Role of highly conserved histidines in the catalytic site of glucose dehydrogenase from Penicillium chrysogenum

(1)

Institute of Technical Microbiology

Master Thesis

Role of highly conserved histidines in the catalytic site

of glucose dehydrogenase from

Penicillium chrysogenum

Elaborated by: Ana Karina Ramijan Carmiol

Supervisors:

Prof. Dr. Dr. Garabed Antranikian

Prof. Dr. Rudolf Müller

MSc. Tobias Halbsguth

(2)

(3)

Master Thesis

Role of highly conserved histidines in the catalytic site

of glucose dehydrogenase from

Penicillium chrysogenum

Submitted in partial fulfillment of the requirements of the

International Master in Chemical and Bioprocess Engineering

Hamburg University of Technology

I hereby declare that the work presented in this document has been prepared by

myself.

Ana Karina Ramijan Carmiol

Evaluation Committee:

Prof. Dr. Dr. Garabed Antranikian

Head of the Institute of Technical Microbiology

Prof. Dr. Rudolf Müller

Professor Institute Technical Biocatalysis

(4)

(5)

Table 1. Experimental outline of the cloning strategy for the site directed mutagenesis of highly conserved histidine residue in the gdh2P.... 27 Table 2. Primers for the amplification of glucose dehydrogenase ... 30 Table 3. Composition of the PCR mix used for the amplification of the 5’ region of the six mutated versions of glucose dehydrogenase gene from P. chrysogenum ... 33 Table 4. Cycling specifications for the amplification of the 5’ region of the six mutated versions of glucose dehydrogenase gene from P. chrysogenum ... 33 Table 5. Composition of the PCR mix used for the amplification of the 3’ region of the six mutated versions of glucose dehydrogenase gene from P. chrysogenum ... 33 Table 6. Cycling specifications for the amplification of the 3’ region of the six mutated versions of glucose dehydrogenase gene from P. chrysogenum ... 34 Table 7. Composition of the PCR mix used for the amplification of five point mutations of the glucose dehydrogenase gene from P. chrysogenum ... 35 Table 8. Cycling specifications for the amplification of five point mutations of the glucose dehydrogenase gene from P. chrysogenum ... 35 Table 9. Composition of restriction digests mix used for the cloning of the mutated gdh2

genes into the pPIC9 vector ... 36 Table 10. Compositions of ligation mix used for the cloning of the mutated gdh2 genes into the pPIC9 vector... 36 Table 11. Description of the expression vectors containing the mutated glucose

dehydrogenase genes of P. chrysogenum ... 40 Table 12. Composition of the reagent mix used for the amplification of the glucose dehydrogenase gene from P. chrysogenum ... 41 Table 13. Cycling specifications for the amplification of five point mutations of the glucose dehydrogenase gene from P. chrysogenum ... 42 Table 14. Composition of restriction digests mix used for the analysis of recombinant plasmids... 43 Table 15. Composition of restriction digest mix used to linearize the recombinant plasmids... 45 Table 16. Composition of the reagent mix used for the amplification of the glucose dehydrogenase gene from the genomic DNA of P. pastoris integrants... 46 Table 17. Pippeting scheme for the determination of glucose dehydrogenase activity .. 48 Table 18. Liquid chromatography using NiNTA column to purify the 6xHis tagged Glucose Dehydrogenase mutated proteins ... 50 Table 19. Preparation of Polyacrylamide-SDS gels for separation of GDH2 mutated proteins ... 50 Table 20. CFU from the different aliquots of E.coli NovaBlue transformed with

recombinant plasmids holding the mutated gdh2 gene from P. chrysogenum ... 62 Table 21. E. coli Novablue clones screened by colony PCR to verify the presence of the

(8)

Table 22. Colonies of P. pastoris GS115 transformed with 1 µg of the recombinant pPIC9 plasmid with the gdh2 genes obtained by PCR site directed mutagenesis ... 65 Table 23. P. pastoris GS115 clones screened by colony PCR to verify the presence of the

gdh2 gene from P.chrysogenum ... 66 Table 24. Calculated protein concentration obtained with the Bradford method ... 73 Table 25. Purification of mutant GDH2H238 protein from the culture supernatant of

P. pastoris clone 4 ... 73 Table 26. Purification of mutant GDH2H514A protein from the culture supernatant of

P. pastoris clone 4 ... 74 Table 27. Purification of mutant GDH2H557A protein from the culture supernatant of

(9)

List of Figures

Figure 1. Glucose biosensor... 14 Figure 2. Glucose dehydrogenase reaction mechanism ... 15 Figure 3. Glucose dehydrogenase cofactors ... 16 Figure 4. Penicillium chrysogenum glucose dehydrogenase amino acid sequence detailing position of conserved domains ... 17 Figure 5. Role of the histydyl residue in the glucose dehydrogenase activity ... 18 Figure 6. A CLUSTALX 2.0 multiple sequence alignment of the glucose dehydrogenase from Penicillium sp, Penicillium chrysogenum, Penicillium italicu, Penicillium

lilacinoechinulatum, Aspergillus terreus,and Aspergillus oryzae. ... 19 Figure 7. Map and MCS of pPIC9 expression system. ... 24 Figure 8. Experimental outline ... 28 Figure 9. Schematic representation of the PCR site directed mutagenesis of the gdh2

gene from P. chrysogenum... 32 Figure 10. Schematic representations of the expression vectors containing the mutated glucose dehydrogenase genes ... 39 Figure 11. Interaction between residues in the 6xHis tag and NiNTA matrix... 49 Figure 12. PNGase F cleaves when a 1-6Fucose is on the core GlcNAc ... 52 Figure 13. Scheme of the glucose dehydrogenase action transferring oxidizing the glucose. ... 52 Figure 14. CLUSTALW multiple sequence alignment of the cholone oxidase from

Arthrobacter globiformis and the GDH2 ... 55 Figure 15. CLUSTALW multiple sequence alignment of the glucose oxidase from A. niger and P. amagasikiense and the GDH2 ... 56 Figure 16. CLUSTALW multiple sequence alignment of the GDH2 and the glucose

(10)

Figure 26. Separation of PCR fragments of gdh2 gene in 1% agarose gel showing the amplification of the mutated genes of P. pastoris clones ... 68 Figure 27. Fast protein liquid chromatography with NiNTA column for the purification of GDH2H514A ... 69 Figure 28. Fast protein liquid chromatography with NiNTA column for the purification of GDH2H557A ... 69 Figure 29. Fast protein liquid chromatography with NiNTA column for the purification of GDH2H158A ... 70 Figure 30. Liquid chromatography with NiNTA column for the purification of P. pastoris

fermentation supernatant containing GDH2H238A performed with Econo purifier system ... 70 Figure 31. SDS polyacrylamide gel stained with coomasie blue depicting the purification of the GDH2H557A . ... 71 Figure 32. SDS polyacrylamide gel stained with coomasie blue depicting the purification of the GDH2H514An ... 71 Figure 33. SDS polyacrylamide gel stained with coomasie blue depicting the purification of the GDH2H238A ... 72 Figure 34. SDS polyacrylamide gel stained with silver depicting the purification of the GDH2H557A ... 72 Figure 35. SDS polyacrylamide gel stained with coomasie blue identifying the

deglycosylated protein from P. pastoris fermentation supernatant. ... 74 Figure 36. SDS polyacrylamide gel stained with coomasie blue identifying the

(11)

Summary

Diabetes is a group of disease linked to metabolic disorder involving insulin, without proper treatment it could generate numerous complications. Diabetic patients must monitor their blood glucose level in order to administrate insulin by external means. The need for timely blood sugar monitoring has lead to the development of self-monitored blood glucose (SMBG). The key to the accurate measurement is the conversion of the glucose concentration to a readable signal, the optimization of SMBG seeks higher specificity towards glucose, O2 insensitivity and long term stability. These properties are exhibited by the glucose dehydrogenase (GDH2) from Penicillum chrysogenum. The structure analysis of GDH2 recognized five highly conserved histidine residues (H158, H238, H435, H514, H557) and a Glucose-methanol-choline oxidoreductase C-terminal domain (GMC_oxred_C). In the present project, site directed mutagenesis of the GDH2 was performed to corroborate the hypothesis that histidine residues have a critical role in the active site of this enzyme. The GDH2 mutant proteins were cloned in Pichia pastoris and purified by Nickel affinity chromatography. The results showed that in comparison with the wild type GDH2 the substitution of the H238

by alanine did not affect the KM or Vmax parameters. Contrary the specific activity of GDH2H14A and GDH2H557A mutated proteins is 1000-fold lower than GDH2wt, demonstrating the vital importance of H514 and H557 in the enzyme functionality.

Key words: diabetes, Self Monitoring Blood Glucose (SMBG), Glucose dehydrogenase,

(12)

(13)

Chapter 1: Introduction

1.1 Diabetes

Diabetes mellitus is a clinically and genetically heterogeneous group of disorders associated to insulin deficiencies. The insulin is a naturally occurring hormone, which is secreted by the beta cells in the pancreas after food ingestion to regulate the sugar and fat metabolism. Diabetic patients present abnormally high levels of glucose in their blood due either to insulin deficiency or to resistance of the body’s cells to the action of insulin (Harris, 1995).

There are three main types of diabetes: type 1, type 2 and gestational diabetes. In diabetes type 1, the body does not produce insulin; the low or absent levels of circulating endogenous insulin make the patient dependent on injected insulin to prevent ketosis and sustain life. Is usually diagnosed in children and young adults, and it was previously known as juvenile diabetes; only 5-10% of people present this form. The diabetes type 2

is also known, as the non-insulin-dependent mellitus is a more common form of diabetes, where the insulin levels may be normal, elevated, or depressed. Hyperinsulinemia and insulin resistance characterize most patients, if the disease progresses insulinopenia may develop. Onset predominantly after age 40 years but can occur at any age, approximately 50% of men and 70% of women are obese. The

gestational diabetes is a glucose intolerance that has its onset or recognition during pregnancy, is associated with older age, obesity or in cases of family history of diabetes. Conveys increased risk for the woman for subsequent progression to non-insulin dependent diabetes mellitus (type 2) and is associated with increased risk of macrosomia (CDS, 2007).

When glucose builds up in the blood instead of going into cells, it can lead to diabetes complications: retinopathy, risk of glaucoma, heart disease, neuropathy, skin disorders, infections, lower extremity foot ulcers, amputation, hypertension, lactic acidosis, depression, hearing losses, gastroparesis, ketoacidosis, hyperosmolar non ketotic coma, hypoglycemia, kidney disease, peripheral arterial disease, stroke, stress among others (Harris, 1995).

(14)

and this number is projected to double by the year 2030, when 366 million diabetic patients are expected (Wild et al, 2004). The personal cost and the healthcare burden of diabetes had triggered the research and diagnostics of this disease.

1.2 Self-monitoring blood glucose

The blood glucose concentration is the major diagnostic criteria for diabetes. It is a valuable tool to make decision on medication dosage and reduce the incidence and progression of microvascular and macrovascular complications (Yoo & Lee, 2010). The pharmaceutical industry had the challenge to provide tight and reliable glycemic control. The development of electrochemical biosensors for glucose played a leading role in this direction.

The concept of the glucose sensor was proposed in 1962 by Clark and Lyons, it was the first time that glucose concentration was measured directly from biological fluids. The glucose meter was composed of an oxygen electrode, an inner oxygen semipermeable membrane, a thin layer of glucose oxidase (GOX) and an outer dialysis membrane. The GOX was immobilized in an electrochemical detector to form an enzyme electrode. A decrease in the measured oxygen concentration was proportional to the glucose concentration. Since then three general strategies were developed for the electrochemical sensors of glucose; by measuring oxygen consumption, measuring the amount of hydrogen peroxide produced by the enzyme reaction (see figure 1) or using an immobilized mediator to transfer the electrons from oxidoreductase enzyme to the electrode (Yoo & Lee, 2010).

(15)

In the second generation glucose meter the basic components of the test strip were the immobilized enzyme and the oxidized mediator. The oxidoreductase (GOx) catalyzes the conversion of glucose to gluconlacton, this reaction also involves the reduction of cofactor flavin adenine ninucleotide (FAD). The electrons from the oxidized sugar are transferred to the oxidized mediator (M), which further on delivered them to the electrode. The reaction is summarized next (Wang, 2001):

The self-monitoring blood glucose (SMBG) technology was perfected rapidly. In 1970 test strips designed for visual evaluation by the patient were available in the market. In the late 1980s, test strip measurements became faster and nowadays an accurate measure can be performed in only 5 seconds. In parallel the sample volume required has decreased, initially the customer had to place a large drop of blood (25 µl) on top of the chemistry coating, state of the art devices needs only 0.3-1 µl. A further development was to replace photometric test strips by electrochemical ones filled by capillarity, a major advantage for hygienic and safety reasons (Hönes et al, 2008).

1.3 Oxidoreductases

(16)

According to their cofactor the GDH can be classified in three groups, the EC1.1.5.2 that uses pyrroloquinoline quinine (PQQ) (figure 3A), the EC1.1.99.10 that is FAD dependent (figure 3B), and the EC 1.1.1.47 that requires NAD+ _{(figure 3C). There are two types of} PQQ-GDH, one is intracellular and soluble but has low substrate specificity, and it oxidizes a variety of monosaccharides and disaccharides (mannose, maltose and lactose). This is a main drawback for glucose sensor because the glucose concentration in the blood could be overestimated. The second type of PQQ-GDH is tightly bound to the outer surface of the cytoplasmic membrane, but requires suitable detergents for solubilization and purification. Another type of GDH is the NAD dependent, which exhibits higher substrate specificity and stability than PQQ-GDH, but using this type of enzyme in the glucose sensor requires an additional organic compound to oxidize NADH to NAD+_{electrochemically (Tsujimura}_{et al}_{, 2005).}

Figure 3. Glucose dehydrogenase cofactors , (A) Pyrroloquinoline quinine (PQQ), (B) Flavin adenine dinocleotide (FAD), (C) Nicotinamide adenine dinucleotide (NAD). Source: Access Science Encyclopedia

A glucose dehydrogenase gene (gdh2) from Penicillium chrysogenum, encoding a FAD dependent GDH, was successfully isolated and studied at the Institute of Technical Microbiology at the Hamburg University of Technology. The DNA sequence was amplified and cloned into the host organism P. pastoris for heterologous expression. The FAD-GDH2 enzyme from P. chryogenum exhibits attractive features for glucose monitoring devices. It has high substrate specificity for glucose and less than 1% towards maltose. The characterization of this enzyme showed a pH optimum at 5, the GDH2 is very stable at high temperatures and has an optimum temperature at 50°C. (Halbsguth, 2011).

(17)

choline dehydrogenase, methanol oxidase, and cellobiose dehydrogenase. This family demonstrates the evolutionary flexibility, it enclose a diverse number of enzymes with different catalytic activities however these proteins retained the same overall structure. Allegedly because the tertiary structure of the ancestral protein was compatible to various substrates, yielding low level of catalysis for each, however this enzyme encountered mutational refinements leading to a higher specificity (Cavener, 1992).

When the GDH2 amino acid sequence was analyzed, two domains belonging to the GMC family were identified (see figure 4), the Glucose-methanol-choline oxidoreductase N-terminal (GMC_oxred_N) and the Glucose-methanol-choline oxidoreductase C-N-terminal (GMC_oxred_C). There are some indications that the N-terminus domain could be involved in the FAD binding, and the C-terminus could embrace the catalytic domain (Halbsguth, 2011).

Figure 4. Penicillium chrysogenum glucose dehydrogenase amino acid sequence detailing position of conserved domains (Halbsguth, 2011)

1.5 Site directed mutagenesis

Upon this date there is no data about the X-ray crystallography of this protein, the active site of the GDH2 remains unknown. Other important structures of the enzyme, like the substrate or cofactor binding sites have not been identified.

(18)

primary amino acid sequence and protein shape, stability and activity (Morrison & Weiss, 2001 and Moreira et al, 2007).

Directed amino acid mutagenesis was used to probe the catalytic mechanism of several enzymes including staphylococcal nuclease, aspartate aminotransferase, methionine aminopeptidase, and ribonucleotide reductase. Based on studies on protein structure, mechanistic and mutagenesis the enzyme rate was understood and enhanced, after indentifying the significantly contribution of specific amino acids in the catalytic efficiency. A specific amino acid replacement could modify the size, acidity, nucleophilicity, the hydrogen-binding or the hydrophobic properties of an amino acid side chain (Mendel et al, 1995).

Bak and Sato (1967) studied the enzymatic properties FAD dependent glucose dehydrogenase from Aspergillus oryzae. In their work the histidyl residues were destroyed by photooxidation in the presence of methylene blue and a decrease on the relative activity was observed, suggested the involvement of this residue in the enzymatic activity. Furthermore it was probed that the enzyme could be inhibited by diazo-I-H-tetrazole (DHT), a coupling reagent, employed to titrate the hisitine residues, strongly inhibiting the glucose dehydrogenase activity. The inhibitory effects of silver ions were also reported and associate to the histidine residues. The researchers suggested that the Ag+_{and DHT inhibited the reduction of enzyme-bound FAD by} glucose, and that key histidyl residues are required for the hydrogen transfer from glucose to the flavin enzyme (see figure 5).

Figure 5. Role of the histydyl residue in the glucose dehydrogenase activity Adapted from Bak & Sato (1967)

Glucose

Glucose dehydrogenase

His FAD Acceptor

(19)

Although the photooxidation assay could damage other key amino acids, such as tryptophane and tyrosine, there was a hint on which residues could be exchanged to understand the mechanism of the glucose dehydrogenase. When the GDH2 nucleotide sequence from P. chrysogenum was aligned with other known fungal glucose dehydrogenases, five highly conserved histidine amino acids could be appreciated H158, H238, H435, H514 and H557 (pointed with a star in figure 6). The last three were enclosed in the GMC_oxred_C domain. In the figure 6 the residues present in the fungal enzymes aligned, when the amino acid was present in 80% of the proteins it was marked with grey, and amino acids with an identity of 100% were colored in black.

(20)

present in 80% of the proteins are marked with grey, 100% identity is marked with black, enclosed in the box and depicted with a star, the highly conserved histidine residues. Source: Halbsguth, 2011.

1.6 Heterologous expression in Pichia pastoris

To study the contribution of the highly conserved histidine residues H158, H238, H435, H514, and H557, the recombinant protein must be produced in order to evaluate the biochemical properties of the mutated enzymes.

Pichia pastoris is a heterologous gene expression system utilized to produce attractive levels of a variety of intracellular and extracellular proteins of interest. It is a host that combines the benefits of yeast genetic manipulation, the characteristic growth of prokaryotic organisms, together with the subcellular machinery for performing posttranslational eukaryotic protein modifications. P. pastoris is a methylotrophic microorganism, which permits the use of methanol promoters to regulate the production of recombinant proteins. The alcohol oxidase I (AOX1) is the first enzyme in the methanol utilization pathway, is undetectable in cell cultured on carbon sources such as glucose, glycerol or ethanol. The AOX1 promoter is a strong inducible promoter that controls the expression of foreign genes, and minimizes the selection of non expressing mutant strains during cell growth (Cregg et al, 1993).

1.7 Objectives of the project

(21)

The specific objectives of this project include:

 PCR site directed mutagenesis of gdh2 from P. chrysogenum

 Cloning the mutant genes in the pPIC9 expression vector

 Integration of the mutated genes in the genome of P. pastoris

 Production of the mutated proteins in heterologous host P. pastoris under the regulation of the AOX1 promoter

 Purification of the recombinant GDH2 protein from the fermentation supernatant of P. pastoris by Nickel affinity chromatography

 Characterization of kinetic properties of GDH2 mutant proteins

 Identification of the FAD cofactor bound to the mutated proteins

(22)

(23)

Chapter 2: Materials

To probe the individual contribution of highly conserved amino acids and analyze how the mutation could adversely affect glucose dehydrogenase function a P. chrysogenum

expression system was required.

2.1 Glucose dehydrogenase gene

Plasmid DNA containing the gdh2 gene was provided by Tobias Halbsguth to use as a template for the cloning strategy of this project that seek to understand by site directed mutagenesis and alanine scanning the importance of highly conserved histidine residues in the functionality and structure of the GDH from P. chrysogenum.

2.2 Expression Vector

The vector pPIC9 from Invitrogen was successfully used to express in Pichia pastoris the

(24)

Figure 7. Map and MCS of pPIC9 expression system, showing the special features of the plasmid and the restriction sites used for cloning EcoRI and NotI (enclosed in a box) and the 5’ and 3’ primers used for sequencing (depict inside a discontinuous box). Source: Invitrogen, Expression Kit user manual, 2009.

2.3 Pichia pastoris strain GS115

(25)

2.4 Chemicals

The chemicals used for the elaboration of buffers, solutions and mediums are listed in the following section according to the task where they were employed

Escherichia coli cultivation medium

 LB agar plates: 1% tryptone, 0.5% yeast extract, 1% NaCl, 1.5% agar

 LB liquid medium: 1% tryptone, 0.5% yeast extract, 1% NaCl

 SOC medium: 0.5% yeast extract, 2% tryptone, 10mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10mM MgSO4, 20 mM glucose

Buffers for restriction digest

 1X BamHI: 10 mM Tris-HCl pH 8, 5 mM MgCl2, 100 mM KCl, 0.02% Triton and 0.1 mg/ml BSA

 1X Buffer SacI: 10 mM Bis-Tris-Propane-HCl pH 6.5, 10 mM MgCl2 and 0.1 mg/ml BSA

 1X Orange Buffer: 50 mM Tris-HCl (pH 7.5 at 37°C), 10 mM MgCl2, 100 mM NaCl, 0.1 mg/ml BSA

DNA electrophoresis

 50X TAE buffer: 242g Tris base, 57.1ml Glacial Acetic Acid, 18.6 g EDTA, distillated water up to 1 L

 6X loading dye: 10 mM Tris-HCl (pH 7.6), 0.03% bromophenol blue, 0.03% xylene cyanol FF, 60% glycerol, 60 mM EDTA

DNA ligation

 10X T4 DNA ligase buffer: 400 mM Tris-HCl, 100 mM MgCl2, 100 mM DTT, 5 mM ATP, pH 7.8

Pichia pastoris cultivation media

 YPD: 1% yeast extract, 2% peptone, 2% dextrose (glucose)

 Minimal Dextrose Medium (MD): 1.34% Yeast Nitrogen Base, 4x10-5 _{% biotin,} 2% dextrose

(26)

 Fermentation Basal Salts Medium: 26.7 ml Phosphoric acid, 1.18 g Calcium Sulfate, 18.2 g Potassium Sulfate, 14.9 g Magnesium Sulfate-7H2O, 4.13 g Potassium Hydroxide, 40 g Glycerol and distillated H2O up to 1 L.

 Pichia Trace Metal Salts (PTM): 6 g Cupric Sulfate-5 H2O, 0.08 g Sodium Iodide, 3 g 0.2 g Manganese Sulfate-H2O, 0.2 g Sodium Molybdate-2H2O, 0.02 g Boric acid, 0.5 g Cobalt Chloride, 20 g Zinc Chloride, 65 g Ferrous Sulfate-7H2O, 0.2 g Biotin, 5 ml Sulfuric Acid, distillated H2O up to 1 L

SDS-PAGE protein analysis

 4X Sample buffer: 7.5 ml Glycerin, 2.5 ml Mercaptoethanol, 1.2 g SDS, 0.5 ml bromophenol blue 2% (w/v)

 SDS-PAGE 1X Electrophoresis buffer: 30.3 g Tris, 144.1 g Glycine, 10 g SDS, 1000 ml distillated H2O, pH 8.4

 Separation buffer: 18.2 g Tris, 0.4 g SDS up to 100 ml distillated H2O, pH 8.8

 Stacking buffer: 6.1 g Tris, 0.4 g SDS up to 100 ml distillated H2O, pH 6

 De-staining solution: 300 ml ethanol, 100 ml acetic acid, up to 1000 ml distillated H2O

Enzyme activity assay

 Sodium Citrate buffer: 60 mM citric acid, adjust pH to 6 with NaOH

 5X Bradford solution: 100 mg Coomasie Brilliant Blue diluted in 50 ml 95% ethanol, mixed with 100 ml concentrated phosphoric acid, and adding distillated water up to 200 ml

Deglycosylation assay:

(27)

Chapter 3: Methods

A list of the main tasks performed to achieve the goal is summarized in the table 1, in the figure 8 the sequence of the methods used are illustrated.

Table 1. Experimental outline of the cloning strategy for the site directed mutagenesis of highly conserved histidine residue in the gdh2 gene and the subsequent expression of the recombinant proteins in P. pastoris

Step Action

1 Analysis of the gdh2 gene from P. chrysogenum and identification of the highly conserved histidine residues that could be involved in the catalytic mechanism of this enzyme.

2 Amplification of the 3’ and 5’regions of the gdh2 gene separately, using mutagenic primers that incorporate to both segments the point mutation or the deletion of the putative catalytic domain. Fusion of the PCR fragments by a third amplification reaction giving the mutant gdh2

3 Cloning of the mutant genes in the expression vector pPIC9 with EcoRI and NotI, after purification of the fragments.

4 Transformation of E.coli NovaBlue chemically competent cells with the six recombinant plasmids pPIC9::gdh2h158a/h238a/h435a/h514a/h557a and

Δgmc_oxred_c. Analysis of transformants by colony PCR, restriction digestion and DNA sequencing

5 Transformation and integration of P. pastoris with the previously linearized pPIC9::gdh2h158a/h238a/h435a/h514a/h557a and Δgmc_oxred_c and analysis of

Pichia’s integrants by PCR

6 Expression of mutant genes in P. pastoris recombinant strains and fermentation of the strains, monitoring of cell growth and glucose dehydrogenase activity.

7 Protein purification using Ni-NTA columns for the purification of 6xHis tagged GDH2 mutant proteins

8 Kinetic experiments of the mutant and wild type GDH2 9 Deglycosylation assays on the purified GDH2 mutant proteins

(28)

(29)

3.1 Analysis of gdh2 sequence

The amino acid sequence of glucose dehydrogenase (GDH2) from P. chrysogenus was used as template primary structure analysis and to construct a model of the tertiary structure. For both studies the intrinsic signal peptide of the GDH2 was excluded from the alignments.

3.1.1 GDH2 primary structure

The CLUSTALW algorithm was used to align the protein sequence of GDH2 with: the choline oxidase FAD dependent from Arthrobacter globiformis (UniProt Q59117), the glucose oxidase (GOX) protein sequences from Aspergillus niger (UniProt P13006) and

Penicillium amagasakiense (UniProt P81156), and with the amino acid sequence from the FAD-GDH from Burkholderia cepacia (UniProt Q8GQE7).

3.1.2 GDH2 tertiary structure model

The programs SWISS Work space, SWISS Model and the SWISS-Pdb Viewer were employed to model a theoretical tertiary structure of the GDH2 based on the structural alignment and comparison of active sites and relevant domains (Arnold et al, 2006; Schweder et al, 2003; Guex et al, 1997).

3.2 PCR Site Directed Mutagenesis

The Polymerase Chain Reaction was employed to introduce five punctual mutations in the gdh2 gene; these mutations comprise the exchange of a specific histidine residue (highly conserved among other glucose oxidases) by an alanine residue. In addition a truncated version of the gdh2 gene was also achieve by PCR, designing a reverse primer that excluded the putative catalytic domain of the glucose dehydrogenase

(30)

signal was excluded. The Gdh2-rev_His_NotI and the Deletion_F_rev primers include a 6xhistidine tag, a termination codon and a NotI restriction site.

Table 2. Primers for the amplification of glucose dehydrogenase (gdh2)

Primer name Primer sequence

Gdh2_EcoRI_oSP_fw 5'-AAAGAATTCGTCCCCCATGCGTCACACAAA TC-3'

His158Ala_A_fw 5'-GATCCGGCCTACGCCGGCTTTACTGGGCCC -3'

His238Ala_B_fw 5'- CAGAACAGAACCAATCTCGCTGTCTGGCTCAATAC-3'

His435Ala_C_fw 5'-CGCGGTAGCATTGCCCTCTCTTCTGCGG -3'

His514Ala_D_fw 5'-CCGGTCAAACTTTGCCCCGATTACCACAGC -3'

His557Ala_E_fw 5'-CCAGGTCTGTGGTGCCCTCCAGAGCACCG -3'

His158Ala_A_rev 5'-GGGCCCAGTAAAGCCGGCGTAGGCCGGATC -3'

His2388Ala_B_rev 5'- GTATTGAGCCAGACAGCGAGATTGGTTCTGTTCTG-3'

His435Ala_C_rev 5'-CCGCAGAAGAGAGGGCAATGCTACCGCG -3'

His514Ala_D_rev 5'-GCTGTGGTAATCGGGGCAAAGTTTGACCGG-3'

His557Ala_E_rev 5'-CGGTGCTCTGGAGGGCACCACAGACCTGG-3'

Deletion_F_rev 5'-AAAGCGGCCGCTTAATGGTGATGGTGATGGTGGGGCGATAGCAGGATCTCT GC-3'

Gdh2_rev_His_NotI 5'- AAAGCGGCCGCTTAATGGTGATGGTGATGGTGCAACTGCCCCTTGATGATG TCGG-3'

The mutagenesis strategy is represented in the figure 9. Two individual PCR reactions per construct were needed to incorporate the point mutation in the site of the highly conserved histidine residues (depicted in bold letters). The first PCR reaction amplified the 5’ end of the gdh2 gene until the histidine triplet of interest (H158, H238, H435, H514, and H557); a special reverse primer was used along to incorporate the punctual mutation where the histidine residue was exchange by alanine. A similar approach was followed in the second PCR reaction were the goal was to produce the 3’ end of the gdh2

(31)

(32)

Figure 9. Schematic representation of the PCR site directed mutagenesis of the gdh2 gene from P. chrysogenum. The positions of the codons for highly conserved histidine (H) residues are depicted on bold letters. The mutagenic primers are abbreviated with the last 3 letters of their name. Two parallel PCR reactions were set to amplify the 5’- and the 3’- ends of the gene using mutagenic primer to incorporate the point mutation, represented by a start, to the DNA fragment mutation. The construction of the truncated gdh2 gene needed only a particular reverse primer complementary to the sequence neighboring the GMC_oxred_C domain, symbolized, as a red rectangle were 3 highly conserved histidine residues H435, H515 and H557are enclosed.

In a first PCR reaction the 5’ region of the gdh2 gene was amplified with a specific pair of primers. The forward primer (Gdh2_EcoRI_oSP_fw) was designed complementary to the beginning of the codifying gdh2 sequence, although the initiation codon and the intrinsic signal peptide of the gdh2 were excluded, and an EcoRI recognition site was incorporated. Six different reverse primers were used in combination with Gdh2_EcoRI_oSP_fw to amplify each one of the specific mutations. The reverse primer employed annealed to the region flanking the histidine codon of interest but it contained an inner disparity where the specific histidine codon was replaced by an alanine codon.

(33)

Table 3. Composition of the PCR mix used for the amplification of the 5’ region of the six mutated versions of glucose dehydrogenase gene from P. chrysogenum

Component Volume

[μl] Concentration Final

MilliQ water (sterile) 33.25 -

5XPhusion HF Buffer 10 1x

10 mMdNTPs 4 200 μM (each)

20 μM Forward Primer: Gdh2_EcoRI_oSP_fw 1 0.4 μM

20 μM Reverse Primer:

A_rev/B_rev/C_rec/D_rev/E_rev/F_rev 1 0.4 μM

DNA template 0.5

Phusion® DNA polymerase 0.25

Table 4. Cycling specifications for the amplification of the 5’ region of the six mutated versions of glucose dehydrogenase gene from P. chrysogenum

PCR stage Temperature

[°C] Time [s] Cycles

Initial denaturation 98 120 1

Denaturation 98 30 30

Annealing 58.8/58.3.5 30 30

Extension 72 30 30

Final extension 72 600 1

The second PCR reaction produced a DNA fragment containing the C-terminus region of the glucose dehydrogenase. For the amplification a forward mutagenic primer was designed to match the region bordering the particular histidine codon but containing the internal difference that provoked the mutation, a codon exchange of histidine by alanine. Furthermore the reverse primer used, paired the 3’ end of the gdh2 gene, and incorporated a histidine tag and a restriction site for NotI into the PCR products.

The amplification of the 3’ end of the gdh2 gene was done in the same manner as the polymerase chain reaction for the 5’ regions previously explained. The components used in the PCR mixture and the cycling conditions are summarized in the tables 5 and 6.

Table 5. Composition of the PCR mix used for the amplification of the 3’ region of the six mutated versions of glucose dehydrogenase gene from P. chrysogenum

20 μM Forward Primer: A_fw/B_fw/C_fw/D_fw/

E_fw/F_fw 1 0.4 μM

(34)

Table 6. Cycling specifications for the amplification of the 3’ region of the six mutated versions of glucose dehydrogenase gene from P. chrysogenum

[°C] Time [s] Cycles

Annealing 68.4/69.7 30 30

Extension 72 30 30

The out coming PCR products containing the 5’ and 3’ ends of the glucose dehydrogenase mutated genes were separated by agarose electrophoresis with TAE 1X buffer for 30 minutes at 100 V. The majority of DNA fragments were analyzed in 1% agarose gels; however the amplicons with expected size lower than 400 bp were examined in a matrix with 1.5% agarose. The visualization of the DNA molecules was adding to each gel possible 0.4mg/ml of ethidium bromide (EtBr) and exposing to UV light.

For the size determination 5 μl of the GeneRuler 1 kb or 100bp DNA ladder ready to use from Fermentas were employed. After corroborating the expected size of the fragment, the mixture resultant from the PCR was purified with the GENE Jet™ PCR Purification Kit from Fermentas. The DNA extraction was done according to the manufacturer’s protocol, although the procedure was modified, in the last step where the DNA was eluted in sterile MilliQ water pre-warmed to 65°C before applying to the column.

(35)

Table 7. Composition of the PCR mix used for the amplification of five point mutations of the glucose dehydrogenase gene from P. chrysogenum

20 μM Forward Primer: Gdh2_EcoRI_oSP_fw 1 0.4 μM

20 μM Reverse primer: Gdh2_rev_His_NotI 1 0.4 μM

DNA template with the 5’ end of the gdh2 gene 1 DNA template with the 5’ end of the gdh2 gene 1

Phusion® DNA polymerase 0.5

Table 8. Cycling specifications for the amplification of five point mutations of the glucose dehydrogenase gene from P. chrysogenum

[°C] Time [s] Cycles

Annealing 58 30 30

Extension 72 30 30

The amplicons from the fusion PCR were separated by electrophoresis in a 1% agarose matrix with buffer TAE 1X for 30 minutes at 100 V. After confirming the expected sizes 1766 bp and 1272 bp for the point mutations and the truncated gene respectively, the mutated genes were purified with the GeneJet kit as previously explained.

3.3 Cloning the mutated gdh2 genes into the expression vector

The planned strategy permitted a direct cloning of the mutated gdh2 genes into the

EcoRI and NotI sites on the multiple cloning site of the pPIC9 expression vector. Three extra nucleotides were added at the 5’ end of each primer sequence, this served as an overhang allowing a proper digestion of the PCR fragments with the restriction enzymes.

(36)

Table 9. Composition of restriction digests mix used for the cloning of the mutated

gdh2 genes into the pPIC9 vector

[μl]

MilliQ water (sterile) 22

10X Buffer Orange 3

DNA 3

EcoRI 1

NotI 1

To verify that both enzymes successfully cut the six genes of interest and the vector, 15 μl of the double restriction mixture were loaded in a 1% agarose gel, after electrophoresis, the DNA fragments with the expected size were excised from the gel and purified with the GeneJet™ Gel Extraction Kit following the protocol suggested by Fermentas, although the elution was done using MilliQ sterile water pre warmed at 65°C.

The complementary ends generated by the restriction enzymes favored the subsequent ligation of the DNA molecules mediated by the T4 DNA Ligase. The molar ratio of insert over vector used was 3:1, the exact composition of the ligation mixture is detailed in the table 10; the six reactions were incubated in ice water overnight.

Table 10. Compositions of ligation mix used for the cloning of the mutated gdh2 genes into the pPIC9 vector

[μl]

10X T4 DNA Ligase Buffer 1

Vector: pPIC9 1

insert: gdh2 h158a/h238a/h435a/h514a/h557a/Δgmc 7

T4 DNA ligase 1

(37)

A

(38)

(39)

Figure 10. Schematic representations of the expression vectors containing the mutated glucose dehydrogenase genes of P. chrysogenus obtained by PCR site directed mutagenesis of the codon

E

(40)

the pPIC9 expression system, ampicillin resistance (Amp), pBR322 origin of replication for E. coli

(pBR322), the AOX1 promoter (pAOX1), P. pastoris wild type gene encoding histidinol dehydrogenase (HIS4), N-terminal protein secretion signal (S), sequence from the AOX1 gene that targets the plasmid integration at the AOX1 gene (3’AOX1), the native transcription termination and polyadenylation signal from AOX1 gene (TT). Figures created in GENtle Map Software version 1.9.4 based on Invitrogen Expression Kit user manual, 2009

Table 11. Description of the expression vectors containing the mutated glucose

dehydrogenase genes of P. chrysogenum obtained by PCR site directed mutagenesis

Construct name Size

[bp] Elements Purpose

pPIC9::gdh2h158a 9769 gdh2h158a, AOX1

promoter, α factor secretion signal, 3’ AOX1,

HIS4, ampR_{, pBR322, TT}

Investigate the contribution of the H158 residue in the activity of the glucose dehydrogenase from P. chrysogenum

pPIC9::gdh2h238a 9769 gdh2h238a,

AOX1promoter, α factor secretion signal, 3’ AOX1, HIS4, ampR_{, pBR322, TT}

promoter, α factor secretion signal, 3’ AOX1,

promoter, α factor secretion signal, 3’ AOX1,

pPIC9::gdh2Δgmc_oxred_c 9769 gdh2Δgmc_oxred_c , AOX1 promoter, α factor secretion signal, 3’ AOX1,

Investigate the contribution of the GMC-oxred_C domain in the activity of the glucose dehydrogenase from P. chrysogenum

(41)

were spread in aliquots of 20, 50 and 100 μl, onto LB plates with 50 μg/ml carbenicillin. After incubation of the plates at 37°C overnight, the colony-forming-unit CFU were counted.

3.4.1 Analysis of E.coli recombinant plasmids

The colonies growing on the selection media (LB+50 μg/ml carbenicillin) had to be tested to confirm the presence of the recombinant plasmids, pPIC9::gdh2h158a,

pPIC9::gdh2h238a, pPIC9::gdh2h435a, pPIC9::gdh2h514a, pPIC9::gdh2h557a and pPIC9::gdh2ΔGMC_oxredC. With this intention 3 assays were performed, firstly a colony PCR that would result in a DNA fragments present only in clones containing the glucose dehydrogenase gene. Secondly a restriction digest analysis with BamHI was performed, based on the presence of two recognition sites in the glucose dehydrogenase gene, and one restriction site in the backbone of the pPIC9 site. The final method to validate the site directed mutagenesis was sequencing the multiple cloning sites, this was done by Eurofins MWG GmbH (Ebersberg, Germany).

3.4.2 Colony PCR

The colony PCR sought to amplify a fragment of the glucose dehydrogenase gene present in all the constructs, this allowed the screening of a wide number of clones in parallel. In total ten clones per constructed were screened, a sample of the colony growing in the agar plate was picked with a sterilized toothpick and scrape on a PCR tube. Consequently aliquots of PCR master mix containing Taq DNA polymerase (produced at the Institute of Technical Microbiology, TUHH) were added to the cell pellets. The detailed composition of the PCR mix as well as the conditions used for the PCR are summarized in the table 12

Table 12. Composition of the reagent mix used for the amplification of the glucose dehydrogenase gene from P. chrysogenum

10x Taq Buffer 1 1x

25 mM MgCl2 1 2.5 mM

10 mMdNTPs 0.8 200 μM (each)

20 μM Forward Primer: Gdh2_EcoRI_oSP_fw 0.2 0.4 μM

20 μM Reverse primer: his2388Ala_B_rev 0.2 0.4 μM

(42)

Table 13. Cycling specifications for the amplification mutated glucose dehydrogenase genes from P. chrysogenum

[°C] Time [s] Cycles

Annealing 58 30 30

Extension 72 30 30

With the primers employed a DNA fragment of 737 bp was expected in all the constructs enclosing the glucose dehydrogenase gene, positive and negative control reactions were prepared to corroborate that the PCR conditions were appropriate, using a plasmid with the wild type gdh2 and MilliQ water respectively. After amplification the products of the PCR were analyzed in 1% agarose gels. Ten clones per construct were screened with this method; one clone showing the desired amplicons (for each construct) was chosen for subsequent plasmid DNA sequencing.

3.4.3 Restriction digest analysis

To corroborate that the presumed positive clones had the mutated version of the gdh2

gene inserted in the expression vector, the recombinant plasmids were purified from 5 ml LB cultures with the assistance of the GeneJet Plasmid Miniprep Kit (Fermentas GmbH, St Leon Rot).

(43)

with a length of 530 and 8750 bp. An illustration of the location of the recognition sites for BamHI in each of the plasmid can be observed in the figure 4.

Six reaction were prepared with a 1 μl of plasmid preparation from pPIC9::gdh2h158a,

pPIC9::gdh2h238a, pPIC9::gdh2h435a, pPIC9::gdh2h514a, gdh2h557a and pPIC9::

Δgmc_oxred_c, the components and the amounts used are detailed in the table 14; the digestion was incubated at 37°C for 3 hours.

Table 14. Composition of restriction digests mix used for the analysis of recombinant plasmids

[μl]

MilliQ water (sterile) 7.5

1X BamHI Buffer 1

DNA 1

BamHI 0.5

The cut plasmids were separated by electrophoresis in a 1% agarose gel, 1 μl of the uncut plasmid was also loaded to the gel to visualize then migration and size of the supercoiled DNA.

3.4.4 DNA sequencing

After identifying six putative candidates clones of E.coli carrying the recombinant plasmid of interest, two aliquots of each plasmid preparations were sent to the facilities of Eurofins MGW Operon, were sequencing reactions were performed using the 5’AOX1

and 3’AOX1 primers. As shown in the figure 1, this primers flank the MCS of the pPIC9 vector. The resulting forward and reverse readings were aligned using the eBioX software; this permits to identify the mutations, the correct reading frame, and the presence of the secretion signal, among others.

3.5 Transformation and integration of Pichia pastoris

(44)

To achieve the transformation of P. pastoris it was necessary to prepare electrocompetent cells, linearized the plasmid DNA and performed six individual electroporation events. The transformation of P. pastoris was performed by a combination of the methods by Wu & Letchworth (2004) and Cereghino et al (2008).

3.5.1 Prepare electrocompetent cells

An aliquot of P. pastoris GS115 were used to inoculate 20 ml of YPD, the cells were incubated overnight at 30°C. The next day 20 μl of the preculture were used as inoculum for 250 ml of fresh YPD medium, when this culture reach an OD600 of 2.165, the cell concentration was calculated using the formula:

1 Absorbance600 = 5x107_cell/ml

The concentration of the cells harvest was 6.20x107_{cell per ml, these cells were} centrifuged in sterile falcon tubes at 1500xg for 5 minutes at 4°C. The recovered cell pellet was later resuspended in 124 ml of pretreatment buffer (100 mM LiAc, 10 mM DTT, 0.6 mM sorbitol, 10 mM Tris-HCl, pH7), incubated on ice for 30 minutes and centrifuged for 5 minutes at 4°C. The pretreatment buffer volume was calculated according to the next relation:

8x108_{cell resuspended in 8 ml pretreatment buffer}

Afterwards the cells were centrifuged and resuspended in 23.25 ml of 1 M sorbitol using the following relation:

8 ml pretreatment buffer resuspended in 1.5 ml 1 M ice-cold sorbitol

The cell pellet was washed three times with the same volume of ice-cold sorbitol, and finally resuspended in 250 μl of sorbitol, from this volume aliquots of 80 μl were prepared for the electroporation assays.

3.5.2 Linearization of the DNA

(45)

enzyme which produced a single cut in the backbone of the vector, it should not have a recognition site inside the gdh2 mutated genes. The enzyme SacI (5’-GAGCTC-3’) was chosen; this enzyme cuts in the 5’AOX1 region of the recombinant plasmid at the 221 bp. According to the Pichia expression Manual from Invitrogen if the P. pastoris strain GS115 is used and the expression vector is linearized with SacI the phenotype from the transformants will be His+_Mut+_{. The pPIC9::}_gdh2h158a_{, pPIC9::}_gdh2h238a_, pPIC9::gdh2h435a, pPIC9::gdh2h514a, gdh2h557a and pPIC9::gdh2Δgmc_oxred_c were incubated at 37°C for 3 hours with SacI, the exact composition of the restriction digest reaction is detailed in the table 15.

Table 15. Composition of restriction digest mix used to linearize the recombinant plasmids

[μl]

MilliQ water (sterile) 16

1X Buffer SacI 2

DNA 1

SacI 1

After incubating the samples for 3 hours at 37°C, the enzyme was deactivated at 65°C for 20 minutes. Afterwards 80 μl of MilliQ sterile water were added to each sample, and the resulting 100 μl were purified with the GeneJet PCR Purification Kit, in the final step the DNA was eluted in 20 μl of pre-warmed MilliQ water.

3.5.3 Transformation

The aliquots of P. pastoris cells pre-treated with lithium acetate and dithiothreitol were gently mixed with 15 μl of the linearized pPIC9::gdh2h158a, pPIC9::gdh2h238a,

(46)

3.5.4 Analysis of Pichia pastoris integrants by PCR

The strain of P. pastoris GS115 used for transformation has a mutation in the histidinol dehydrogenase gene (his4) that prevents it to synthesize histidine. However the pPIC9 plasmid has Pichia wild-type gene histidinol gene, if the recombinant plasmid was integrated in the genomic DNA of the P. pastoris GS115 after transformation, the yeast will be able to grow of minimal media without histidine supplementation (MD). For these reason sixteen clones were chosen per construct and streaked onto new MD plates, the clones that continue to grow were considered positive.

In spite of this fact the integrants were further analyzed by PCR to assure they possess the glucose dehydrogenase gene from P. chrysogenum. A quick DNA extraction carried out, a small cell clump scratched from the colonies growing in the MD plates was resuspended it in 50 μl MilliQ water, afterwards a tip of spatula of glass beads 425-600 μm (acid washed) were added to the cell suspension, next the mixture was incubated at 95°C for 10 minutes, subsequently mixed in the vortex at medium speed for 5 minutes, and finally centrifuge to recover the supernatant. A supernatant aliquot of 5 μl was used as a template for PCR reaction with the primers Gdh2_EcoRI_oSp_fw and His238Ala_B_rev; the amount of reagents used reviewed on the table 16, the thermal cycling conditions are the same used for colony PCR (table13).

Table 16. Composition of the reagent mix used for the amplification of the glucose dehydrogenase gene from the genomic DNA of P. pastoris integrants

10x Taq Buffer 1 1x

25 mM MgCl2 1 2.5 mM

10 mMdNTPs 0.8 200 μM (each)

20 μM Forward Primer: Gdh2_EcoRI_oSP_fw 0.2 0.4 μM

20 μM Reverse primer: his2388Ala_B_rev 0.2 0.4 μM

Genomic DNA preparation 5

Taq DNA polymerase 0.2

The 10 μl PCR products aliquots were loaded onto a 1% agarose gel, to confirm the presence of the 737 bp fragment from P. chrysogenum glucose dehydrogenase gene.

(47)

combination with a different mutation of the glucose dehydrogenase gene from P. chrysogenum.

3.6.1 Fermentation

The cultivation of P. pastoris recombinant strains was individually performed in 2L laboratory bioreactor (BioEngineering, Switzerland) following the protocols suggested by Invitrogen in the manual “Pichia Fermentation Process Guidelines”(2002). Along the fermentation process the key parameters were monitored. The temperature was maintained at 30°C because higher ranges would be detrimental for the protein expression; the temperature was controlled with the help of the heating element, a cooling system and Pt100 sensor. The dissolved oxygen (DO) indicates the glycerol or methanol metabolization rate, for this reason the DO was continuously measured by a DO-sensor. The aeration flow was maintained in the range of 0.1-1 vvm to maximize the oxygenic concentration in the medium. With assistance of the pH sensor and the peristaltic pumps for acid and base the pH range was controlled and kept at pH 5. An antifoam agent was added under special circumstances to avoid denaturation of the secreted protein.

The glycerol batch fed was started with the inoculum preparation, for this a colony from each one of the six P. pastoris genetically modified was independently employed to start a 100 ml culture in Buffered Glycerol-complex medium (BMGY). The yeast broth was agitated at 250 rpm and grew at 30°C until it reached an OD600between 2 and 6. When the preculture attained the desired optical density it was used to inoculate 1 L of the Fermentation Basal Salt medium with a seed of 5-10%. The liquid media was autoclaved in situ, cooled down and supplemented with 4.35 ml P. pastoris trace metal salts (PTM).

(48)

3.6.2 Sampling

The growth of P. pastoris was monitored at various time points; measures of the culture optical density at 600 nm (OD600), as well as determinations of the dry and wet weights were performed periodically during the whole fermentation process.

For these purpose samples of 10 ml of fermentation broth were extracted from the bioreactor and centrifuged at 4000xg for 10 minutes, the cell pellet was used in the determination of the dry and wet weight and the supernatant was transferred to a new tube and tested for glucose dehydrogenase activity. The determination of the optical density was performed using 1 ml aliquot of the yeast culture and diluting 1:100 or 1:1000.

The glucose dehydrogenase activity was determined indirectly as the reduction of the 2,6-dichloroindophenol (DCIP). The assay was started when 50 μl of GDH solution were incubated with the components of the master mix (glucose, DCIP, Na-citrate buffer) previously warmed at 50°C. The glucose dehydrogenase transfers electrons from the glucose to the DCIP, this compound changes its conformation from the oxidized (blue) form to the reduced (colorless) state. This color change was spectrophotometrically monitored as a decrease rate in absorbance at 600 nm (Varian Cary 50 Spectrophotometer, Agilent Technologies, Santa Clara). The pippeting scheme for the reaction is described in the table 17.

Table 17. Pippeting scheme for the determination of glucose dehydrogenase activity

Component Volume added

[μl] Final concentration

1 mM DCIP 100 0.1 mM

1 M Glucose 40 40 mM

60 mM Sodium citrate buffer pH 6 810 48.6 mM

GDH2 solution 50

The measured change in absorption per minute (ΔAbs/min) was used to calculate the enzyme activity following the next relation:

(49)

3.6.3 Harvest Pichia pastoris

The cells from the fermentation were harvested using a super-speed Sorvall centrifuge at 7000 rpm for 30 minutes at 4°C. The resulting supernatant was recovered and filtered using 0.45-μm membrane filters from Whatman®. A sample from the cell pellet was store in a 50 ml falcon tube at -20°C.

3.7 Purification of 6xhis tagged GDH2 mutant proteins

An aliquot of 140 ml from each of the six fermentations supernatant was prepared for purification. Firstly the pH of sample was adjusted to with NaOH, afterwards the suspension was centrifuged in 50 ml falcon tubes using a speed of 4000xg during 10 minutes at 4°C. The resulting pellet was discarded and the solution was filtered using 0.2-μm membrane filters from Whatman®.

3.7.1 Nickel Affinity Chromatography

A metal chelate affinity chromatography was employed to purify the 6xhis tagged recombinant proteins from the supernatant. This technique is based on the interaction between the histidine residues and the immobilized Nickel ions. The NiNTA matrix from Qiagen provided a unique environment for the protein binding; the Nitrilotriacetic ligand has a tetradentale-chelating group that occupies 4 of the 6 sites in the nickel coordination sphere as pictured in the figure 11.

(50)

A fast protein liquid chromatography (FPLC) was performed using a pre-packed 25 ml NiNTA superflow column from Qiagen adapted to the Äktapurifier from GE Healthcare. During the liquid chromatography the absorption at 280 nm, the conductivity and the pressure were constantly measured though the process. The overpressure limit was set to 0.5MPa; the steps were performed following the specification from the table 18.

Table 18. Liquid chromatography using NiNTA column to purify the 6xHis tagged Glucose Dehydrogenase mutated proteins

3.7.2 Analysis of elution fractions

The collected elution fractions were analyzed in a 12% SDS-polyacrylamide-gel to verify the presence of a single band representing the 6xhis tagged GDH2. The samples were prepared before by mixing 35 μl of the elution fraction with 10 μl of 4X sample buffer and boiling the solution for 10 minutes at 95°C. Subsequently the samples were separated by electrophoresis with 1X electrophoresis buffer at 120 V for 1 hour.

Table 19. Preparation of Polyacrylamide-SDS gels for separation of GDH2 mutated proteins

Reagent 12% Separation gel Stacking Gel

40% (w/v) Acrylamide 3 ml 0.6 ml

Separation buffer 2.5 ml -

Stacking buffer - 1.2 ml

Distillated water 4.5 4 ml

TEMED 5 μl 5 μl

10%APS 100 μl 100 μl

To corroborate the efficiency of the purification protocol, after electrophoresis the SDS-PAGE gels were stained with Coomassie brilliant blue and then rinsed with de-staining solution. The bands were compared against the unstained protein molecular weight

Step Solution Uploaded Volume

[ml] [ml/min] Flow rate

Sample loading Fermentation’s supernatant, pH7 100 1

Protein binding 50 mM NaH2PO4, 300 mM NaCl, pH 8 50 2

Wash 50 mM NaH2PO4, 300 mM NaCl,

20 mM imidazole, pH 7 100 2

Elution 50 mM NaH2PO4, 300 mM NaCl,

(51)

marker from Fermentas, the expected sizes were 63.5 kDa for the GDH2 protein with the point mutation, and 46 kDa for the GDH2 truncated version.

3.7.3 Protein dialysis

The purifications fractions with the single GDH2 protein were collected and later loaded into Visking® dialysis tubing with exclusion limit of 10 kDa. Before filling the protein solution the membrane was incubated on boiling water for 5 minutes, cooled down and shaped like a cylinder; one border was sealed and the other end was fastened tight to a clamp. The dialysis sack was fixed to a floatation device and place on a 5 L beaker filled with 60 mM Sodium citrate buffer pH 6, the system was agitated with a magnetic stirrer overnight. The next day the purified protein was recovered from the membrane and placed in a 50 ml sterile falcon tube and stored at 4°C.

3.7.4 Determination of protein concentration

The protein content of the purified GDH was determined via the Bradford method, an aliquot of 10 μl of the samples was incubated with 990 μl of 1X Bradford solution, after 5 minutes the absorbance at 595 nm was determined with a spectrophotometer. The values obtained were compared with BSA calibration curve previously prepared.

3.8 Deglycosylation assay

(52)

Figure 12. PNGase F cleaves when a 1-6Fucose is on the core GlcNAc based on Tretter et al

(1991). (Source: New England BioLabs)

The deglycosylation reaction was performed according to the guidelines from New England Biolabs, an aliquot from the fermentation’s supernatant containing 15μg of protein was incubated with 1 μl denaturing buffer at 100°C for 10 minutes. Afterwards 2 μl NP40, 2 μl 10X Reaction Buffer and 1 μl PNGase F were added to the mixture and the reaction was incubated overnight at 37°C. After the deglycosylation assay the proteins were analyzes on 12 % SDS-PAGE, following the electrophoresis protocol previously described in the section 3.7.2.

The purified proteins were also evaluated with this technique, using 10 μg of the purified and dialyzed GDH2 with the same procedure used for the fermentation’s supernatant.

3.9 Determination of enzyme kinetics

The reaction rate was calculated as previously explained in the section 3.6.2, were the measured change in the absorbance (ΔAbs/min) was a reflex of the reduction rate of DCIP. One unit of GDH2 was defined as the amount of enzyme necessary for the reduction of 1 μmol DCIP, as summarized in the scheme bellow:

Figure 13. Scheme of the glucose dehydrogenase action transferring oxidizing the glucose, the D-Glucose

D-glucono-1,5-lactone

GDH2

FAD FADH2

DCIPoxidize

d

DCIPreduce

(53)

The KM and Vmax the kinetic parameters were experimentally determined performing a series of activity assays were the glucose concentration was increase but the enzyme concentration was maintained; based on the Michaelis Menten Model a theoretical maximum will occurred when the enzyme active sites are saturated.

Kinetics studies were performed for two proteins the GDH2 and the GDH2H238A, the first one is the wild type produced by the expression of the glucose dehydrogenase gene from P. chrysogenum, the second one is the product of the same gene with a site directed mutation where the highly conserved histidine in the position 238 was exchange by alanine. The influence of the H238 residue on the substrate binding can be analyzed by comparison of the KM and Vmax values with the ones obtained for the wild type.

3.10 Detection of FAD spectrum

The purified proteins were resuspended in 4 ml Sodium citrate buffer pH 6, filtered with a 0.2 µm Membrane filter and further concentrated to 1 ml final volume using an Amicon® Ultra 4 10K device. To evaluate the influence of the highly conserved histidine residues in the binding site of the FAD cofactor, the spectrum of the purified mutant proteins GDH2H238A, GDH2H514A and GDH2H557A was recorded with a Spectrophotometer (Varian Cary 50, Agilent Technologies, Santa Clara). Absorbance was measured at room temperature in 60 mM Sodium citrate buffer pH 6 from =280 - 700 nm at a scan rate of 300 nm/min and a data intervals of 0.5 nm. The spectrum was recorded before and after addition of 50 mM glucose.

(54)

(55)

Chapter 4: Results

4.1 Analysis of gdh2 sequence

Three amino acids sequence alignments and the tertiary model of the GDH2 from P. chrysogenum is display in the next two sections.

4.1.1 GDH2 primary structure

The similarities of the GDH2 amino acid sequence with other four FAD dependent enzymes belonging to the GMC family were analyzed with CLUSTALW algorithm. The first alignment was made against a choline oxidase from Arthrobacter globiformis. The results are shown in the figure 14. There are 153 identical positions depicted in grey and 185 similar sites.

Figure 14. CLUSTALW multiple sequence alignment of the cholone oxidase (CHO) from

(56)

The CLUSTALW analysis for the GDH2 and the glucose oxidases from A. niger and P. amagasakiense is shown in the figure 15. The 3 enzymes contain 150 identical amino acids, and 215 similar positions.

Figure 15. CLUSTALW multiple sequence alignment of the glucose oxidase (GOX) from A. niger

(ASPNG) and P. amagasikiense (PENAG) and the glucose dehydrogenase (GDH2) from P. chrysogenum

Role of highly conserved histidines in the catalytic site of glucose dehydrogenase from Penicillium chrysogenum

Institute of Technical Microbiology

Master Thesis

Role of highly conserved histidines in the catalytic site

of glucose dehydrogenase from

Penicillium chrysogenum

Elaborated by: Ana Karina Ramijan Carmiol

Supervisors:

Prof. Dr. Dr. Garabed Antranikian

Prof. Dr. Rudolf Müller

MSc. Tobias Halbsguth

Master Thesis

Role of highly conserved histidines in the catalytic site

of glucose dehydrogenase from

Penicillium chrysogenum

Submitted in partial fulfillment of the requirements of the

International Master in Chemical and Bioprocess Engineering

Hamburg University of Technology

I hereby declare that the work presented in this document has been prepared by

myself.

Ana Karina Ramijan Carmiol

Evaluation Committee:

Prof. Dr. Dr. Garabed Antranikian

Head of the Institute of Technical Microbiology

Prof. Dr. Rudolf Müller

Professor Institute Technical Biocatalysis

Table of Contents

List of Figures

Summary

Chapter 1: Introduction

1.1 Diabetes

1.2 Self-monitoring blood glucose

1.3 Oxidoreductases

1.5 Site directed mutagenesis

1.6 Heterologous expression in Pichia pastoris

1.7 Objectives of the project

Chapter 2: Materials

2.1 Glucose dehydrogenase gene

2.2 Expression Vector

2.3 Pichia pastoris strain GS115

2.4 Chemicals

Chapter 3: Methods

3.1 Analysis of gdh2 sequence

3.2 PCR Site Directed Mutagenesis

3.3 Cloning the mutated gdh2 genes into the expression vector

A

E

3.5 Transformation and integration of Pichia pastoris

3.7 Purification of 6xhis tagged GDH2 mutant proteins

3.8 Deglycosylation assay

3.9 Determination of enzyme kinetics

3.10 Detection of FAD spectrum

Chapter 4: Results

4.1 Analysis of gdh2 sequence