• No se han encontrado resultados

2.2

Tissue culture

2.2.1

Cell culture

All cells were kept in an incubator at 37oC with an atmospheric environment of 5% CO2. Growth medium used for different cell lines are presented in Table 2.4.

CELL LINE GROWTH MEDIUM COMPONENTS

HEK293 MEM, 10% FCS (Bethyl Laboratories), 2mM L-Glutamate, 100 units Penicillin, 0.1mg/ml Streptomycin, + 1% Non Essential Amino Acids TRex Same as HEK293 + 5µg/ml Blasticidin (Invitrogen) TRex-willinGFP Same as TRex + 250µg/ml Zeocin (Invitrogen) MCF10A DMEM (Invitrogen), 5% Horse serum (Invitrogen),

20ng/ml EGF, 0.5µg/ml Hydrocortisone, 100ng/ml Cholera toxin, 10µg/ml Insulin, 100 units Penicillin + 0.1mg/ml Streptomycin

MCF10A-pBabe Same as MCF10A + 2µg/ml Puromycin MCF10A-YAP Same as MCF10A + 300µg/ml Hygromycin MCF10A-YAP Same as MCF10A-YAP + 2µg/ml Puromycin + pBabe

Phoenix-A DMEM, 10% FCS (Bethyl Laboratories), 2mM L-Glutamate, 100 units Penicillin + 0.1mg/ml Streptomycin

Schwann cells DMEM, 10%FCS (Bethyl Laboratories), 2mM L-Glutamate, 100 units Penicillin, 0.1mg/ml

Streptomycin, 10µM Forskolin + 20ng/ml Heregulin Fibroblasts DMEM, 10% FCS (Bethyl Laboratories),

2mM L-Glutamate, 100 units Penicillin and 0.1mg/ml Streptomycin

Table 2.4: Growth medium reagents for different tissue culture cell lines. All materials were from Sigma unless otherwise stated.

Cells were split, into T75 flasks, three times a week, in a class II sterile chamber. Growth medium was removed and the cells were rinsed with 1.5ml, pre-warmed to 37oC, Trypsin-EDTA (Sigma). Cells were detached from the plastic surface by gently tapping the flask. Cells were harvested with 15ml fresh medium and the appropriate cell density was added back into the flask

41 2.2. TISSUE CULTURE

containing 15ml fresh medium. Cells were passaged up to 40 times before being replaced with fresh cells that were stored in liquid nitrogen (Section 2.2.8). MCF10A cells were obtained from ATCC and were grown according to Debnath et al. (2003). HEK-293 cells were obtained from ATCC, TRex cells were are kind gift from Dr. Chris Tate (University of Cambridge, UK) and primary Schwann and fibroblast cells were a kind gift from Prof. Sue Barnett (University of Glasgow, UK).

2.2.2

DNA transfection

HEK-293 cells were transfected with DNA using GeneJammer transfection reagent (Stratagene) according to the manufacturer’s manual (Table 2.5). HEK-293 cells were harvested and the appropriate cell density was added to dishes so that HEK-293 cells were 60-80% confluent on the day of transfection. Cells were placed in dishes with or without coverslips for use of immunofluo- rescence microscopy or western blotting respectively.

Size of dish GeneJammer DNA Optimem Medium (mm) (µl/dish) (µg/dish) (µg/dish) (ml/dish)

35 6 2 100 2

60 15 5 250 5

90 30 10 750 10

150 60 20 1000 15

Table 2.5: Volumes of reagents used in GeneJammer DNA transfection in different sized dishes.

2.2.3

siRNA transfection

HEK-293 cells were grown to 60-80% confluency in dishes with or without cov- erslips for use of immunofluorescence microscopy or western blotting respec- tively. Three duplex siRNA oligo-ribonucleotides specifically targeted against the willin gene were designed (Invitrogen): siRNA1 = GCCUCUAUAU- GAAUCUGCAGCCUGUACAGGCUGCAGAUUCAUAUAGAGGC, siRNA2 = CACAGACUAUAUGUCGGAAACCAAAUUUGGUUUCCGACAUAUAG- UCUGUG and siRNA3 = GACAGAGCAGCAAGAUACUAUUAUUAAU-

42 2.2. TISSUE CULTURE

AAUAGUAUCUUGCUGCUCUGUC. siRNA was transfected into HEK-293 cells using GeneEraser (Stratagene) transfection reagent according to the man- ufacturer’s protocol. The volume of siRNA was either split so that there was an equal volume of each siRNA duplex or made up of a single siRNA duplex.

2.2.4

Retroviral production and transfection

Retroviral infections were performed on MCF10A cell lines. Appropriate safety measures were taken when producing and transfecting a retrovirus. All viral work was done in a class II tissue culture hood designated for viral work only. All liquid waste was aspirated into a viral container containing Virkon (Antec International Ltd) and solid waste was placed in a double bag within the tissue culture hood after which it was placed within the viral waste. Both liquid and solid wastes were autoclaved before being disposed of.

Phoenix-A cells were harvested and 4x106 cells were plated into 90mm dishes. After 24 hours, Phoenix-A cells were transfected with a pBabe vector containing the gene of interest and an empty vector was used as a control. For each 90mm transfection: 43µl Mirus LT1 (Mirus) was added to 1.5ml serum free Optimem (Invitrogen) and was left to incubate for 20 minutes at room temperature. 20µg of pBABE vector was added to Mirus LT1-Optimem solution and left to incubate for a further 30 minutes. The DNA-LT1-Optimem solution was then added drop by drop to the plate of Phoenix-A cells, which contained a total of 10ml of DMEM and 10% FCS. 24 hours post-transfection, the medium was removed and 4ml DMEM containing 10% FCS was added. Media was collected 48 hours post-transfection and 4ml DMEM containing 10% FCS was added back on the cells. 72 hours post-transfection, media containing the virus was collected. The media containing the virus from 48 hours and 72 hours post-transfection were pooled together and passed through a 0.45µm filter to remove cellular debris. The media containing the virus was used directly for retroviral transfection.

Cells to be transfected by retroviral transfection were harvested and 5x105 cells were plated per 90mm dishes. 24 hours after seeding, culture media was aspirated from the 90mm dishes and 4ml of virus-media containing 8µg/ml polybrene (Sigma) was added to the cells and left to incubate for 8 hours in a 37oC viral tissue culture incubator. Media was aspirated after the incubation and 10ml fresh culture media was added. Cells were selected with 2µg/ml

43 2.2. TISSUE CULTURE

puromycin 48 hours post-infection. Four days after puromycin selection only puro-resistant cells remained.

2.2.5

Stable cell line production

Confluent T75 flasks were transfected with appropriate DNA plasmids using either the GeneJammer transfection (Section 2.2.2) or the retroviral transfec- tion (Section 2.2.4) method. Cells were incubated in a sterile tissue culture incubator at 37oC. 48 hours post-transfection, cells were selected for plas- mid expression using appropriate antibiotics: 500µg/ml zeocin and 5µg/ml blasticidin were added to TRex-willin-GFP cell line; 2µg/ml puromycin was added to MCF10A-willin, MCF10A-FERM and MCF10A-Cterm cell lines; and 300µg/ml hygromycin was added to MCF10A-YAP cells. The cells were maintained in antibiotic containing medium thereafter.

2.2.6

Inducing TRex cell line

Willin-GFP expression was induced in the TRex-willin-GFP cells with growth medium containing 1µg/ml tetracycline. Fresh tetracycline was added every 48 hours for long inductions.

2.2.7

Storage of cell lines

Confluent T75 flask containing cells to be frozen down were trypsinised and resuspended in growth medium. Cells were harvested at 350g for 5 minutes at room temperature. The cell pellet was resuspended in freezing medium containing 40% FCS, 50% normal cell maintenance medium and 10% DMSO. 1.5ml aliquots were added to a cryotube and placed at -80oC in a cryo-freezing container (Nalgene) for 24 hours. The cryotubes were placed in a liquid nitro- gen store for long-term storage.

2.2.8

Rescue of frozen cell lines

Cells were quickly thawed at 37oC and added to a sterile T75 flask containing 20ml growth cell medium. After 24 hours, the medium was aspirated and replaced with fresh medium.