• No se han encontrado resultados

ENFERMEDAD Y MUERTE DE GUILAIN

In document El Hechicero de Meudon (página 124-126)

EL MATRIMONIO MILAGROSO

ENFERMEDAD Y MUERTE DE GUILAIN

Two methods were used for the construction of plasmids during this project, namely InFusion cloning (Clontech) and standard ligation of digested or amplified DNA. Those plasmids that were difficult to clone due to troublesome secondary structure were purchased from GenScript.

2.2.6.1In-Fusion molecular cloning

In-Fusion cloning is a recombination based cloning strategy that was used to insert one or two PCR products into a linearised plasmid in a single reaction. The plasmids that were constructed using the In-Fusion cloning method are described in Table 2-7 and 2-8. Each insert was amplified by PCR using a high fidelity polymerase from HSV-1 or plasmid DNA with the appropriate primers (Tables 2-7 and 2-8). These primers contain 15 nucleotide extensions at their 5’ end that are identical to the vector sequence flanking a unique restriction site in the vector or are complementary to a neighbouring PCR product. If more than two inserts were required, they were first joined together by splice overlap PCR to join them together before cloning. In splice overlap PCR, each fragment was amplified such that the overlapping sequences at the end were added. These amplified fragments with regions of homology on the two ends to be joined together, were then used as template DNA for another PCR with the external primers, such that they will knit together.

Plasmid produced

Vector details Insert(s) details

Parental

plasmid Forward primer Reverse primer Template DNA Forward primer Reverse primer

pT UL3/UL4

pTracer-

CMV/bsd pTracer bla pTracer EF1 HSV-1 KOS

UL3 Lf UL3 Rf UL4 Lf UL4 Rf

Table 2-7. Description of the strategy used to construct plasmid pT UL3/UL4 by In- Fusion cloning. To linearise the pTracer-CMV/bsd, the vector was amplified using the primers described. The UL3 and UL4 fragments were amplified with 5’ end which are identical to the vector sequence flanking a unique restriction site in the vector or are complementary to the neighbouring PCR product. The three fragments were joined together by In-Fusion cloning.

Plasmid produced

Vector details Insert details

Parental plasmid Restriction enzyme(s) Template DNA Forward primer Reverse primer

pT CMV IE_mC CMV/bsd pTracer SpeI

pTracer

CMV/bsd CMV IE Lf CMV IE Rf pT456 mCherry Lf mCherry Rf

pT CMV

IE_mC_BGH pT CMV IE_mC SpeI

pTracer CMV/bsd CMV IE Lf mCherry Rf II pTracer CMV/bsd BGH Lf BGH Rf II pT eGC U pT L3/UL4 SpeI

pIGCN21 eGFP Cre Lf II pT Rev Cre C pTracer

CMV/bsd BGH Lf BGH Rf II pT pgB_eGC pT eGC SpeI HSV-1 KOS gB P Fwd gB P Rev pT pICP6_eGC pT eGC SpeI HSV-1 KOS RR1 P Fwd RR1 P Rev

pT pC_eGC pT eGC SpeI CMV/bsd pTracer CMV Fwd CMV Rev pUC57 LAT pCmC pUC57 pLAT eGC SpeI and NotI pTracer CMV IE_mC LAT CMV Fwd LAT mC Rev pU26/7

pICP47/Tdtom pU26/7 pICP47 NotI pCIGH3 Tomato BGH Fwd Tomato BGH Rev

pU3.0.5kbF Blunt II pCR- HindIII and NotI

HSV-1 KOS 0.5Lf Fwd Consensus Lf Rev HSV-1 KOS Consensus Rf Fwd 0.5Rf Rev

pU3.1kbF Blunt II pCR- HindIII and NotI

HSV-1 KOS 1Lf Fwd Consensus Lf Rev HSV-1 KOS Consensus Rf Fwd 1Rf Rev

Table 2-8. Description of the strategy used to construct plasmids using In-Fusion cloning. The cloning strategy used to construct each plasmid is described. The vector was linearised with the indicated restriction endonuclease. The insert(s) were amplified using the primers indicated, with sequences added onto the 5’ end that are identical to the vector sequence flanking a unique restriction site in the vector or are complementary to the neighbouring PCR product. If more than two inserts were inserted into the vector, they were first joined by splice overlap PCR.

Plasmid produced

Vector details Insert details

Parental plasmid Restriction enzyme(s) Template DNA Forward primer Reverse primer

pU3.2kbF Blunt II pCR- HindIII and NotI

HSV-1 KOS 2Lf Fwd Consensus Lf Rev HSV-1 KOS Consensus Rf Fwd 2Rf Rev

pU3.3kbF Blunt II pCR- HindIII and NotI

HSV-1 KOS 2.6Lf Fwd Consensus Lf Rev HSV-1 KOS Consensus Rf Fwd 3Rf Rev pT pICP0_eGC pT pICP0 mC Cre NheI pT pICP0 mC Cre pICP0 mC Fwd pICP0 GFP Rev

pU3.2kbF-

gBCre pU3.2kbF-ESgBCre KpnI and SpeI pU3.2kbF-ESgBCre

noESF1 noESR1

noESF2 noESR2

pU3.2kbF-

ESgBCre pU3.2kbF NotI

pT pC_eGC GFP/Cre F GFP/Cre R pT pgB_eGC pgB F pgB R MVA p7.5 ESmini (gB-498- 505) minigB F minigB R pT UL3/UL4 SV40 F SV40 R

Prior to cloning, the vector and insert DNA was coprecipitated, with 100 ng of vector DNA and a 2:1 molar ratio of insert to vector DNA. The DNA was precipitated by mixing together 1/10 volume 3 M sodium acetate, three volumes of 100% ethanol and 20 μg of glycogen, followed by vigorous mixing. The DNA was centrifuged at 20200 g for 15 minutes to pellet the DNA, and then washed with 70% ethanol. The DNA pellet was allowed to air dry for 15 minutes, and then resuspended in 8 μL of sterile DNA.

The In-Fusion HD cloning kit (Clontech) was used according to the manufacturer’s instructions. In general, a 2:1 molar ratio of insert to vector was used, with a final volume of 10 μL. 2.5 μL of the undiluted In-Fusion reaction mix was used for transformation into chemically competent E. coli by heat shock (refer to Section 2.2.8).

Table 2-8 cont. Description of the strategy used to construct plasmids using In- Fusion cloning.

2.2.6.2Conventional ligation for molecular cloning

DNA fragments that were unable to be amplified efficiently due to secondary structure were excised from the parental plasmid by restriction digest. The vector was linearised with enzyme such they produce complementary overhanging sequences. These plasmids were constructed using a conventional ligation strategy, with the details shown in Table 2- 9.

Plasmid produced Parental plasmid Template plasmid Restriction enzyme (s)

pT pICP47_eGC pT eGC pUC57 pICP47 w/o OriS SpeI pU26/7 pICP47 pU26/7 pUC57 pICP47 w/o OriS SpeI pU3.0.5kbF-Venus pU3.0.5kbF pUC57 pICP47 Venus KpnI pU3.1kbF-Venus pU3.1kbF pUC57 pICP47 Venus KpnI pU3.2kbF-Venus pU3.2kbF pUC57 pICP47 Venus KpnI pU3.3kbF-Venus pU3.3kbF pUC57 pICP47 Venus KpnI pT pICP0_mC Cre pT UL3/UL4 pUC57-pICP0 mC Cre SpeI

The vector was first dephosphorylated using Antarctic phosphatase according to the manufacturer’s instructions (New England Biolabs). Briefly, 1× Antarctic phosphatase reaction buffer, 5 units of Antarctic phosphatase and 1 μg of linearised plasmid DNA were mixed to a final volume of 15 μL in sterile water and incubated for 15 minutes at 37°C. The enzyme was then heat inactivated by incubating at 70°C for five minutes.

Prior to ligation, the insert and vector DNA was coprecipitated as described in Section 2.2.6.1, with 100 ng of vector DNA and a 2:1 molar ratio of insert to vector DNA. This DNA was ligated using the LigaFast rapid DNA ligation system (Promega) according to the manufacturer’s instructions with three units of T4 DNA ligase. 2.5 μL of the undiluted ligation reaction was used for transformation into chemically competent E.coli by heat shock (refer to Section 2.2.8).

Finally, to construct the plasmid pX330-minigB, single stranded oligodeoxynucleotides were annealed and cloned into the vector pX330 (as described by Cong et al., 2013). The vector pX330 was linearised using the restriction endonuclease BbsI (New England Biolabs) as previously described (refer to Section 2.2.4). The oligodeoxynucleotides S_ER

Table 2-9. Description of the strategy used to construct plasmids by a conventional ligation method. The cloning strategy used to construct each plasmid is described. The vector and insert was linearised with the indicated restriction endonuclease and were cloned together using T4 DNA ligase.

and AS_ER (sequences CACCGGCCGCGCTGCAGACTGCCGCA and AAACTGCGGCAGTCTGCAGCGCGGCC, respectively) were annealed by mixing together 100 μM of each oligonucleotide and 1× T4 ligation buffer (New England Biolabs) in sterile water, and incubating at 95°C for five minutes, before leaving to cool to room temperature. To ligate the oligodeoxynucleotides into the vector, approximately 25 ng of vector and 20 μM of the annealed oligodeoxynucleotides were mixed with 10 units of BbsI, 4.5 units of T4 DNA ligase (New England Biolabs) and 1× T4 ligation buffer in a final volume of 15 μL in sterile water. This mix was then incubated at 37°C for one hour and 2 μL of the reaction was then used for transformation into Stbl3 competent cells by heat shock (refer to Section 2.2.8).

In document El Hechicero de Meudon (página 124-126)