• No se han encontrado resultados

Seguimiento y control para la formación de tejido social

Capítulo 5. Formulación del plan de acción

5.6. Seguimiento y control de las actividades propuestas en el plan de acción

5.6.3 Seguimiento y control para la formación de tejido social

cell differentiation

We have recently shown that Np95 is involved in a common silencing process of ectopically expressed promoter constructs with Dnmt3a, Dnm3b and the histone methyltransferase G9a ((Meilinger et al, 2009) see chapter 2.6). Moreover, we showed that Np95 interacts with the de novo methyltransferases Dnmt3a and Dnmt3b. These findings pointed us towards the investigation of a possible Np95 role in silencing of endogenous promoter regions. We addressed this question by differentiating various knockout cell lines and compared expression and methylation level changes of the pluripotency factors oct4

and nanog during differentiation.

Material and Methods

Cell lines: Wild type (J1 and E14), dnmt1-/-, DKO (dnmt3a-/-dnmt3b-/-), TKO (dnmt1-/-, dnmt3a-/-dnmt3b-/-), and np95-/- cell lines described previously (Meilinger et al, 2009).

Cell culture, transfection and stable cell line generation: Mouse ES cells were cultured

without feeder cells in gelatinized flasks and in DMEM supplemented with 16% fetal calf serum, 1000U/ml LIF, ß-mercaptoethanol and L-Glutamin as described previously (Frauer et al., 2011). Cell were transfected immediately after splitting with FuGENE HD (Roche, Mannheim) according to manufactures protocol.

GFP-positive cells were sorted 48 hours after transfection with a FACS Aria II (Becton – Dickinson). Sorted cells were plated under low density for stable cell line generation. The remaining GFP-positive cells were subsequently sorted and cultured until a stable pool of GFP-expressing cells was obtained.

Differentiation into embryoid bodies: a single cell suspension was obtained after

resuspending in ESC medium without LIF. Cells were counted and adjusted to 3x104

cells/ml and 20 µl drops were spotted on the lid of a bacterial dish. The lid was turned and put back on the dish filled with PBS to prevent desiccation. After 2 or 4 days of incubation, EBs were collected and propagated in ESC medium without LIF. To prevent adhesion, EBs were transferred into a bacterial dish for further cultivation. Samples were collected every second or fourth day and genomic DNA as well as RNA was extracted and purified.

Results

153

Genomic DNA and RNA Isolation from embryoid bodies: Genomic DNA was isolated using

QIAmp DNA Maxi kit following the protocol for tissue lysis and isolation. Lysis was carried out 1-4 hours in lysis buffer to guarantee complete lysis. For simultaneous purification of DNA and RNA samples were collected in 1ml TRIzol reagent (Invitrogen) and either lysed by repetitive pipetting or by using a Dounce Homogenisator at later time points. Genomic DNA was further purified using a QIAmp Mini column and bisulfite treated using DNA Methylation Gold kit (Zymo Research).

Methylation Analysis based on Pyrosequencing: Bisulfite treated DNA was amplified in a

PCR reaction with specific primer sets and nested PCR conditions for oct4 and nanog promoter regions (see Table 3). The amplified PCR product was subjected to pyrosequencing carried out by varionostic GmbH, Ulm.

Table 3: Bisulfite primer sequences for oct4 and nanog promoter

promoter forward primer sequence reverse primer sequence length CpG

oct4 GTTGTTTTGTTTTGGTTTTG GATAT GTTAGAGGTTAAGGTTAGAGGGTGG ATGGGTTGAAATATTGGGTT TATTTA GTTAGAGGTTAAGGTTAGAGGGTGG- bio 454bp 12 nanog GAGGATGTTTTTTAAGTTTTT TTT TTATTATATTGATATGAGTGTGGG AATGTTTATGGTGGATTTTG TAGGT TTATTATATTGATATGAGTGTGGG-bio 369bp 6

DNA methylation and expression of oct4 and nanog during EB differentiation

We investigate a possible function of Np95 in silencing of endogenous promoter regions by differentiating np95-/-, dnmt1-/- ES cells and their respective wild types into EBs and compared expression and methylation level changes of the pluripotency factors oct4 and

nanog. Various differentiation protocols are available, but EB formation by the hanging-

drop method provides the most homogenous population. The differentiation process in EBs is similar to the one observed in early embryonal development. During EB formation cells are not forced into specific cell lineages and thus this method allows differentiation into cells from all three germ layers. We controlled the size of the EBs by using a defined number of cells. EBs were harvested after 2-4 days and transferred into bacterial dishes to

Results

154

avoid adhesion and further cultivation. To compare methylation of oct4 and nanog promoter with transcript levels, we harvested EBs every 2-4 days and analyzed methylation level changes of oct4 and nanog promoter regions as well as transcript levels. For methylation analysis, we isolated and bisulfite treated genomic DNA before subjecting it to pyrosequencing.

The pyrosequencing analysis of the oct4 promoter in wild type ES cells shows that methylation steadily increases after 4 days of initiation of differentiation and reaches a plateau after 16 days (see Figure 2-5). The results are strikingly similar in both analyzed wild type cell lines: E14 and J1, which are the respective wild type backgrounds for np95-/- ES cells and the dnmt knockout ES cells (TKO and dnmt1-/-). Notably, expression of oct4

declines fast after initiation of differentiation and already at day 4 lowest transcript levels were detected indicating a complete down regulation (provided by Christine Schmidt). Similar effects can be observed in the analysis of the nanog promoter, yet methylation levels are significantly lower and reach only 40% methylation compared to approximately 70% that were found in the oct4 promoter sequence (see Figure 2-6). Interestingly, we found down regulation of oct4 and nanog in np95-/- and dnmt1-/- knock out cells to be

surprisingly similar compared to the respective wild type cell lines and with a similar kinetics. Moreover, methylation levels were established at day 4 of differentiation, which is comparable to data obtained in wild type cell lines. However, methylation levels by far do not reach those observed in the respective wild type cells and stagnate at day 8 with around 20% and 10% in the oct4 promoter and the nanog promoter, respectively. Furthermore, methylation levels decrease slightly after day 8 in dnmt1-/- ES cells but not in

np95-/- ES cells. This observed difference was unexpected considering that np95-/- and

dnmt1-/- ES cells have such strikingly similar methylation levels on both single copy

promoter sequences and repetitive elements (see figure Figure 2-4) and given the fact that enzymatic activity of Dnmt1 is directly depended on the interaction with Np95 (Bostick et al, 2007; Sharif et al, 2007).

Results

155

Figure 2-4: Comparison of methylation in wild type, dnmt1-/- and np95-/-ES cells. CpG methylation of major

satellite repeats was analyzed by bisulfite treatment, PCR amplification and pyrosequencing for quantitative analysis. Both wild type cell lines J1 and E14 have methylation levels of around 80% at each CpG site. Strikingly, similar recused methylation levels were found in dnmt1-/- and np95-/-ES cells.

Results

156

Figure 2-5: Methylation and expression of pluripotency factor oct4 during EB differentiation in wild type and knockout ES cells. Two wild type cell lines (J1, E14) were differentiated into EB up to 24 days and oct4 promoter methylation was analyzed every 2-4 days. Methylation levels from 5 CpG sites were averaged at each time point for each cell lines. (B) Simultaneously to genomic DNA extraction, mRNA was prepared for relative oct4 mRNA expression at each time point (provided Christine Schmidt).

Results

157

Figure 2-6 Methylation and expression of pluripotency factor nanog during EB differentiation in wild type and knockout ES cells: Two wild type cell lines (J1, E14) were differentiated into EB up to 24 days and nanog promoter methylation was analyzed every 2-4 days. Methylation levels from 5 CpG sites were averaged at each time point for each cell lines. (B) Simultaneously to genomic DNA extraction, mRNA was prepared for relative nanog mRNA expression at each time point (provided by Christine Schmidt).

Results

158

Taken together, the comparison of the methylation level profiles in np95-/- and dnmt1-/-

knockout cell lines revealed that de novo methylation carried out by Dnmt3a and Dnmt3b is not impaired in np95-/-ES cells, as we expected from the CMV promoter silencing data. Moreover, our data suggest that interaction of Np95 with the de novo methyltransferases Dnmt3a and Dnmt3b ((Meilinger et al, 2009) see chapter 2.7) is not involved in silencing of endogenous promoters. However, consistent with our previous findings that silencing of the CMV promoter precedes DNA methylation, our data on silencing of the pluripotency factors oct4 and nanog clearly shows that initial down regulation is independent of DNA methylation and DNA methyltransferases.

Down regulation of oct4 in TKO cells

In addition to the analysis of wild type and np95-/- and dnmt1-/- ES cells we differentiated TKO cells and TKO cells stably expressing GFP-Dnmt1 (see chapter 2.3) into EBs and determined methylation of oct4 and nanog promoter as well as their transcript levels during differentiation. We found that both; oct4 and nanog mRNA levels decrease steadily during the first 4 days and stagnate at about 20%, indicating an initial down regulation but incomplete silencing of oct4. These findings strongly support further that the initial down regulation process of pluripotency genes is independent of DNA methylation and DNA methyltransferases.

Results

159

Figure 2-7 Methylation and expression of oct4 in TKO cells rescued with Dnmt1. TKO cells stably expressing GFP-Dnmt1 were differentiated over 24 days into EBs. Methylation of oct4 promoter was analyzed in those cells and no methylation was detectable at any time point. In comparison, mRNA levels of oct4 were determined at the same time points during differentiation and down regulation was detectable reaching a stable relative level of around 20% (provided by Christine Schmidt).

Results

Results

161

Identification of differentiation area

(manuscript in preparation)

Results

162