[PDF] Top 20 Informe 2-Ensayo de Granulometria Agregado Fino
Has 10000 "Informe 2-Ensayo de Granulometria Agregado Fino" found on our website. Below are the top 20 most common "Informe 2-Ensayo de Granulometria Agregado Fino".
Performance of a methylation specific real-time PCR assay as a triage test for HPV-positive women
... false positive rate (= 1-specificity) for women with no CIN was ...among HPV-positive women ...exclusively women who were referred to our colposcopy unit for diagnostic ...nostic ... See full document
72
Comparison of real time PCR and microscopy for malaria parasite detection in Malawian pregnant women
... pfldh PCR assay - was not associated with poor birth outcomes compared with aparasitaemic ...antigen test or PCR assays [20,21]. In contrast, real-time PCR positivity was ... See full document
6
Comparison of Real Time Multiplex Human Papillomavirus (HPV) PCR Assays with INNO LiPA HPV Genotyping Extra Assay
... MRL HPV type-specific multiplex PCR. Multiplex HPV PCR assays are type- specific assays designed to simultaneously amplify and detect the L1, E6, and E7 ORFs of HPV6, HPV11, ... See full document
37
Sensitivity, Specificity, and Clinical Value of Human Papillomavirus (HPV) E6/E7 mRNA Assay as a Triage Test for Cervical Cytology and HPV DNA Test
... more specific than testing for HPV ...the performance of the PreTect HPV-Proofer E6/E7 mRNA assay (Norchip) as a triage test for cytology and HPV DNA ...1,201 ... See full document
89
Evaluation of a Real Time Reverse Transcription PCR Assay for Detection of Enterovirus D68 in Clinical Samples from an Outbreak in New York State in 2014
... seminested PCR amplification and subsequent analysis of the VP1 sequences, which is not feasible for most clinical laboratories ...rRT-PCR assay that was recently developed by the CDC (16) using a ... See full document
138
Comparison of Real Time Multiplex Human Papillomavirus (HPV) PCR Assays with the Linear Array HPV Genotyping PCR Assay and Influence of DNA Extraction Method on HPV Detection
... the performance of HPV detection systems have been published to ...poor performance of the s-LA pro- tocol was a result of the use of the Qiagen Spin blood DNA extraction kit with final DNA elution ... See full document
8
Rapid Stool Based Diagnosis of Clostridium difficile Infection by Real Time PCR in a Children's Hospital
... a test that can produce accurate results in order to facilitate appropriate patient management and the timely enactment of infection control ...sensitive assay for the detection of ...turnaround ... See full document
50
Laboratory Detection of Clostridium difficile in Piglets in Australia
... their test pop- ulation ...the real-time PCR assay and a range of EIA ...with real-time PCR and EIA for RT078 than for many other ri- botypes, including the ... See full document
61
Multiplex Real Time PCR shortTUB Assay for Detection of the Mycobacterium tuberculosis Complex in Smear Negative Clinical Samples with Low Mycobacterial Loads
... 103-bp-long PCR amplicon containing either deoxyuridine (dU) or deoxyri- bosylthymine (dT), these researchers found that the CodUNG enzyme specifically degraded ... See full document
36
Human papillomavirus testing with Pap triage for cervical cancer prevention in Canada: a cost-effectiveness analysis
... 100,000 women associated with the different screening strategies (for Ontario; results were similar for the other provinces and Canada as a ...of HPV testing followed by Pap triage were associated ... See full document
67
Mastitis pathogen identification using polymerase chain reaction in New Zealand milk samples : a thesis presented in partial fulfilment of the requirements for the degree of Master of Science in Animal Science at Massey University, Palmerston North, New Zealand
... Figure 1. Internal Amplification Control curves obtained from a 93-bp fragment of lambda-DNA included in the Primer Mixes 1, 2, 3, and 4 of the PathoProof Mastitis PCR Assay. Illustrated are the IAC ... See full document
52
Original Article Evaluation of the management of Hr-HPV+/PapTest- women: results at 1-year recall
... in positive high-risk HPV women without cytological lesions is still under ...these women and the role of HPV genotyping ...of women aged 35-64 with primary high-risk HPV ... See full document
25
Nonisotopic Detection and Typing of Human Papillomavirus DNA in Genital Samples by the Line Blot Assay
... blot assay by avoiding coampli- fication. HPV and b-globin sequences were coamplified only by the line blot ...for HPV detection with consen- sus L1 primers (6), we avoided b-globin coamplification ... See full document
12
Comparative Assessment of Sensitivity and Specificity of Rose Bengal Test and Modified In-House ELISA by using IS711 Taqman Real Time PCR Assay as a Gold Standard for the Diagnosis of Bovine Brucellosis
... The real-time PCR assays were carried out for Brucella identification using IS711 oligonucleotides pairs (forward: GCTTGAAGCTTGCGGACAGT) and (reverse GGCCTACCGCTGCGAAT and dual labeled FAM and BHQ ... See full document
5
External Quality Assessment for Enterovirus 71 and Coxsackievirus A16 Detection by Reverse Transcription PCR Using Armored RNA as a Virus Surrogate
... Preparation of armored RNAs. Three gene fragments were amplified by RT-PCR using EV71 and CA16 RNA as templates. Both EV71 RNA and CA16 RNA were kindly provided by the Beijing Center for Disease Preven- tion and ... See full document
127
A triplex quantitative real time PCR assay for differential detection of human adenovirus serotypes 2, 3 and 7
... traditional PCR method to detect serotypes of adenovirus [25, 26] needs gel electrophor- esis and sequencing, which significantly increases the risk of cross-contamination and is also time consuming and ... See full document
36
Evaluation of Novel Broad Range Real Time PCR Assay for Rapid Detection of Human Pathogenic Fungi in Various Clinical Specimens
... of real-time PCR and direct sequencing of positive PCR products improves the di- agnostic turnaround ...total time required for the de- tection of fungal pathogens in cervical ... See full document
167
Evaluation of the COBAS AmpliPrep Total Nucleic Acid Isolation COBAS TaqMan Hepatitis B Virus (HBV) Quantitative Test and Comparison to the VERSANT HBV DNA 3 0 Assay
... Monitor test; Roche Diagnostics, Meylan, France), branched- DNA signal amplification (VERSANT HBV DNA ...3.0 assay; Bayer Diagnostics, Puteaux, France), or hybridization of a chemiluminescent probe (Digene ... See full document
100
Comparative Evaluation of the ExaVir Load Version 3 Reverse Transcriptase Assay for Measurement of Human Immunodeficiency Virus Type 1 Plasma Load
... Load assay employs a mod- ified enzyme-linked immunosorbent assay (ELISA) format to measure the viral reverse transcriptase (RT) activity, which in turn correlates with plasma RNA levels (3, ...The ... See full document
154
<p>An efficient method that combines the ThinPrep cytologic test with E6/E7 mRNA testing for cervical cancer screening</p>
... logic test (TCT), HPV DNA detection, and HPV mRNA ...false positive results, especially among atypical squamous cells of undetermined signi fi cance or worse (ASCUS+) (including ASCUS) cases, ... See full document
75
Related subjects