Las construcciones

Dnmt1 was the first DNA methyltransferase to be described in mammalian cells and is the major enzyme involved in maintenance of DNA methylation patterns of post-replicative DNA sequences (Bestor & Ingram, 1983; Hermann et al, 2004a; Leonhardt et al, 1992). Dnmt1 has a strong preference for hemi-methylated sites in vitro, although in vitro studies revealed residual activity on unmethylated DNA sequences (Frauer & Leonhardt, 2009; Hermann et al, 2004a; Pradhan et al, 1999). Moreover, in cancer cells, overexpression of Dnmt1 was associated with hypermethylation at specific promoter regions which argues for a de novo methylation activity of Dnmt1 (Biniszkiewicz et al, 2002). The question that remains unanswered is whether Dnmt1 has de novo methylation activity on unmethylated DNA sequences in living cells. To this aim, we analyzed the ability of Dnmt1 to restore methylation patterns in methylation devoid triple knockout ES cell line (TKO) (Tsumura et al, 2006).

Material and Methods

Expression constructs and cell lines: The GFP-Dnmt1 expression construct was described

previously (Frauer et al, 2011). The GFP-Dnmt3a and GFP-Dnmt3b constructs were kindly provided by (Okano et al, 1998), triple knock out cell lines were generated and kindly provided by (Tsumura et al, 2006).

Cell culture and transfection: Mouse ES cells were cultured without feeder cells in

gelatinized flasks and in DMEM supplemented with 16% fetal calf serum, 1000 U/ml LIF, ß-mercaptoethanol and L-Glutamin as described previously (Frauer et al., 2011). Cells were transfected with a GFP-Dnmt expression construct immediately after splitting with FuGENE HD (Roche, Mannheim) according to the manufactures protocol.

Rescue assay and stable cell line generation: GFP-positive cells were sorted 48 hours after

transfection with a FACS Vantage SE cell sorter or a FACS Aria II (Becton –Dickinson), respectively. Sorted cells were either directly lysed to isolate genomic DNA (48 hours rescue assay) or plated under low density for stable cell line generation. The remaining GFP-positive cells were subsequently sorted until a stable pool of GFP-expressing cells was obtained. After a stable pool of cells was generated, single cells were sorted into a

Results

79 gelatinized 96 well plate to generate single clones. Clones were cultured, expanded and proteins were extracted to analyze the expression of the GFP fusion protein. Expression levels were compared to the endogenous protein levels in wild type ES cells and clones expressing similar levels were chosen.

Genomic DNA Isolation and Bisulfite Treatment: Genomic DNA was isolated using QIAmp

DNA Mini kit (Qiagen) kit and 500 ng-1.5 µg DNA was bisulfite treated using either EpiTect (Qiagen) or EZ DNA Methylation-Gold Kit (Zymo Research) following the manufactures conditions.

Methylation Analysis based on Pyrosequencing: Bisulfite treated DNA was amplified in a

PCR reaction with specific Primer sets and PCR conditions for CpG Islands of skeletal α-

actin, H19a, dnmt1o promoter, Xist exon 1, intracisternal type A particle long terminal

repeat (IAP) and major satellite repeats (see table Table 1 and Table 2).

Table 1: Bisulfite primer sequences for single copy gene promoters.

promoter _{forward primer sequence reverse primer sequence length CpG}

skeletal- α

actin

GGGGTAGATAGTTGGGGATATTTTT CCTACTACTCTAACTCTACCCTAAAT

A-bio

309bp 13

dnmt1o GTTGTTTTTTGGTTTTTGTGGGTA CAACCTTAACAACACAACTAAAATA

GTTGTTTTTTGGTTTTTGTGGGTA CAACTATACACTATCAAATAACCT-bio _{272bp 4}

H19a GATTAGATAGTATTGAGTTTGTTTGGAGT CCTAAAATACTAAACTTAAATAACCCA

CAA GAG AAA ATA GTT ATT GTT TAT AGT TTT ACCATTTATAAATTCCAATACCAAAAA TAA-bio 317bp 10 xist GTTAATTAATGTAGAAGAATTTTTAGTGTT TA TTATTTAAGGAGTTTTGGGGGAATATT T GTTAATTAATGTAGAAGAATTTTTAGTGTT TA TTTAATAAGATGTTAGAATTGTAATTTT TGTG -bio 458bp 19

Major satellite repeats were amplified in a single PCR reaction and two PCR reactions were pooled using a Millipore purification kit, while all other sequences were amplified in a nested PCR reaction. The amplified PCR product was subjected to pyrosequencing carried out by varionostic GmbH, Ulm.

Results

80

Table 2: Bisulfite primer sequences for repetitive sequences

sequence forward primer sequence reverse primer sequence length CpG

MajSat AAATGAGAAAtATttAtTTG CCATaATTTTCAaTTTTCTT -bio 234bp 8

IAP GTTGTTTTTTGGTTTTTGTGGGTA CAACCTTAACAACACAACTAAAATA

GTTGTTTTTTGGTTTTTGTGGGTA CAACTATACACTATCAAATAACCT-bio 259bp 4

Methylation analysis in TKO cells transiently rescued with GFP-Dnmt1

We investigated the activity of Dnmt1 on unmethylated DNA in TKO ESC’s by re- expression of Dnmt1 in transient as well as stable rescue experiments. For this aim, we used triple knockout (TKO) ESC’s that lack all the three major methyltransferases Dnmt1, Dnmt3a and Dnmt3b and therefore are devoid of methylation. We performed a transient rescue assay where TKO cells were transfected with GFP-Dnmt1, GFP-Dnmt3a and GFP- Dnmt3b and analyzed selected sequences to determine the ability to methylate unmethylated DNA sequences in vivo. In a transient rescue assay TKO cells were transfected with the respective plasmids and FACS sorted after 48 hours. Genomic DNA was isolated, bisulfite treated and subjected to pyrosequencing for a quantitative methylation analysis. TKO cells rescued with GFP-Dnmt1 remained unmethylated in all of the analyzed sequences after 48 hours. In comparison we performed the same approach with GFP-Dnmt3a and GFP-Dnmt3b, respectively, which showed that both de novo methyltransferases are active and able to re-methylate unmethylated DNA sequences in TKO cells.

Establishment of stable TKO cell lines and methylation analysis by pyrosequencing

To overcome limitations of a transient rescue assay as well as to analyze long-term effects of Dnmt1 expression in TKO cells, we additionally established TKO cell lines, which stably express GFP-Dnmt1. For a comparison of different methyltransferase activities we also generated stable pools of GFP-Dnmt3a and GFP-Dnmt3b TKO cell lines, respectively. For this aim we established a new FACS based approach to generate stable TKO cell lines

Results

81 since TKO cells are resistant to the most commonly used selective markers (Tsumura et al, 2006). After several rounds of FACS sorting for GFP positive cells and their subsequent propagation all cell lines were stable. We generated pools of TKO cells stably expressing GFP-Dnmt1, GFP-Dnmt3a and GFP-Dnmt3b. Furthermore the pool of TKO cells stably expressing GFP-Dnmt1 was further subcloned and single clones were selected for further methylation analysis. Genomic DNA was isolated, bisulfite treated and subjected to pyrosequencing as described for the transient rescue experiment. Moreover, we analyzed three different pools of GFP-Dnmt1 stable cell lines over several passages to address dynamics and kinetics of a potential de novo methylation activity of Dnmt1 and to detect a possible accumulation of methylation over time. Genomic DNA samples were obtained three and six weeks after transfection and subjected to pyrosequencing.

Results

82

Figure 2-1: Quantitative methylation analysis of single copy gene promoters in TKO cells rescued with GP- Dnmt1, GFP-Dnmt3a and GFP-Dnmt3b. Quantitative methylation levels of (A) 13 CpG sites were averaged for skeletal α-actin promoter and (B) 4 CpG sites for dnmt1o promoter for each analyzed sample. Methylation of wild type and dnm1-/- _{are displayed for comparison. TKO cells were rescued with GFP-Dnmt1}

and three different pools of stable cell lines (I-III) were analyzed 3 weeks (a) and 6 weeks (b) after stable transfection. Four different stable clones (#1,#10,#12,#19) were selected whose dnmt1 expression levels are similar compared to the endogenously expressed Dnmt1 in wild type cells (data not shown). CpG Methylation was not detected at any time point in any of the analyzed TKO GFP-Dnmt1 cell lines (A,B). TKO cells rescued with GFP-Dnmt3a and GFP-Dnmt3b showed detectable methylation in the skeletal α-actin promoter (A) and in the dnmt1o promoter (B) indicating de novo methylation activity.

Results

83

Figure 2-2: Quantitative methylation analysis of imprinted promoter H19a and xist promoter in TKO cells rescued with GP-Dnmt1, GFP-Dnmt3a and GFP-Dnmt3b. Quantitative methylation levels of (A) 6 CpG sites were averaged for xist promoter and (B) 5 CpG sites for h19a promoter for each analyzed sample. Methylation of wild type and dnm1-/- _{are displayed as comparison. TKO cells were rescued with GFP-Dnmt1}

and three different pools of stable cell lines (I-III) were analyzed 3 weeks (a) and 6 weeks (b) after stable transfection. Four different stable clones (#1,#10,#12,#19) were selected whose dnmt1 expression levels are similar compared to the endogenously expressed Dnmt1 in wild type cells (data not shown). CpG Methylation was not detected at any time point in any of the analyzed TKO GFP-Dnmt1 cell lines (A,B). TKO cells rescued with GFP-Dnmt3a and GFP-Dnmt3b showed detectable methylation in the xist promoter (A) indicating de novo methylation activity, while no methylation was detectable in the h19a promoter (B).

Results

84

Figure 2-3 Quantitative methylation analysis of repetitive sequences major satellites and IAP elements TKO cells rescued with GP-Dnmt1, GFP-Dnmt3a and GFP-Dnmt3b. Quantitative methylation levels of (A) 8 CpG sites were averaged for major satellites and (B) 11 CpG sites for IAP elements for each analyzed sample. Methylation of wild type and dnm1-/- _{are displayed as comparison. TKO cells were rescued with GFP-Dnmt1}

and three different pools of stable cell lines (I-III) were analyzed 3 weeks (a) and 6 weeks (b) after stable transfection. Four different stable clones (#1,#10,#12,#19) were selected whose dnmt1 expression levels are similar compared to the endogenously expressed Dnmt1 in wild type cells (data not shown). CpG Methylation was not detected at any time point in any of the analyzed TKO GFP-Dnmt1 cell lines (A,B). TKO cells rescued with GFP-Dnmt3a and GFP-Dnmt3b showed detectable methylation in major satellites (A) and in the IAP elements (B) indicating de novo methylation activity.

Results

85

Methylation analysis in TKO cells stably expressing GFP-Dnmt1, GFP-Dnmt3a and GFP-Dnmt3b

The analysis of GFP-Dnmt3a and GFP-Dnmt3b stable cell lines show low but measureable

de novo methylation in all analyzed sequences, except for the case of H19a, which

requires passage through the germ line to become methylated (Tucker et al, 1996). We were able to detect a 10-15-fold increase in methylation levels of GFP-Dnmt3a and GFP- Dnmt3b stable cell lines compared to untreated TKO cells. However, these methylation levels do not by far reach those found in dnmt1-/- _{ES cells where both de novo} methyltransferases are expressed. Therefore, our data points towards the important role of a synergetic function between Dnmt3a and Dnmt3b in de novo methylation activity.

Surprisingly, in none of the analyzed GFP-Dnmt1 clones and stable pools was DNA methylation detectable above background, even after several passages of cultivation (see

Figure 2-1, Figure 2-2, Figure 2-3). These findings clearly show that Dnmt1 alone is not able to de novo methylate unmethylated DNA sequences in vivo and argues against several studies claiming that Dnmt1 has de novo methylation activity apart from its clear involvement in maintenance. To clarify whether proximal pre-existing CpG sites are able to initiate de novo methylation of Dnmt1 further experiments have to be performed in living cells. To this aim introduction of methylation at specific sites followed by a rescue assay with Dnmt1 would be necessary. Moreover, to investigate whether interaction between the three active methyltransferases might activate de novo activity of Dnmt1, double-rescue experiments of the active methyltransferases in combination with their respective catalytically inactive “mutants” are necessary to be performed.

Results

Results

87

DNA-methylation of CpG dyads and markov modeling of

DNA-methylation control in mammals

Results

88