• No se han encontrado resultados

The effects of the synthesis and localization of ZipA, an essential component of the Escherichia coli divisome, on division and membrane dynamics

N/A
N/A
Protected

Academic year: 2022

Share "The effects of the synthesis and localization of ZipA, an essential component of the Escherichia coli divisome, on division and membrane dynamics"

Copied!
107
0
0

Texto completo

(1)

Universidad Autónoma de Madrid

Facultad de Ciencias

Departamento de Biología Molecular

The effects of the synthesis and localization of ZipA, an essential component of the Escherichia coli divisome, on division and

membrane dynamics

TESIS DOCTORAL

Laura Cueto Burdiel

Licenciada en Biología

(2)

Universidad Autónoma de Madrid

Facultad de Ciencias

Departamento de Biología Molecular

The effects of the synthesis and localization of ZipA, an essential component of the Escherichia coli divisome, on division and

membrane dynamics

TESIS DOCTORAL

Memoria presentada para optar al título de Doctor en Biociencias Moleculares

Laura Cueto Burdiel

Licenciada en Biología

TUTOR ACADÉMICO DIRECTOR José Berenguer Carlos Miguel Vicente Muñoz

Consejo Superior de Investigaciones Científicas Centro Nacional de Biotecnología

Madrid, 2018

(3)

Este trabajo ha sido realizado en el Centro Nacional de Biotecnología (CNB-CSIC) bajo la dirección del Profesor de Investigación Miguel Vicente, y en North Carolina State University (NCSU), Carolina del Norte, EEUU durante una estancia de 3 meses en el laboratorio del Dr. Chase Beisel. Este trabajo ha sido financiado por el programa de Formación de Personal Universitario del Ministerio de Educación, Cultura y Deporte (FPU2013/00949).

(4)

Gracias a Miguel por haberme dado la oportunidad de realizar esta tesis doctoral en su laboratorio, por su apoyo, y por todo lo que he aprendido en estos 4 años. Para mi ha sido todo un privilegio haber hecho mi tesis bajo la supervisión de una de las personas con más conocimientos y carrera científica en el campo de la división bacteriana. Solo espero haber estado a la altura.

A Pilar y Mercedes, gracias por vuestra paciencia infinita conmigo. Gracias por el esfuerzo que habéis puesto en este proyecto. Habéis sido las velas que han empujado “este barco”

hasta llegar a puerto. Esta tesis es tan mía como vuestra. He aprendido mucho de vosotras, tanto en lo profesional como en lo personal. Creo que acabo esta tesis siendo algo más comunicativa y sociable y si eso de verdad es así, ha sido gracias a vosotras.

A Paolo, gracias por tu tiempo y dedicación. Aún sigo sin saber de donde sacas horas al día para hacer todas las cosas que haces y entregarte al 100% en cada una de ellas. Ha sido un verdadero placer haber aprendido de ti y contigo. Gracias por sacar siempre tiempo para mi cuando lo he necesitado, por cada uno de tus consejos y por haberme ayudado tanto. Eres muy buen científico, pero eres aún mejor persona.

To Chase Beisel for all good advices and help while I was in his lab, and to all the people in his lab in NCSU, specially to Chunyu, Fanni, Jenny and Athul for making me feel at home and having a lot of fun there.

A Cris, por los dos años que compartimos tanto dentro como fuera del laboratorio, fueron sin duda los mejores. Aunque ahora estás lejos, siempre tienes tiempo para darme el consejo que necesito escuchar en cada momento. Me llevo una amiga.

A todos aquellos que han pasado por el 217 durante estos 4 años, en especial a Alicia, por su ayuda en los comienzos de esta tesis. A Anabel, Susanne, Marcin, Marina, Derly, David, Martín y Adrián, gracias por vuestra ayuda durante el tiempo que hemos compartido.

A mis padres, porque el día que defienda esta tesis estarán orgullosos de mi, pero yo llevo toda la vida estando orgullosa de ser su hija. Sin vosotros hoy no estaría escribiendo los agradecimientos de una tesis doctoral. Gracias infinitas.

A mi abuelo, con sus 94 años, solo por la ilusión que supone para él ver a su nieta doctorarse, se que todo el esfuerzo ha merecido la pena.

A Carlos, por caminar a mi lado en esta etapa y en la vida. Todo es mejor contigo

(5)

Contents

(6)

13

FIGURE INDEX ... 15

ABBREVIATIONS ... 17

RESUMEN ... 21

SUMMARY ... 25

INTRODUCTION ... 29

1.CELL DIVISION IN ESCHERICHIA COLI... 31

1.1. ZipA, an essential component in E. coli cell division ... 32

2.GENETIC CONTROL OF THE DIVISION PROCESS ... 34

3.ROLE OF MEMBRANE ORGANIZATION IN BACTERIAL DIVISION ... 36

3.1. Lipid domains in bacteria ... 37

3.2. Functional membrane microdomains in bacteria ... 38

3.3. Flotillin-like proteins and cell division ... 40

OBJECTIVES ... 43

MATERIALS & METHODS ... 47

1.MATERIALS ... 49

1.1. Bacterial strains ... 49

1.2. Plasmids ... 49

1.3. Antisera ... 52

1.4. Oligonucleotides ... 53

1.5. Chemicals and kits ... 56

1.6. Others ... 59

2. METHODS ... 60

2.1. Bacterial strains and growth media ... 60

2.2. Green fluorescence protein (GFP) assay ... 60

2.3. Reverse transcription-Polymerase chain reaction (RT-PCR) ... 61

2.4. Rapid Amplification of cDNAs Ends (5’RACE). ... 61

2.5. Electrophoretic Mobility Shift Assay (EMSA) ... 62

2.6. Construction of P1 P2 and yqiK mutants... 63

2.7. Immunolocalization of division proteins ... 63

2.8. SDS-PAGE and immunoblot ... 64

2.9. Cell-membrane fractionation based on detergent resistance ... 64

2.10. Isolation of inner membranes ... 65

2.11. Production of supported lipid bilayer (SLB) ... 65

2.12. Fluorescence recovery after photobleaching (FRAP) ... 66

2.13. Flow Cytometry Analysis ... 66

2.14. Thin Section Transmission Electron Microscopy ... 67

2.15. Cryo-transmission Electron Microscopy... 67

(7)

14

RESULTS ... 69

1.GENETIC REGULATION OF ZIPA IN E. COLI ... 71

1.1. Bioinformatics analysis of the genomic region upstream the zipA gene ... 71

1.2. Conservation of the 5´upstream zipA region in gamma proteobacteria... 72

1.3. Transcription Start Sites (TSS) for zipA gene in E . coli ... 73

1.4. Control of zipA expression by Fis and H-NS ... 74

1.5. Strength of the zipA regulatory signals ... 77

1.6. Effect of a single point mutation in the putative repressor region of zipA ... 78

1.7. Differential effect of bacterial growth rate and sigmaS (s) on ZipA amount ... 79

1.8. Defective division as a consequence of P2 disruption ... 80

2.CHARACTERIZATION OF THE E. COLI YIQK FLOTILLIN MUTANT ... 83

2.1 Localization of ZipA at specific membrane domains ... 83

2.2. The E. coli YqiK protein is a putative flotillin ... 84

2.3. Effect of the absence of YqiK on membrane fluidity ... 85

2.4. Effect of low salt concentration on the growth and division of yiqk mutant ... 87

2.5. Cell growth complementation of the yiqK mutant ... 89

2.6. Disruption of membrane potential by low salt concentration on yiqK cells ... 90

2.7. Ultrastructure of membranes lacking YqiK protein ... 91

2.8. Restoration of yiqK growth and membrane potential after salt addition ... 92

2.9. Localization of proto-ring components in yiqk cells at low salt concentrations... 93

3.EFFECTS OF ZIPA OVERPRODUCTION ON THE YIQK MEMBRANE INTEGRITY... 95

3.1. Disruption of cell growth and membrane potential by ZipA overproduction on yiqK mutant strain ... 95

3.2. Disruption of cell growth and membrane potential by the overproduction of the transmembrane segment of ZipA on in the absent of YqiK ... 101

DISCUSSION ... 107

1.THE EXPRESSION OF ZIPA IS CONTROLLED BY REGULATORY SIGNALS LOCATED AT ITS 173-BP UPSTREAM REGION ... 109

2.YQIK PROTEIN IS ESSENTIAL FOR E. COLI TO GROW AT LOW SALT CONCENTRATIONS ... 110

3.FTSZ IS DEGRADED IN THE ABSENCE OF YQIK AT LOW SALT CONCENTRATION ... 112

4.OVERPRODUCTION OF THE TRANSMEMBRANE REGION OF ZIPA COMPROMISES MEMBRANE INTEGRITY IN CELLS LACKING YQIK ... 114

CONCLUSIONS... 115

CONCLUSIONES ... 119

REFERENCES ... 123

(8)

15

Figure index

Figure 1. Essential components of the cell division ring and their assembly in Escherichia coli. .. 31

Figure 2. Structure of ZipA and its interaction with FtsZ in E. coli ... 33

Figure 3. E. coli division and cell wall (dcw) cluster... 34

Figure 4. Classification of bacterial promoters according to their growth rate dependence ... 36

Figure 5. Schematic presentation of three types of lipid domains in bacillus subtillis membrane .. 38

Figure 6. Organization of FMM in Bacillu s subtillis membra ne………..40

Figure 7. Bioinformatic analysis of zipA regulatory sequence ... 72

Figure 8. Alignment of the 230-bp region upstream zipA coding sequence. ... 73

Figure 9. Sequence of the 307 bp region upstream the zipA translational start site (ATG). ... 74

Figure 10. Electrophoretic mobility shift assay gel using the zipA regulatory region as DNA probe ... 76

Figure 11. Distribution of the proteins identified by mass spectrometry from the excision of the emsa gel bands ... 76

Figure 12. Localization of the Fis and H-NS binding sites in the zipA regulatory region ... 77

Figure 13. Fluorescence levels produced by different fragments of the zipA regulatory region cloned upstream sfGFP in wt and rpos strains ... ¡ERROR! MARCADOR NO DEFINIDO. Figure 14. Relative concentration of zipA against growth rate ... 80

Figure 15. RNA and protein quantification in wt, p1 and p2 strains. ... 81

Figure 16. Immunolocalization of ZipA in p1 and p2 mutants ... 82

Figure 17. Detection of FtsZ and ZipA in membrane fractions of wt cells. ... 83

Figure 18. YqiK protein structure ... 85

Figure 19. Fluorescence recovery after photobleaching of supported lipid bilayers ... 86

Figure 20. Effect of low salt concentrations on growth and division in wt and yiqK cells ... 88

Figure 21. Effect of different NaCl concentrations on the growth of yiqK strain growth. ... 88

Figure 22. Effect of YqiK overproduction on yiqk growth ... 90

Figure 23. Effect of the salt concentrations on membrane potential. ... 91

Figure 24. Effects of low concentration of salt on the membrane structure ... 91

Figure 25. Effect of low salt concentrations on growth and division in wt and yiqk cells ... 92

Figure 26. Percentage of DiBAC stained cells during 90 minutes of growth in LBNS and 120 minutes after the addition of salt (restoration). ... 93

(9)

16

Figure 27. Effect of low salt concentrations on ZipA and FtsZ localization. ... 94

Figure 28. FtsZ and ZipA levels in wt and yiqk cells growing at different NaCl concentrations .. 94

Figure 29. Effect of ZipA overproduction on growth and division... 95

Figure 30. Localization of ZipA and FtsZ on wt and yiqk cells after ZipA induction. ... 96

Fig ure 31. FtsZ a nd ZipA levels in wt a nd yiqk cells following ZipA induction….96 Figure 32. Effect of ZipA overproduction on membrane potential. ... 98

Figure 33. Effects of ZipA overproduction on the membrane structure ... 99

Figure 34. Localization of ZipA in wt and yqik cells under overproduction conditions... 100

Figure 35. Effect of the overproduction of different ZipA regions on growth and division ... 101

Figure 36. Localization of ZipA and FtsZ on wt and yiqk cells overproducing the transmembrane or the cytoplasmic fragment of ZipA ... 103

Figure 37. FtsZ and ZipA levels in wt and yiqk cells following induction of the transmembrane or the cytoplasmic fragment of ZipA. ... 104

Figure 38. Effect of the overproduction of the transmembrane or the cytoplasmic segment of ZipA on membrane potential ... 106

Figure 39. The signals and transcription factors affecting ZipA expression ... 110

Figure 40. Model explaining the effect of a decrease in membrane fluidity on FtsZ degradation by ClXP ... 113

(10)

Abbreviations

(11)

19

Abbreviations

Amp Ampicillin

BSA Bovine serum albumin

Cam Chloramphenicol

CIP Calf intestine alkaline phospahatase

DTT Ditiotreitol

EDTA Ethylenediaminetertriacetic acid FMM Functional membrane microdomains GFP Green fluorescence protein

Kan Kanamycin

LB Luria Bertani

LBNS Luria Bertani no salt OD Optical density at 600 nm PBS Phosphate buffer solutios PCR Polymerase chain reaction

PI Propidium iodide

PMSF Phenylmethylsulfonyl fluoride RT-PCR Reverse transcription-PCR

RACE Rapid amplification of cDNA ends Rpm Revolutions per minute

SDS Sodium dodecyl sulphate

SDS-PAGE SDS-polyacrilamide gel electrophoresis TAP Tobacco acid pyrophosphatase

TEMED Tetramethylethylenediamine

Tris Tris (hydroxymethyl) aminomethane

(12)

Resumen

(13)

Resumen

23

La división en bacterias es un proceso complejo que asegura la generación de dos células hijas idénticas. Este proceso se inicia en el citoplasma con el ensamblaje de la maquinaria de división, el divisoma, y finaliza con la constricción de la membrana, produciéndose por último la septación. El primer evento en producirse es el ensamblaje de FtsZ en un anillo (anillo de FtsZ) en el centro de la célula. En Escherichia coli, el anillo formado por FtsZ se ancla a la membrana a través una proteína asociada a la membrana, FtsA, y de ZipA, que es una proteína integral de membrana.

Estas tres proteínas forman la estructura del proto-anillo que sirve como andamio para el ensamblaje del resto de proteínas de división. La posición de FtsZ en el centro de la célula viene dictaminada por mecanismos específicos como el sistema Min (de Boer et al 1989) y el sistema de oclusión por nucleoide (Woldringh et al, 1991. A nivel genético, la producción de las proteínas que conforman el divisoma debe estar controlada de forma precisa para evitar los efectos letales causados cuando la cantidad relativa de alguna de estas proteínas se altera y al mismo tiempo para asegurar que las células puedan dividirse. El mantenimiento de la integridad de la membrana celular es también esencial para asegurar que la división se lleva a cabo de forma correcta. El trabajo presentado en esta tesis está enfocado en el estudio de los mecanismos de regulación que controlan la producción de ZipA, uno de las proteínas esenciales en el proceso de división de Escherichia coli. En la sección 1 de Resultados, se analizaron las señales reguladoras que controlan la producción de ZipA. Además, en la sección 2 se estudió la asociación de ZipA con la membrana, obteniendo que ZipA está integrada en regiones específicas de la membrana de E. coli que guardan cierta similitud con las balsas lipídicas descritas en células eucariotas. Se conoce que las flotilinas, son las proteínas encargadas de organizar estas balsas lipídicas en Eucariotas (Morrow and Parton 2005), por ello en esta sección construimos un mutante deficiente en la proteína YqiK en E. coli, un homólogo estructural de las flotilinas eucariotas, y analizamos los defectos en la membrana de E. coli asociados a la ausencia de esta proteína. En la sección 3, estudiamos el efecto de la sobreproducción de ZipA en ausencia de YqiK. Los resultados obtenidos muestran que la producción de ZipA se incrementa con la velocidad de crecimiento siguiendo un patrón de tipo “housekeeper”. La producción de ZipA está controlada por señales reguladoras presentes en una región que se extiende 173 pb aguas arriba de la región codificante para la proteína, en esta región el promotor P2 es esencial para asegurar la producción de suficiente cantidad de ZipA para permitir que el proceso de división se lleve a cabo de forma correcta. Además, hemos identificado al regulador global Fis unido al promotor P2 durante el crecimiento exponencial, mientras que el represor H-NS fue identificado durante el crecimiento en fase estacionaria, unido a la región inmediatamente aguas arriba de la secuencia codificante. Fis podría activar la transcripción durante la fase de crecimiento activo mientras que H-NS parece que podría reducir la producción de ZipA para ajustarla a un crecimiento en fase estacionaria. Los resultados obtenidos con relación a membrana nos muestran que la proteína YqiK de E. coli es esencial para mantener la integridad de la membrana en condiciones de baja concentración de sal en el medio de cultivo. La falta de esta proteína reduce la fluidez de la membrana, lo que afecta a los procesos celulares asociados con la membrana como es la división. La reducción en la fluidez de la membrana podría además reducir la movilidad de ZipA dentro de la membrana, ya que nuestros resultados muestran como la reducción en la fluidez de la membrana va acompañada de la degradación de FtsZ. En base a estos resultados proponemos que la baja fluidez de la membrana originada por la ausencia de YqiK, podría reducir la capacidad de ZipA de proteger FtsZ frente a la degradación por la proteasa ClpXP.

Nuestro trabajo evidencia que el control genético y el mantenimiento de la integridad de la membrana son esenciales para asegurar el correcto funcionamiento de ZipA, y por lo tanto de la división.

(14)

Summary

(15)

Summary

27

Bacterial division is a complex process that ensures the generation of two identical daughter cells.

This process starts in the bacterial cytoplasm with the assembly of the division machinery, the divisome, and finishes with the constriction of the bacterial membrane leading to cell separation. As an early event, FtsZ is assembled as a ring (the FtsZ-ring) at midcell. In Escherichia coli, the FtsZ- ring is anchored to the membrane through the associated membrane protein, FtsA, and through the integral membrane protein, ZipA. These three proteins form the proto-ring structure serving as a scaffold for the assembly of the rest of the divison proteins. The midcell position of FtsZ is directed by a dedicated mechanisms as the Min system (de Boer et al 1989) and by nucleoid occlusion (Woldringh et al, 1991). These two mechanisms prevent FtsZ localization at sites different from the midcell. Being essential for bacterial propagation, division is a tightly regulated process. At the genetic level, the production of division proteins has to be precisely controlled to avoid lethal effects when the relative amount of any of the divisome elements is altered and at the same time to allow cells to divide. Maintenance of membrane integrity is also essential to ensure division to proceed in a proper way. In this thesis we focus on the study of the regulatory mechanisms controlling the production of ZipA, one of the crucial elements in the division process in Escherichia coli. In the section 1 of Results, the regulatory signals responsible for ZipA production were analyzed. We also study the association of ZipA with the E. coli membrane showing that this protein is inserted at specific membrane regions enriched in specific lipids that may be form structures similar to the eukaryotic lipid rafts. It is known that flotillins are the proteins responsible for the organization of these lipid rafts in eukaryotic cells (Morrow and Parton 2005). We construct a flotillin deficient mutant (yiqk) in E. coli to study in section 2 the membrane defects associated to the absent of flotillin. In section 3 we study the effect of ZipA overproduction in the yiqk mutant. Results show that ZipA production increases according to the bacterial growth rate following a housekeeper expression pattern. ZipA production is largely controlled by regulatory signals present in the 173-bp region upstream the zipA coding sequence. In this region the P2 promoter is essential to ensure sufficient protein production to allow E. coli division. We have identified Fis as one of the transcriptional regulators interacting with the promoter region during exponential growth phase, whereas the global repressor H-NS was found interacting with a region upstream the translational start site during stationary phase. Fis would activate transcription during exponential phase while H- NS would act to decrease ZipA production at higher growth rates. We have found that the E. coli flotillin-like protein YqiK is essential to maintain membrane integrity under no-salt conditions. Our results suggest that the lack of flotillin decreases membrane fluidity, which affects membrane associated processes such as division. The decrease in membrane fluidity would decrease ZipA mobility inside the E. coli membrane. Our results show that under these conditions the lower fluidity is accompanied by a decrease in the intracellular amounts of FtsZ.. Our work empathizes that the genetic control and the maintenance of membrane integrity are essential to ensure a correct function of ZipA, and therefore an efficient division process in E. coli.

(16)

Introduction

(17)

Introduction

31

1. Cell division in Escherichia coli

Cell division is one of the most important processes in bacterial life and its efficiency has been proposed among the reasons for the widespread presence of bacteria in our planet. The first genes involved in division were identified by genetic procedures using non-dividing mutants. These genes were named as filamentous temperature sensitive (fts) because they were isolated in strains unable to divide, but able to grow at 42ºC resulting in the production of long filaments (Ricard and Hirota 1973; Ryter 1968; Howard-Flanders and Theriot 1966).

Assembling of division proteins follows a sequential order that starts with the formation of the FtsZ ring (Pazos, Natale, and Vicente 2013) (Figure 1). Furthermore, FtsZ assembly requires dedicated positioning mechanisms as Min system and nucleoid occlusion to prevent assembly at sites different form the midcell (Jia et al. 2014) (Schumacher 2017). The majority of the studies about bacterial division are focus on FtsZ and FtsA function in division. Regarding the genetic mechanisms controlling division, the information available come also from the study of the genetic regulation of the ftsZ and ftsA genes, the cytoplasmic components of the proto-ring. Division in Escherichia coli is a spatially and temporally controlled process where membrane plays an important role, for these reasons we study the genetic regulation of the membrane component of the proto-ring, ZipA, and its function in the E. coli membrane.

Figure 1. Esse ntial compone nts of t he cell division ring and t heir assembly in Escherichia coli. Ten essential proteins form the division ring, assembling in subcomplexes in a concerted way (A). In a first step or early assembly, FtsZ, ZipA and FtsA localize at midcell forming the proto-ring (B and D). FtsK binds to the proto-ring to complete the cytoplasm ring (C). At a late assembly stage, the periplasmic connector (FtsQ, FtsB and FtsL) and the peptidoglycan factory (FtsW and FtsI) are recruited to the midcell and form the periplasmic ring (C and D). FtsN is recruited to the divisome at a final step when all the proteins have been already recruited. Fts protein names have been abbreviated by excluding Fts. Zip=ZipA.

(18)

Introduction

32

1.1. ZipA, an essential component in E. coli cell division

The ZipA protein is only found in gammaproteobacteria (RayChaudhuri 1999). It is a bitopic cytoplasmic membrane protein with a short periplasmic N-terminal end, a single transmembrane domain and a large cytoplasmic part. The cytoplasmic part contains a flexible linker containing a Map-Tau repeat, a charged domain, and a proline-glutamine enriched region (P/Q), and the C-terminal globular domain (RayChaudhuri 1999; Hale and de Boer 1999). While all the other parts may serve a structural role, the C-terminal globular domain contains the FtsZ-binding site (FZB) that is sufficient to interact with the central hub (Buske and Levin 2013) (Pazos, Natale, and Vicente 2013) of FtsZ (Mosyak et al. 2000;

Moy et al. 2000) (Figure 2). This interaction protects FtsZ from degradation by the housekeeping protease complex ClpXP This role is specific for ZipA and cannot be replaced by either FtsA or by FtsA* (Pazos, Natale, and Vicente 2013). FtsA* is a gain-of-function FtsA mutant (R268W) (Geissler, Elraheb, and Margolin 2003) able to bypass in vivo the requirement for ZipA during cell division. ZipA, together with FtsZ, is required for FtsI- independent preseptal peptidoglycan synthesis, which mediates the transition between cell elongation and constriction (Potluri, Kannan, and Young 2012). The FtsA* protein is equally able to bypass this role of ZipA. A gain of function mutant, FtsZ* (L169R), a mutation enhancing bundling of the FtsZ polymers, has been described as able to bypass as well the requirement for ZipA (Haeusser, Rowlett, and Margolin 2015).

Regarding the structure of ZipA, no clear function is attributed to the P/Q domain. Electron microscopy images identified it as an unfolded flexible polypeptide (Ohashi et al. 2002) suggesting that it may play a role in the orientation of the bound FtsZ polymers on the membrane surface (Erickson 2001). Recently, this domain was found to undergo conformational changes depending on the lateral protein density packing changing from a condensed coiled state at low densities to a more extended brush-like conformation when the density is higher (Lopez-Montero et al. 2013). Although the lipid composition of the membrane may modulate the shape and the oligomeric state of the FtsZ polymers on the surface (Mateos-Gil et al. 2012), a role of the ZipA anchoring region in this effect has not been proven (Hale and de Boer 1999).

Studies using E. coli maxicells as well as in vitro FtsZ assembly experiments show that ZipA stabilizes FtsZ and induces the formation of higher order structures or bundles (Hale, Rhee, and de Boer 2000; Pazos, Natale, and Vicente 2013). Furthermore, interaction between ZipA

(19)

Introduction

33

and FtsZ is sufficient to promote membrane constriction when both proteins are encapsulated together with GTP in giant unilamelar vesicles. In vivo, an excess of ZipA modifies the cytoplasmic membrane where it produces invaginations and disrupts membrane potential (Cabre et al. 2013).

In contrast to FtsA that only recruits FtsZ polymers, ZipA can recruit FtsZ monomers to the membrane (Loose and Mitchison 2014). This may be due to the higher binding affinity that ZipA has for FtsZ. FtsZ monomers are recruited to the membrane by ZipA where they polymerize, whereas the FtsA binding is too weak to allow FtsZ binding of monomers, needing the multiple interaction sites provided by the FtsZ polymers, to establish a more stable interaction (Loose and Mitchison 2014).

Fig ure 2. Struct ure of ZipA a nd its interaction wit h FtsZ in E.

coli. ZipA is an inner membrane protein with a short N-terminal periplasmic domain, a single transmembrane segment and a large cytoplasmic domain that can be subdivided in three different regions:

The Map-Tau repeat, the charged domain (+/-), the proline-glutamine enriched region (P/Q) and the globular domain (FZB, from the FtsZ Binding domain). Crystal structure of the interaction between the FZB domain of ZipA and the C-terminal end of FtsZ (red colored)

(20)

Introduction

34

2. Genetic control of the division process

The study of the genetic mechanisms controlling division in E. coli has been focus on a specific region in the chromosome that contains the majority of the genes involved in the process. This region is known as division and cell wall (dcw) cluster and it contains 16 genes encoding proteins involved in cell division and/or cell wall synthesis. All the genes are transcribed in the same direction and several regulatory signals controlling individual genes are often found in the upstream genes. There are no transcriptional terminators inside the cluster, allowing transcripts to be initiated at the mra promoter. The ftsZ maps at the distal end of the cluster and at least six promoters contribute to its transcription. Two promoters (ftsQ2p1p) are located within ddlB and transcribe ftsQ, ftsA and ftsZ. A single promoter within ftsQ (ftsAp) transcribes ftsA and ftsZ, and three promoters within ftsA (ftsZ4p3p2p) transcribe ftsZ. The contribution of these promoters and the upstream elements to ftsZ transcription has been determined using reporter fusions and fusions to the native ftsZ respectively (Flardh, Garrido, and Vicente 1997) (Flardh, Palacios, and Vicente 1998) (de la Fuente, Palacios, and Vicente 2001) (Figure 3).

Figure 3. E. coli division and cell wall ( dcw) cluster. Schematic view of the E. coli dcw cluster. Genes coloured in pink are involved exclusively in division, the ones in green are involved in division and cell wall synthesis, genes in blue are exclusively involved in cell wall synthesis, and the ones in grey are not directly involved in any of these functions. At the middle there is a closer

(21)

Introduction

35

view of the cluster region containing the promoters that control ftsQ, ftsA and ftsZ expression represented as orange and purple arrows. Promoters coloured in purple are growth rate-direct dependent promoter whereas the promoter coloured in orange represents a growth rate-inverse dependent promoter, known as gearbox promoter. At the bottom, the contribution of the upstream elements and the promoters to the ftsZ transcription is represented by percentages. more than 66% of ftsZ transcripts are initiated from sequences upstream ddlB. Considering the upstream elements, the ftsQ2p1p contribution is reduced to 15% and ftsZ4p3p to 12%. A minor contribution comes from ftsAp and ftsZ2p, whose levels are reduced to 4% and 2%, respectively

Three of the six promoters that contribute to ftsZ transcription are inversely growth-rate dependent (ftsQ1p, ftsZ4p and 3p) and increase their activity on stationary phase (Aldea et al. 1990) (Smith, Masters, and Donachie 1993). The regulation of ftsQ1p and 2p is particularly important since they are the ones that contribute more to ftsZ transcription. At rapid growth rates (exponential phase), ftsQ2p would be active, whereas ftsQ1p becomes predominant at low growth rates (stationary phase). FtsQ1p is classified as a gearbox promoter and it depends on the stationary growth phase sigma factor σS. This kind of promoter may ensure that the gene products are produced at constant amounts per cell and cell cycle at any growth rate. (Vicente et al. 1991). The overall effect of this growth rate regulated control is to maintain constant the levels of FtsZ protein per cell cycle given that;

cell size is larger in fast-growing cells. ensure that the gene products are produced at constant amounts per cell and cell cycle at any growth rate (Vicente et al. 1991). Cellular levels of FtsZ are rate limiting for division, a modest overproduction of FtsZ produces the formation of minicells, due to the production of abnormal polar extra divisions, whereas higher levels of FtsZ block division. Indeed, the molar ratio of FtsA to FtsZ is critical for a normal division process, since the effect produced by high levels of one of the proteins can be suppressed by the co-ordinate overexpression of the other (Dai and Lutkenhaus 1992) (Dewar, Begg, and Donachie 1992).

ZipA levels are also critical for E. coli division given that; its overproduction blocks division causing filamentation and membrane defects (Cabre et al. 2013). The regulatory signals controlling zipA expression has not been analyzed yet. As a transmembrane protein the genetic regulation controlling ZipA production could be different from ftsZ and ftsA, however a gearbox promoter could also affect its expression to coordinate the amount of ZipA with FtsZ and FtsA, the other components of the proto-ring.

(22)

Introduction

36

Figure 4. Classificatio n of bacterial promoters according to t he ir growt h rate depende nce. Bacterial promoters are classified into stringent, gearbox or housekeeper promoters according to their growth rate dependency. Genes under the control of stringent promoters are higher express at higher growth rates, showing a direct-growth rate dependency in a plot that represents the relative concentration of the gene product against the growth rate (R) (ribosomal genes). Gearbox promoters control genes which expression does not change with the growth rate giving rise to an inverse growth rate dependency plot (ftsQ, ftsZ, bolA). Housekeeper promoters control genes which expression increases with the growth rate to maintain the same relative concentration per cell mass (zipA).

3. Role of membrane organization in bacterial division

Bacterial membrane is actively involved in many of the cell cycle events, as nucleoid segregation and division (Funnell 1993; Nanninga 1998). Nucleoid association with the membrane has been observed using several techniques (Firshein 1989; Schaechter, Polaczek, and Gallegos 1991). This association has been explained to couple transcription, translation and insertion of membrane proteins (Nanninga 1998). Coupled transcription, translation and insertion of membrane proteins could be involved in the regulation of DNA replication, segregation and cell division through the formation of lipid domains (Norris 1992;

Woldringh, Jensen, and Westerhoff 1995). Bacterial membranes are responsible to maintain

(23)

Introduction

37

shape morphology and integrity during division. Bacterial cell division apparatus and the bacterial cytoskeletal elements are essentially membrane-anchored structures. For example, FtsZ assembles in a division ring between daughter chromosomes to initiate septation. The mechanism that determine its nucleation site on the membrane is still unknown, but phospholipid defects affect the correct interaction of the division ring with the membrane and its structure (Mileykovskaya et al. 1998). Phospholipids and proteins are the major components of bacterial membranes and their correct organization is essential to maintain membrane integrity.

3.1. Lipid domains in bacteria

In 1972, Singer and Nicholson proposed the fluid mosaic model to explain cell membrane organization. According to this model, proteins and lipids are homogenously distributed and diffuse freely across the membrane. Nowadays, it is known that the localization of envelope components and membrane proteins is not random. This complexity was first documented in eukaryotic cells where proteins related to signal transduction and membrane trafficking are confined into cholesterol- and sphingolipids-enriched membrane domains or lipid rafts (Simons and Ikonen 1997). It is thought that there are some raft-associated proteins such as flotillin that act as scaffold recruiting proteins to lipid rafts to facilitate their interaction and oligomerization (Bickel et al. 1997). Flotillin proteins play an essential role in lipid raft organization, and consequently they ensure the correct functionality of some cellular processes that take place in these lipid domains, such as, membrane sorting, trafficking, cell polarization, and signal transduction. Any perturbation in flotillin activity cause serious defects in these membrane-associated cellular processes (Morrow and Parton 2005) (Babuke and Tikkanen 2007) (Otto and Nichols 2011) (Stuermer 2011) (Zhao et al. 2011). Lipid rafts have been evidenced in eukaryotic organisms, their presence in bacteria is less documented.

However, a complex organization of bacterial membranes, including the presence of special lipid domains has been described in Bacillus subtillis and E. coli (Govindarajan et al. 2013) (Vanounou et al. 2002) (Vanounou, Parola, and Fishov 2003). In E. coli and B subtilis these domains contains cardiolipin (CL) and are localized in the polar and septal regions (Barak and Muchova 2013) (Matsumoto et al. 2006) (Kawai et al. 2004). The lipid domains may influence the polar localization of many proteins, most of them involved in cell division.

Membrane curvature has been proposed to be an important factor in the formation of these CL domains (Mukhopadhyay, Huang, and Wingreen 2008). A link between lipid domains and peptidoglycan synthesis was found using phospholipid specific dyes to stain the

(24)

Introduction

38

membrane of B. subtilis and E. coli. The dyes used preferentially associate with regions enriched in negatively charged phospholipids such us phosphatidylglycerol (PG) and cardiolipin (CL). In B. subtilis a helical distribution of the dye along the cell length was observer while in E. coli the dyes appear in bands but not forming helical structures. These specific distribution was not observed in B. subtillis cells devoid of the peptidoglycan layer (protoplasts), or in cells depleted of MurG, an enzyme involved in peptidoglycan synthesis (Muchova, Wilkinson, and Barak 2011). CL and PG domains may serve as cues for the localization of proteins to specific sites in the cell. For example, the MinD protein, from the Min system division site selection machinery colocalize with PG domains (Mileykovskaya et al. 2003).

Figure 5. Sc he matic presentatio n o f t hree types of lipid do mains in Bacillus subtillis membra ne. Cardiolipin (CL) and phosphatidylglycerol (PG) domains, and functional membrane microdomains (FMM). Figure modified from (Barák and Muchová 2013).

3.2. Functional membrane microdomains in bacteria

Although, no lipid raft structures had been fully characterized in bacteria, signal transduction cascades and protein transport appear to be arranged into functional membrane microdomains (FMM) in bacteria and their distribution seems to be independent of CL and

(25)

Introduction

39

PG domains (Donovan and Bramkamp 2009; Lopez and Kolter 2010). Bacterial FMM have been found in B. subtilis and Staphylococcus aureus, these FMM are compact and hydrophobic regions resistant to non-polar detergent disaggregation. This condition was used to isolate them from the rest of the membrane, resulting in one membrane fraction that is sensitive to detergents (detergent sensitive membrane (DSM) fraction) and another that is resistant to detergent disruption (detergent-resistant membrane (DRM) fraction) (Brown 2002; Shah and Sehgal 2007). The DRM fraction is considered a membrane fraction enriched in FMM and include FMM associated proteins (Lopez and Koch 2017) .The FMMs are composed by three main components: lipids, the protein cargo, and flotillins. Most of the lipids forming the FMMs are polyisoprenoids, but the molecular structure of these lipids is not clear yet. The protein cargo are proteins involved in signal transduction and membrane trafficking which function depends on their localization on FMM. Flotillins would recruit proteins to the FMM to facilitate their interaction and oligomerization. (Morrow and Parton 2005; Stuermer 2010; Zhao et al. 2011; Stuermer 2011). Although the precise function of bacterial flotillins is not clear yet, it is thought that as occurs in eukaryotic lipid rafts, it plays a structural role in the organization of the bacteria FMMS. Flotillins are membrane proteins that in bacteria are attached by their N-terminal region to the membrane via a hairpin-loop.

The C-terminal domain contain a coiled-coil region that seems to be involved in facilitate protein-protein interactions and oligomerization (Schneider et al. 2015). They belong to a large family of proteins known as SPFH (stomatin prohibitin flotillin and HflK/C) family (Tavernarakis, Driscoll, and Kyrpides 1999). The first bacterial flotillin-homolog was discovered in B. subtilis. It was named as YuaG, but currently it is known as FloT (Tavernarakis, Driscoll, and Kyrpides 1999). This protein plays a role in sporulation and it is distributed in patches along the cell length (Donovan and Bramkamp 2009). FloT was localized at the DRM fraction where it localizes with sensor kinases as KinC, suggesting a role for FloT in organizing signal transduction processes in B. subtilis (Lopez and Kolter 2010). Another flotillin, known as FloA was found in B. subtillis (first described as YqfA).

FloA colocalizes and interacts with FloT. Both flotillins localize in small and high dynamic foci along B. subtillis membrane. FloA and FloT may to be involved in cellular processes such as sporulation, secretion, motility and natural competence (Donovan and Bramkamp 2009; Lopez and Kolter 2010; Schneider et al. 2015). Two kinds of B. subtillis FMMs differ in their FloT and FloA concentration, one type only contains FloA and the cargo proteins in this FMM are mainly involved in cell wall synthesis and cell division. The second type of B. subtillis FMM contains both flotillins and the cargo proteins seem to be related with

(26)

Introduction

40

adaptation to stress and to stationary phase conditions. Each FMM is specialized in regulating different cellular processes within the same cell (Schneider et al. 2015).

Bioinformatics studies have revealed the presence of flotillin-like proteins in other bacteria genera such as Listeria and Staphylococcus. Listeria monocytogenes only contains a FloA- like protein that shares 62% identity and 76% positive amino acids with FloA of B. subtillis.

Similarly, Staphylococcus aureus only contains one floA-like flotillin gene in its genome.

FloA of S. aureus shares 84% identity and 90% positive amino acids with FloA of B.

subtillis. In Mycobacterium and Streptomyces only one flotillin-encoding gene has been found (Bramkamp and Lopez 2015). The presence and organization of FMM in the membrane of Gram-negative bacteria has not been addressed in much detail so far. Only one flotillin-like gene has been found in E. coli, termed as yqiK (Hinderhofer, Walker, Friemel, Stuermer, Moller, et al. 2009).

Figure 6. Organizatio n o f FMM in Bacillus subtillis membra ne. FMM are represented in green. Proteins and cellular processes associated to FMM are also indicated.

Figure from (Bramkamp and Lopez 2015).

3.3. Flotillin-like proteins and cell division

Flotillins found in B. subtillis are responsible for lateral segregation of membrane domains and they directly affect membrane fluidity. Flotillins in this gram-positive organism are involved in controlling membrane organization, which is critical for all the processes that take place at the membrane. Overexpression of flotillins in B. subtillis has been associated with cell shape and cell division defects. Cells simultaneously overexpressing FloA and FloT show a substantial decrease in cell length and a significant number of minicells can also be observed. In B. subtillis, cells overproducing FloA and FloT showed an increase in the

(27)

Introduction

41

number of Z-rings, which has been associated with the presence of the FtsZ-negative regulator protein EzrA in the DRM fraction of B. subtillis (Mielich-Suss, Schneider, and Lopez 2013). FloA and FloT in B. subtillis act as chaperons recruiting proteins to the FMM, which means that an overexpression of both proteins could affect the localization or even the activity of the proteins that form this FMM. Overproduction of FloA and FloT could negatively affect EzrA activity favoring the rapid assembly of FtsZ. Indeed, low levels of EzrA were detected in cells overproducing both flotillins, suggesting that an overproduction of FloA and FloT promotes EzrA degradation activating the activity of the FtsH protease (Schneider et al. 2015). All of these evidences suggest that flotillins are involved in important processes such as division, and changes in their expression could affect normal bacterial growth.

In contrast to the abundance of data on the proteins involved in bacterial division there is a paucity of studies on the role of lipids in this process. Among them there are reports on E.

coli mutants that are compromised in phosphatidylethanolamine (PE) synthesis are not able to divide forming long filaments (Mileykovskaya et al. 1998). A result suggesting that membrane lipid composition may play an essential and not well-known role in the division process of E. coli affecting even the septation complex.

(28)

Objectives

(29)

Objectives

45

• To test whether zipA expression is controlled by the same regulatory signals as ftsZ and ftsA, we have studied the regulatory signals that trigger zipA expression and the transcriptional factors involved in its expression using transcriptional fusions to sfGFP and protein-DNA binding assays. We will measure the relative concentration of the protein at different growth rates to analyze the expression pattern of zipA during E. coli cell cycle.

• To investigate whether ZipA is homogenously distributed in E. coli membrane or whether it is associated to specific lipid domains, similar to eukaryotic lipid rafts, we have constructed and characterized an E. coli mutant that lacks the flotillin-like protein, YqiK. We will identify the membrane defects associated with the absence of this protein, and how these defects affect ZipA localization and therefore the division process.

• To analyze how membranes lacking YqiK overcome stress conditions, we have overproducde ZipA and different regions of the protein in the absence of YqiK.

(30)

Materials & Methods

(31)

Materials

49

1. Materials

1.1. Bacterial strains

The bacterial strains used in this study are described in Table 1.

Table 1. Strains used in this work

Strain Genotype Reference

DH5 endA1, gyrA, hsdR17, relA, recA1, supE44, thi1,

(lacaya-argf)U169, 80 (lacZM15), F-

(Taylor, Walker, and McInnes 1993)

BL21 E. coli str. B F ompT gal dcm lon hsdSB(rBmB) λ(DE3 [lacI lacUV5-T7p07 ind1 sam7 nin5]) [malB+]K-12S) pLysS[T7p20 orip15A](CmR)

(Blattner et al. 1997)

MG1655 Escherichia coli K12 lambda-, ilvG-, rfb-50, rph-1, F-

(Jeong et al. 2009)

VIP2000 MG1655 rpoS This work

VIP2001 MG1655 p1zipA This work

VIP2002 MG1655 p2zipA This work

VIP2003 MG1655 yqiK This work

1.2. Plasmids

The plasmids used in this study, their relevant properties and markers are shown in Table 2.

Table 2. Plasmids used in this work

Plasmid Relevant characteristics and markers Reference

pALex Cloning vector, GFP protein under a Psos promoter, Ampr pALex-GFP

pASV001 pBAD22-his6::zipA (1-78 bp) Laboratory stock

pBAD22 Cloning vector, contains PBAD promoter; Ampr (Guzman et al.

1995)

pBAD33 Cloning vector, contains PBAD promoter; Camr (Guzman et al.

1995)

(32)

Materials

50

pCP20 Flp recombinase gene, FLP, Ts replication, CmR, AmpR (Cherepanov and Wackernagel 1995) pDMB-ATG Cloning vector to obtain the sfGFP (Bower and Prather

2012)

pKD13 Template plasmid for gene disruption, FRT sites, Kanr (Datsenko and Wanner 2000)

pKD46 Recombineering plasmid, Ampr Datsenko and

Wanner 2000)

pHis17 Expression plasmid for C-terminal his-tag. PT7 promoter, Ampr

(van den Ent and Lowe 2000)

pLCV7 230-bp fragment from the zipA upstream region cloned in pAlex-GFP (from -230-bp ZipA start codon)

This work

pLCV15 173-bp fragment from the zipA upstream region cloned in pAlex-GFP (from -173bp to ZipA start codon)

This work

pLCV16 120-bp fragment from the zipA upstream region cloned in pAlex-GFP (from -120bp to ZipA start codon)

This work

pLCV18 184-bp fragment from the zipA upstream region cloned in pAlex-GFP (from -230 to -46bp)

This work

pLCV19 134-bp fragment from the zipA upstream region cloned in pAlex-GFP (from -230 to -96bp)

This work

pLCV20 73-bp fragment from the zipA upstream region cloned in pAlex-GFP (from -230 to -157bp)

This work

pLCV21 127-bp fragment from the zipA upstream region cloned in pAlex-GFP (from -173 to -46bp)

This work

pLCV22 77-bp fragment from the zipA upstream region cloned in pAlex-GFP (from -173 to -96bp)

This work

pLCV23 74-bp fragment from the zipA upstream region cloned in pAlex-GFP (from -120 to -46bp)

This work

pLCV24 E. coli Shine-Dalgarno sequence and sfGFP protein cloned in pUC19

This work

pLCV25 RnaseIII processing site inserted in pLCV24 This work

(33)

Materials

51

pLCV26 zipA regulatory fragment from pLCV7 cloned upstream the sfgfp gene (RNaseIII processing site and SD sequence included)

This work

pLCV27 zipA regulatory fragment from pLCV15 cloned upstream the sfgfp gene (RNaseIII processing site and SD sequence included)

This work

pLCV28 zipA regulatory fragment from pLCV16 cloned upstream the sfgfp gene (RNaseIII processing site and SD sequence included)

This work

pLCV30 zipA regulatory fragment from pLCV18 cloned upstream the sfgfp gene (RNaseIII processing site and SD sequence included)

This work

pLCV31 zipA regulatory fragment from pLCV19 cloned upstream the sfgfp gene (RNaseIII processing site and SD sequence included)

This work

pLCV32 zipA regulatory fragment from pLCV20 cloned upstream the sfgfp gene (RNaseIII processing site and SD sequence included)

This work

pLCV33 zipA regulatory fragment from pLCV21 cloned upstream the sfgfp gene (RNaseIII processing site and SD sequence included)

This work

pLCV34 zipA regulatory fragment from pLCV22 cloned upstream the sfgfp gene (RNaseIII processing site and SD sequence included)

This work

pLCV35 zipA regulatory fragment from pLCV23 cloned upstream the sfgfp gene (RNaseIII processing site and SD sequence included)

This work

pLCV38 pLCV26 with a point mutation T/A at -56 position from the ZipA start codon

This work

pLCV39 pLCV27 with a point mutation T/A at -56 position from the ZipA start codon

This work

pLCV40 pLCV28 with a point mutation T/A at -56 position from the ZipA start codon

This work

pLCV41 pLCV30 with a point mutation T/A at -56 position from the ZipA start codon

This work

(34)

Materials

52

pLCV42 pLCV33 with a point mutation T/A at -56 position from the ZipA start codon

This work

pLCV43 pLCV35 with a point mutation T/A at -56 position from the ZipA start codon

This work

pLCV50 pBAD33-yqiK This work

pPNV40 pTrc99A-ftsA (Pazos, Natale, and

Vicente 2013)

pPZV23 pTrc99A-his6::zipA (Pazos, Natale et al.

2013)

pPZV32 pTrc99A-his6::zipA (256-987 bp) (Pazos, Natale et al.

2013)

pPZV33 pTrc99A-ftsA* (Pazos, Natale et al.

2013)

pUC19 Cloning vector, Ampr (Yanisch-Perron,

Vieira, and Messing 1985)

1.3. Antisera

The polyclonal antibody used in this work are described in Table 3.

Table 3. Antisera used in this work

Antibody Target protein Antibody Dilution (IF)a Dilution (WB)b Reference

Anti-histidine Histidine MVM1 1:150 1:5000 Laboratory stock

MVC1 ZipA MVC2 1:500 1:20000 Laboratory stock

MVC2 FtsZ Anti-histidine 1:10000 1:4000 Sigma

MVM1 FtsA MVC1 1:500 1:10000 Laboratory stock

a: Immunofluorescence b: Western blot

(35)

Materials

53 1.4. Oligonucleotides

Oligonucleotide primers used in this work are listed in Table 4.

Table 4. Primers used in this work

Primer Sequence 5’-3’ Orientation Target

Kan up TTCAGTGACAACGTCGAGCACAGCTGCGCA

A

Fw kan

Kan rev TTGCGCAGCTGTGCTCGACGTTGTCACTGA

A

Rv kan

LCV3 AAAGGTACCATTATATTCTCTGTTG Rv zipA

upstream region

LCV3* TATATTCTCTGTTGTTCTAACACC Rv zipA

upstream region

LCV4 CCGAAACTCGAGATCAGGATGAGCTCC Fw zipA

upstream region

LCV9 CCGAAACTCGAGATTGCGCAATGGACAG Fw zipA

upstream region

LCV9* TAATTGCGCAATGGACAGTT Fw zipA

upstream region

LCV10 CCGAAACTCGAGAATCGGCAAATACTCTTA

G

Fw zipA

upstream region

LCV11 AAAGGTACCTGTCCATTGCGCAATTAC Rv zipA

upstream region

LCV12 AAAGGTACCTTTCACAGCACAAAGATAG Rv zipA

upstream region

(36)

Materials

54

LCV13 CCGAAACTCGAGTTCATCTATCTTTGTGCTG Fw zipA

upstream region

LCV14 AAGGTACCTACTCACTAAGAGTATTTGC Rv zipA

upstream region

LCV16 CGGGGTACCGGAAGATCTAGGAGGCCTCTA

GATGGTGAGCAAGGGCGAAG

Fw zipA

LCV17 CCCAAGCTTTTACTTATAGAGTTCATCC Rv zipA

LCV18 GGGGTACCACTATAGAGGGACAAACTC Fw ftsZ

LCV19 GAAGATCTCCCGGTCGTATTAACCG Rv ftsZ

LCV20 GGTAATCGGCAAATACACTTAGTGAGTAAA

TGTTTGC

Fw gapA

LCV21 GCAAACATTTACTCACTAAGTGTATTTGCCG

ATTACC

Rv gapA

LCV22 GGCGTTGGTGAGGTTCGT Fw sfgfp

LCV23 CTCATGCTCCTGAGCGTTAGC Rv sfgfp

LCV24 AGCAGAAGCCGGTTGCTAAA Fw RNAseIII

processing site

LCV25 TCCGGCTCTTTCGCAGTTT Rv RNAseIII

processing site

LCV26 ACTTCGACAAATATGCTGGC Fw zipA

upstream region (p56)

LCV27 CGGGATGATGTTCTGGGAA Rv zipA

upstream region (p56)

(37)

Materials

55

P1 up CTGCGTGGGGCAGATGTGAATGATGAAACC

ATAATCAGGATGAGCTCCTTGTGTAGGCTG GAGCTGCTTC

Fw pKD13

P1 rev TTTTGCTGTTTTTTCGAACATATCCTAACTG

TCCATTGCGCAATTACCCGATTCCGGGGAT CCGTCGACC

Rv pKD13

P2 up AGGAAAATTCTGCGTATTTTACCGGGTAAT

TGCGCAATGGACAGTTAGGAGTGTAGGCTG GAGCTGCTTC

Fw pKD13

P2 rev CCGATTACCTCAAGTGCAAGTGCACTATTA

ACTTTCACAGCACAAAGATAATTCCGGGGA TCCGTCGACC

Rv pKD13

P3 up AAAAAGCACGATTTCATCTATCTTTGTGCTG

TGAAAGTTAATAGTGCACGTGTAGGCTGGA GCTGCTTC

Fw pKD13

P3 rev CTGTTGTTCTAACACCTTGCCACCACGGCAA

ACATTTACTCACTAAGAGATTCCGGGGATC CGTCGACC

Rv pKD13

YqiK up GGTGGTACCATGGATGATATTGTTAATTCTG

TGCC

Fw yqiK

YqiK rev GGTTCTAGATTACTCTGCTTTTTCTTCGA Rv yqiK

zipA 5’ up ACTAACAGCACAGAGATGACAGCCA Fw zipA

upstream region

zipA5’ rev TCACGTTTTGACTTCATTCGTTTT Rv zipA

5’ RACE GS

CCAGTACCAACCGCCTTATG Fw zipA

Referencias

Documento similar

If the concept of the first digital divide was particularly linked to access to Internet, and the second digital divide to the operational capacity of the ICT‟s, the

No obstante, como esta enfermedad afecta a cada persona de manera diferente, no todas las opciones de cuidado y tratamiento pueden ser apropiadas para cada individuo.. La forma

In the preparation of this report, the Venice Commission has relied on the comments of its rapporteurs; its recently adopted Report on Respect for Democracy, Human Rights and the Rule

1. S., III, 52, 1-3: Examinadas estas cosas por nosotros, sería apropiado a los lugares antes citados tratar lo contado en la historia sobre las Amazonas que había antiguamente

In the previous sections we have shown how astronomical alignments and solar hierophanies – with a common interest in the solstices − were substantiated in the

While Russian nostalgia for the late-socialism of the Brezhnev era began only after the clear-cut rupture of 1991, nostalgia for the 1970s seems to have emerged in Algeria

Díaz Soto has raised the point about banning religious garb in the ―public space.‖ He states, ―for example, in most Spanish public Universities, there is a Catholic chapel

teriza por dos factores, que vienen a determinar la especial responsabilidad que incumbe al Tribunal de Justicia en esta materia: de un lado, la inexistencia, en el