-2 cm long, were rinsed using running tap water for 10 seconds. Each thallus was sterilised by immersion in 70% ethanol for 10 seconds followed by rinsing in water, then immersion in 1% sodium hypochlorite solution (20%, v/v commercial bleach) for 10 seconds followed by rinsing three times with water, and lastly the surface sterilised thalli were air dried by placing under laminar air flow for 20 minutes.
3.2.3
Total genomic DNA extraction
To determine which method was best for the extraction of DNA from several Usnea specimens in this study, different methods of DNA extraction was tested. The methods were generally classified into two groups of (1) commercially available DNA extraction kits and (2) an optimised CTAB published protocol for DNA extraction from lichens.
3.2.3.1 Commercially available DNA extraction kits
Seven DNA isolation kits namely, REDEXTRACT-N-AmpTM Plant PCR Kit (Sigma-Aldrich, USA), DNeasy® Plant Mini Kit (QIAGEN, Valencia, CA, USA), Dneasy® Blood & Tissue Kit (QIAGEN, Hilden, Germany), Isolate Plant DNA Mini Kit (Bioline, London, UK), PowerSoil® DNA Isolation Kit (MoBio Laboratories, Carlsbad, CA), GF-1 Plant DNA Extraction Kit (Vivantis, Selangor, Malaysia), and PUREGENE® kit (Cell Lysis Solution (Lot No. 8335812) + Protein Precipitation Solution (Lot No. 8335997) from QIAGEN, Maryland, USA) were evaluated. DNA from three samples (collected less than a three months before this study done) was extracted using each one of these kits.
The REDEXTRACT-N-AmpTM Plant PCR Kit is a fast kit that allows DNA extraction within about 20 minutes. Briefly, 100 µl of the extraction solution was added into the surface sterilised lichen sample
and incubated at 95°C for 15 minutes after which 100 µl of dilution solution was added and the tube vortexed for 10 seconds.
The Dneasy® Plant Mini Kit is the most commonly used DNA extraction kit for lichen based on the literature (e.g. Mansournia et al. (2012), Singh et al. (2012), and Sohrabi et al. (2013)). This kit was used according to the manufacturer’s protocol with a slight modification. Briefly, the surface sterilised lichen samples were ground to fine powder in liquid nitrogen using sterilised mortars and pestles. Samples were incubated for 120 minutes at 65°C after adding 400 µl of the lysis buffer (AP1) and RNase A (4 µl) at concentration of 20 mg/ml. Proteins and polysaccharides were precipitated at the next step by adding 130 µl of the precipitation buffer. After this a few steps for reducing the amount of contamination (RNA, proteins, and polysaccharides) were undertaken; DNA molecules were bound to the membrane of the spin column (Dneasy Mini spin column) by centrifuging the samples. The membrane was washed twice of other compounds using the wash buffer (Buffer AW). Lastly the DNA was eluted using 50µl of the elution buffer (Buffer AE), which is 10 mM Tris.Cl and 5 mM EDTA, at pH 9.0.
The Dneasy® Blood & Tissue Kit is recommended as a suitable kit for samples containing a high amount of protein and has been designed to remove a higher amount of protein than the Dneasy® Plant Mini Kit. This kit has also been used several times for extracting total genomic DNA from lichens (Sohrabi et al., 2011; Wang et al., 2012a). The manufacture’s protocol was very similar to the Dneasy® Plant Mini Kit; however, 20 µl of proteinase K solution (600 mAU/ml) was also added to the samples at the lysis stage of extraction.
The Isolate Plant DNA Mini Kit, which has never been used for extraction of DNA from lichens, was tested in this study. Briefly, the samples were frozen using liquid nitrogen and each sample was ground to fine powder using a mortar and pestle. Samples were lysed by incubating at 65°C for 120 minutes after adding 400 µl of the Lysis Buffer and RNase A (3 µl) solution (20 mg/ml). The Precipitation Buffer (100 µl) was added into the lysed samples and the proteins were precipitated after incubating the samples on ice for 5 minutes followed by centrifuging. The samples were filtered to remove unwanted particulate material using the first spin column (PD1) and the Binding Buffer was added to the filtrates. The DNA in the binding buffer was bound to the membrane in the second spin column (PD2). The membrane and DNA molecules were rinsed twice using the Wash Buffer (700 µl) containing 96% ethanol. The DNA was eluted from the membrane after 1 minute incubation at room temperature using 50 µl of provided elution buffer.
The PowerSoil® DNA Isolation Kit is used to extract DNA from soil with a very high level of purity. It is optimised to extract microbial DNA from all types of soil as well as DNA of the other environmental samples and it has been used for lichens (Bates et al., 2011). One of the main differences between this kit and the other kits used in this study is that it contains special bead tubes for the preparation of the samples. DNA was extracted from the samples according to the manufacturer’s instructions. Briefly, the surface sterilised lichen samples were added to the PowerSoil® Bead Tubes and they were vortexed after adding 60 µl of the cell lysis buffer (C1). After cell lysis step, 250 µl of the patented inhibitor removal buffer (C2) was added to the mixture followed by incubating at 4°C for 5 minutes. The secondary patented inhibitor removal solution (C3) of this kit was also added for precipitating additional non-DNA materials. Finally, the DNA molecules were bound to the silica membrane in the Spin Filter and were eluted using 50 µl of the elution buffer (C6) which is a low salt solution (10 mM Tris) after the washing step using the ethanol wash solution (C5).
The GF-1 Plant DNA Extraction Kit was tested for isolating DNA from the lichen samples using the procedure provided by the manufacturer. Briefly, homogenisation was carried out by grinding the surface sterilised samples in liquid nitrogen into fine powder. The lysis process was carried out by incubating the samples at 65°C for 120 minutes after adding 280 µl of the lysis buffer (PL) and 20 µl of proteinase K. RNase A at a concentration of 20 mg/ml (20 µl) was added after the lysis step and the mixture was incubated at 37°C for 5 minutes. A secondary homogenisation step was carried out by incubating the sample at 65°C for 10 minutes after adding 2 volumes of the Buffer PB. DNA molecules were precipitated by adding 200 µl of absolute ethanol to the mixture and then they were bound to the glass filter membrane of the spin column. The DNA was eluted from this membrane using the elution buffer (50 µl) after the washing step.
The PUREGENE® system has been used previously for extraction of genomic DNA from lichens (O'Brien et al., 2005). A modified protocol from the Genomic DNA Isolation Kit (PUREGENE, Minneapolis, MN, USA) was used for extracting DNA from the lichen samples in this study. Briefly, after the surface sterilised lichen samples were ground into a powder in liquid nitrogen using chilled mortars and pestles, the Cell Lysis Solution (400 µl) was added to the fine powder of each surface-sterilised sample and the mixture was incubated at 6 °C for 120 minutes. RNA treatment step was carried out by adding RNase A (1.5 µl) at a concentration of 20 mg/ml to the mixture and incubation at 37°C for 15 minutes. The Protein Precipitation Solution (170 µl) was added to the cell lysates and was then incubated on ice for 5 minutes. The protein precipitation step was completed by centrifuging the tubes and separating the supernatant containing the DNA. DNA was precipitated by adding 500 µl of 100%
isopropanol. The DNA pellet was washed using 300 µl of 70% ethanol and the pellet was rehydrated by adding 50 µl of DNA-free water.
3.2.3.2 Optimised CTAB manual protocol for DNA extraction from lichens
A CTAB DNA extraction method for lichens, optimised by Cubero et al. (1999), was used to isolate DNA from the samples in this study. Briefly, the surface sterilised lichen samples were ground into a powder in liquid nitrogen using chilled mortars and pestles. Then, 500 µl of the extraction buffer (1% w/v CTAB; 1 M NaCl; 100 mM Tris; 20 mM EDTA; 1% w/v polyvinyl polypyrolidone) was added to the lichen powder and incubated at 70°C for 30 minutes after mixing them by inverting the tube. After this lysis step, one volume of chloroform: isoamyl alcohol (24:1 v/v) was added and mixed with the solution. The solution was then centrifuged at 10,000 × g for 5 minutes. The upper aqueous phase from the supernatant was added to two volumes of precipitation buffer (1% w/v CTAB; 50 mM Tris-HCl; 10 mM EDTA; 40 mM NaCl). The mixture was centrifuged (13,000 × g for 15 minutes) and the pellet was re- suspended in 350 µl of NaCl (1.2 M) and one volume of chloroform: isomyl alcohol was added to precipitate the DNA. DNA was collected by centrifuging at 10,000 × g for 5 minutes. The upper aqueous phase was removed after centrifugation to a clean tube and isopropanol (0.6 volume) was added and incubated at -20°C for 15 minutes. Centrifugation at 13,000 × g for 20 minutes pelleted the DNA. The DNA pellet was treated with 2µl of RNase A at concentration of 20 mg/ml incubated at 37°C for 30 minutes. A final wash was carried out by adding 1000 µl of chilled 70% ethanol and the pellet was collected by centrifuging at 13,000 × g for 3 minutes. The ethanol was evaporated at 50°C (5-10 minutes) and pellet was re-suspended in 50 µl of DNA-free water.
3.2.4
DNA concentration and quality measurement
Except for the extracts from the REDEXTRACT-N-AmpTM Plant PCR Kit, which are not purified genomic DNA, the concentration and quality of other extracted DNA samples were measured using spectrophotometry (NanoDrop Technologies Inc., Delaware, USA). The final DNA extracted using each different method in this study was dissolved in 50 µl of water/elution buffer and therefore the methods were comparable.
3.2.5
Polymerase chain reaction (PCR)
Except the REDEXTRACT-N-AmpTM Plant PCR Kit, which has its own polymerase chain reaction (PCR) master mix, the PCR amplifications of other extracted DNA were conducted using the GoTaq® Green Master Mix (Promega, Madison, WI, USA). For the DNA extracted using REDEXTRACT-N-AmpTM Plant PCR Kit, a PCR assay was carried out using fungal and algal specific primers (Table 3.1) added into the
REDEXTRACT-N-AmpTM Plant PCR master mix following the manufacturer’s protocol. Each PCR reaction (20 µl) contained 10 µl of REDEXTRACT-N-Amp PCR ReadyMix, 4 µl of extracted DNA, 1 µl each of the forward and reverse primers (5 µM), and 4 µl of DNA-free water. The thermal cycle was as follows: initial denaturation at 94°C for 2 minutes, then 35 cycles of denaturation at 94°C for 30 seconds, annealing at 54°C for 45 seconds, extension at 72°C for 2 minutes, then a final extension at 72°C for 7 minutes. The thermal cycle for algal rDNA amplification was the same as the fungal one except the annealing time which was at 50°C.
For the DNA extracted using other kits, PCR amplification was performed in a 25µl reaction volume using GoTaq® Green Master Mix (Promega, Madison, WI, USA). It contained 12.5 µl GoTaq® Green Master Mix, 1 µl of a 5 µM solution of each of the algal and the fungal specific forward and reverse primers (Table 3.1), 1 µl of 10 mg/ml purified bovine serum albumin (BSA) 100X (New England BioLabs, Ipswich, MA, USA), to reduce the impact of PCR inhibitors, 8.5 µl sterile ultrapure water, and 1 µl of the extracted DNA (25 µg/µl).
Table 3.1 Fungal and algal ITS rRNA gene specific forward and reverse primers used in this study.
ID Sequence (5ˊ-3ˊ) Target Reference
nr-SSU-1780-5’ Fungal CTGCGGAAGGATCATTAATGAG Fungus (Piercey-Normore and DePriest, 2001) nr-SSU-1780-5’ Algal CTGCGGAAGGATCATTGATTC Alga (Piercey-Normore
and DePriest, 2001)
ITS4 TCCTCCGCTTATTGATATGC Alga &
Fungus (White et al., 1990)
3.2.6 Electrophoresis, DNA Sequencing and sequence-similarity BLAST (Basic Local Alignment Search Tool) search
To visualize if PCR amplifications were successful, the PCR products were separated by electrophoresis on a 1% agarose gel at 10 V/cm for 45 minutes in 1X TAE (40 mM tris-acetate/1 mM EDTA, pH 8). Amplimers were directly sequenced at the Lincoln University Sequencing Facility using primers in an ABI 3100 Genetic Analyser (Applied Biosystems, USA). The ITS rDNA sequences produced in this study were manually trimmed and compared with the available database in GenBank (NCBI; http://www.ncbi.nlm.nih.gov/) using the BLAST searching tool.