[PDF] Top 20 Efecto de la densidad de siembra sobre el rendimiento y calidad del forraje de maíz
Has 10000 "Efecto de la densidad de siembra sobre el rendimiento y calidad del forraje de maíz" found on our website. Below are the top 20 most common "Efecto de la densidad de siembra sobre el rendimiento y calidad del forraje de maíz".
![Análisis y control de flujos de potencia en estado estable [por] Ramiro Patiño Bedolla.](data:image/gif;base64,R0lGODlhAQABAIAAAP///wAAACH5BAEAAAAALAAAAAABAAEAAAICRAEAOw==)
A Novel Drosophila Minute Locus Encodes Ribosomal Protein S13
... It is more likely that mutations in ribosomal protein genes affect both larval and imaginal cells at the level of protein synthesis, resulting in low-.. ered rates of both lar[r] ... See full document
155
Ribosomal Protein Insufficiency and the Minute Syndrome in Drosophila: A Dose-Response Relationship
... A novel Drosophila Gleichauf, ...Geschlechtsappar- Minute locus encodes ribosomal protein ...von Drosophila melanogaster ...The Drosophila ribosomal ... See full document
9
A Drosophila third chromosome Minute locus encodes a ribosomal protein.
... AATAAA sequences are found separated by a single A. Based o n these comparisons we conclude that the Dro- sophila cDNA encodes a r-protein homologous to the mammalian R[r] ... See full document
107
The shut-down Gene of Drosophila melanogaster Encodes a Novel FK506-Binding Protein Essential for the Formation of Germline Cysts During Oogenesis
... We were interested in identifying genes that function upstream of Bic-D in the determination of the oocyte and found that in the shut-down (shu) mutant Bic-D protein was made, but mislocalized. Mutants in shu were ... See full document
5
Immobilisation of active enzymes on novel GFP protein particles : a thesis submitted in complete fulfilment of the requirements of the degree of Master of Science in Microbiology at Massey University, Palmerston North, New Zealand
... Page Figure 1. Inclusion body formation inside bacterial cells 7 Figure 2. Three-dimensional structure of green fluorescent protein (GFP) 10 Figure 3. Types of GFP fusion protein investigated by Jahns et ... See full document
27
Drosophila Mrityu encodes a BTB/POZ domain containing protein and is expressed dynamically during development
... We amplified first strand cDNA from the Rapid-Scan™ gene expres- sion panel for Drosophila (Origene Technologies Inc.) using PCR with the following primers: 5’AGCACGACATAAAATCCCCTTGCGGAGCAT3’ and ... See full document
15
The embryonically active gene, unkempt, of Drosophila encodes a Cys3His finger protein.
... The unkempt gene of Drosophila encodes a set of embryonic RNAs, which are abundant during early stages of embryogenesis and are present ubiquitously in most somatic t[r] ... See full document
60
Structural and biochemical analysis of HutD from Pseudomonas fluorescens SBW25 : a thesis submitted in fulfilment of the requirements for the degree of Master of Science in Molecular Biosciences at Massey University, Auckland, New Zealand
... Pseudomonas fluorescens SBW25 is a gram-negative soil bacterium capable of growing on histidine as the sole source of carbon and nitrogen. Expression of histidine utilization (hut) genes is controlled by the HutC ... See full document
5
Minute Virus of Canines NP1 Protein Governs the Expression of a Subset of Essential Nonstructural Proteins via Its Role in RNA Processing
... MVC encodes multiple NS isoforms during infection of WRD cells and transfection of 293T ...nonstructural protein (NS isoforms and NP1)-encoding transcripts (R1 to R6) and structural protein (VP1 and ... See full document
1
The BFRF1 Gene of Epstein-Barr Virus Encodes a Novel Protein
... Computer analysis of the Epstein-Barr virus (EBV) genome indicates there are ⬃ 100 open reading frames (ORFs). Thus far about 30 EBV genes divided into the categories latent and lytic have been identified. The BamHI F ... See full document
104
missing oocyte encodes a highly conserved nuclear protein required for the maintenance of the meiotic cycle and oocyte identity in Drosophila
... animal oocytes, in Drosophila the oocyte arrests in prophase of meiosis I for the growth phase of oogenesis. During this developmentally programmed arrest, the p27-like cyclin- dependent kinase inhibitor Dacapo ... See full document
5
Extraribosomal L13a Is a Specific Innate Immune Factor for Antiviral Defense
... by protein markers and functional roles, although considerable overlap among them is known ...RNA-binding protein HuR (46), a cardinal regulator of mRNA translation and ...domain-binding protein FIG ... See full document
139
An Arabidopsis Minute-like phenotype caused by a semi-dominant mutation in a RIBOSOMAL PROTEIN S5 gene
... Expression of AtRPS5B is detected in the embryo, but it is significantly weaker than that of AtRPS5A. Apparently, the expression of AtRPS5B does not supply sufficient RPS5 protein to compensate for the presence of ... See full document
6
logjam Encodes a Predicted EMP24/GP25 Protein That Is Required for Drosophila Oviposition Behavior
... same protein as the class Ia, II, and III ...functional protein, similar to the sex-nonspecific product of tra (Boggs et ...other Drosophila EMP24/GP25 ... See full document
19
SUMO Pathway Modulation of Regulatory Protein Binding at the Ribosomal DNA Locus in Saccharomyces cerevisiae
... regulate ribosomal DNA (rDNA) silencing and were found to be hypersumoylated in ulp2D, slx5D, and ulp2D slx5D ...a protein that anchors both Net1 and Tof2 to the replication-fork barrier (RFB) in the rDNA ... See full document
14
Genetic interactions between the Drosophila Abelson (Abl) tyrosine kinase and failed axon connections (fax), a novel protein in axon bundles.
... gene encodes a novel 47-kD protein expressed in a developmental pattern similar to that of Ab1 in the embryonic mesoderm and axons of the central nervous system.. The [r] ... See full document
98
Glycoproteins M and N of Pseudorabies Virus Form a Disulfide-Linked Complex
... To prepare anti-gN serum, EaA cells were infected with recombinant gN- expressing baculovirus and lysed in sodium dodecyl sulfate (SDS)-polyacryl- amide gel electrophoresis (PAGE) sample buffer 5 to 7 days after ... See full document
Genetic Analysis of rolled, Which Encodes a Drosophila Mitogen-Activated Protein Kinase
... 1993; Hata et female sterile with a dominant tor-like phenotype ( Brun- al. Clonal analysis demonstrated that the rate of ner et al. 1994), whereas both rl Su23 and rl Sem showed prolife[r] ... See full document
49
The yeast omnipotent suppressor SUP46 encodes a ribosomal protein which is a functional and structural homolog of the Escherichia coli S4 ram protein.
... S4 is encoded by one of the ram (ribosomal ambiguity) genes in Escherichia coli which are the functional equivalent of omnipotent suppressors in yeast.. Thus, SUP46 a[r] ... See full document
87
The stoned Locus of Drosophila melanogaster Produces a Dicistronic Transcript and Encodes Two Distinct Polypeptides
... The observed homology between the carboxy-termi- nal region of the STNB protein and the AP50 family of clathrin assembly proteins does give some clues as to the possible f[r] ... See full document
121
Related subjects