[PDF] Top 20 Relación entre las Funciones Ejecutivas y el rendimiento académico en la Educación de adultos
Has 10000 "Relación entre las Funciones Ejecutivas y el rendimiento académico en la Educación de adultos" found on our website. Below are the top 20 most common "Relación entre las Funciones Ejecutivas y el rendimiento académico en la Educación de adultos".
Latent Membrane Protein 1 Is a Novel Determinant of Epstein-Barr Virus Genome Persistence and Reactivation
... ABSTRACT Epstein-Barr virus (EBV) is a ubiquitous gammaherpesvirus that persis- tently infects humans, with nearly 95% seropositivity in ...EBV persistence and latency in epithelial ...antigen ... See full document
22
Epstein Barr virus encoded latent membrane protein 1 regulates mTOR signaling pathway genes which predict poor prognosis of nasopharyngeal carcinoma
... The human 22 K oligonucleotide microarray comprised 21,329 probes from the Operon Company (Human Genome Oligo Set Version 2.1), constructed by Capitol- Bio Corporation (Beijing, China). Hybridization to each array ... See full document
6
Epstein-Barr virus leader protein enhances EBNA-2-mediated transactivation of latent membrane protein 1 expression: a role for the W1W2 repeat domain.
... EBV genome, Cp (16, 41), is not detectably induced by the same procedures that activate LMP1 ...EBNA-2 protein in Eli-BL cells cotransfected with EBNA-LP and type 1 EBNA-2 vectors ...type 1 ... See full document
Association of Epstein - Barr virus and breast cancer in Eritrea
... viral genome were amplified by using two primers: Epstein Barr Encoded RNA (EBER) gene (forward primer 5‘CCCTAGTGGTTTCGGACACA3’ and reverse primer 5‘ACTTGCAAATGCTCTAGGCG3’) [12] and Latent ... See full document
9
Epstein-Barr Virus Represses the FoxO1 Transcription Factor through Latent Membrane Protein 1 and Latent Membrane Protein 2A
... and protein levels for the B cells of transgenic mice expressing LMP1 or a chimeric LMP1-CD40 molecule ...EBV genome expression on Bcl-6 expression in B cells and dendritic cells (1, 10, ... See full document
10
Induction of Epstein-Barr Virus Latent Membrane Protein 1 by a Lytic Transactivator Rta
... EBV reactivation has been observed in previous studies, little was known about how LMP1 expression is regulated in the lytic stage (4, 10, 13, 62, 66, ...lytic protein is involved in the upregulation of ... See full document
5
Tumor Suppressor p53 Stimulates the Expression of Epstein-Barr Virus Latent Membrane Protein 1
... WTK1 (TP53 M237I) are latent EBV-infected, genetically similar cell lines derived from a single EBV- transformed Wil2 line (Fig. 1A). They differ in TP53 gene status and are gifts from Howard Liber (45–47). IB4, ... See full document
234
TRAF1 Is a Critical Regulator of JNK Signaling by the TRAF-Binding Domain of the Epstein-Barr Virus-Encoded Latent Infection Membrane Protein 1 but Not CD40
... oncogenic Epstein-Barr virus (EBV)-encoded latent infection membrane protein 1 (LMP1) mimics a constitutive active tumor necrosis factor (TNF) family receptor in its ... See full document
8
Latent Membrane Protein 1 of Epstein-Barr Virus Inhibits as Well as Stimulates Gene Expression
... in latent infection of resting B cells in cell ...the genome with BamHI. The promoters used in latent infection are indicated by arrowheads, with the primary RNA transcripts generated from these ... See full document
3
Interferon Regulatory Factor 7 Is Induced by Epstein-Barr Virus Latent Membrane Protein 1
... P3HR1 virus or the prototype B95-8 strain were exam- ...B95-8 virus has all of the latency genes in its viral genome, whereas the P3HR1 virus genome lacks the EBNA-2 gene and a portion ... See full document
10
Latent Membrane Protein 1 of Epstein-Barr Virus Activates the hTERT Promoter and Enhances Telomerase Activity in B Lymphocytes
... Epstein-Barr virus (EBV) is a ubiquitous human gammaher- pesvirus that establishes a life-long asymptomatic infection in immunocompetent hosts by colonizing memory B ...three latent ... See full document
82
Silencing of the Epstein-Barr Virus Latent Membrane Protein 1 Gene by the Max-Mad1-mSin3A Modulator of Chromatin Structure
... EBV genome is packaged into a nucleosomal structure in the cell (16, ...that protein deacetyla- tion plays an important role in the regulation of LMP1 gene ... See full document
1
Maintenance of Epstein-Barr Virus Latent Status by a Novel Mechanism, Latent Membrane Protein 1-Induced Interleukin-32, via the Protein Kinase Cδ Pathway
... factor 1 (EBF1), signal transducer and activator of transcription 3 (STAT3), and octamer-binding protein 2 (OCT2) ...domain protein, and Janus-acti- vated kinase 3 and then constitutively activate ... See full document
9
The dynamic roles of TGF β signalling in EBV associated cancers
... and/or protein levels of TGFBR1 and TGFBR2 were found to be significantly reduced in primary NPC tissues compared with non-cancerous controls, and their decreased expression correlated with poor survival ... See full document
110
Characterization of the latent membrane protein 1 signaling complex of Epstein Barr virus in the membrane of mammalian cells with bimolecular fluorescence complementation
... Rat- 1 cells were infected with vector control, HA-tagged LMP1, and LMP1-NYFP ...and 1-231-NYFP were able to induce transformation, Rat-1 cells were transduced with retrovirus and focus formation and ... See full document
99
Oral lymphomatoid granulomatosis, the first sign of a ‘rare disease’: a case report
... Introduction: Lymphomatoid granulomatosis is an uncommon Epstein-Barr virus-positive B-cell lymphoma, an angiocentric-destructive process with a predominant T-cell background. Lymphomatoid ... See full document
9
Epstein-Barr Virus Encodes a Novel Homolog of the bcl-2 Oncogene That Inhibits Apoptosis and Associates with Bax and Bak
... fluorescent protein (GFP) fusion proteins were transfected into HeLa ...EBV genome) with the 59-HindIII- and 39-SacII-encod- ing primers 59-CCCAAGCTTGGGATGAACCTGGCCAT TGCT-39 and ... See full document
8
Serum EBV antibodies and LMP-1 in Polish patients with oropharyngeal and laryngeal cancer
... type 1 has a greater potential to transform B lympho- cytes than EBV type 2 and is more common in Western and Asian countries, while EBV-2 is more frequently de- tected in Africa ...type 1 EBV was detected ... See full document
5
Epstein Barr virus latent membrane protein 1 (LMP 1) 30 bp deletion and Xho I loss is associated with type III nasopharyngeal carcinoma in Malaysia
... mutation from A → T at 168295 was also found in these two isolates. In addition, NPC 2 harboured one addi- tional change at codon 335 (GGC → GAC) resulting in an amino acid change from glycine (G) to aspartic acid (D). ... See full document
6
Orientation and patching of the latent infection membrane protein encoded by Epstein-Barr virus.
... These experiments indicated that i at least 30% of the cytoplasmic LMP is in the plasma membrane, as opposed to other membrane compartments of the cell, ii the amino- terminal, carboxy-t[r] ... See full document
121
Related subjects