[PDF] Top 20 Intención y práctica de actividad física en maestros españoles
Has 10000 "Intención y práctica de actividad física en maestros españoles" found on our website. Below are the top 20 most common "Intención y práctica de actividad física en maestros españoles".
Interleukin-27-924A/G gene polymorphism is associated with Rheumatoid Arthritis in Egyptian population
... − 924A/G gene as previously described by Paradowska-Gorycka et ...for gene amplification: forward 5`CTGATCCTGACCTCACTCAACGC3`, reverse 5`CTGAC ...IL-27-924A/G gene, ... See full document
6
Variation at interleukin 6 receptor gene is associated to joint damage in rheumatoid arthritis
... two associated variants are the causal polymorph- ism that influences joint destruction, and instead they are proxies for another ...pattern associated with the most strongly associated SNP, ... See full document
6
Polymorphism and protein expression of MUTYH gene for risk of rheumatoid arthritis
... 20]. Gene polymorphism and mutations that lead to MUTYH inactivation have been associated with many cancers and cancer-associated inflammatory responses ...with arthritis in both mice ... See full document
8
The MHC2TA 168A>G gene polymorphism is not associated with rheumatoid arthritis in Austrian patients
... of gene polymorphisms [18,19] and reflect ethnic differences across ...German population [20]. The frequency of the MHC2TA G allele in that study was ...MHC2TA gene might help to elucidate the ... See full document
19
<p>Single Nucleotide Variants Associated with Colorectal Cancer Among Iranian Patients: A Narrative Review</p>
... to different tumors like CRC. In addition, RAD51 cru- cially contributes to the DSB repair across the homologous recombination (HR). It is notable that a major pathway to the DNA repair is the excision repair (ER) and ... See full document
5
Role of Interleukin 1 Alpha (IL 1α) and Interleukin 1 Receptor Antagonist (IL 1RA) in Pathogenesis of Juvenile Idiopathic Arthritis and Adult Onset Rheumatoid Arthritis of Iraqi Patients
... idiopathic arthritis (JIA) and rheumatoid arthritis (RA) are the two major of arthritis that are characterized by chronic joint ...as arthritis in one or begins before the age of 16 ... See full document
16
Role of vasoactive intestinal peptide in osteoarthritis
... nociception. The mechanism by which VIP exerts its pro-nociceptive effects includes the enhanced produc- tion of cAMP and enhanced protein kinase A activity through the stimulation of adenylyl cyclase [37]. VIP is ... See full document
35
The C161T Polymorphism in Peroxisome Proliferator Activated Receptor ɣ2, but Not Pro12Ala, Is Associated with Diabetic Retinopathy in Type 2 Diabetes Mellitus in an Egyptian Population
... The C161T Polymorphism in Peroxisome Proliferator-Activated Receptor ɣ2, but Not Pro12Ala, Is Associated with Diabetic Retinopathy in Type 2 Diabetes Mellitus in an Egyptian Population R[r] ... See full document
226
Original Article Tumour necrosis factor alpha, ınterleukin 10 and ınterleukin 6 gene polymorphisms of ıschemic stroke patients ın south Marmara region of Turkey
... 2 mL of venous blood was obtained from each subjects. DNA isolation was performed by spin column methods with 400 L of blood. The total reaction volume was prepared in 20 L for each Snp (single nucleotide ... See full document
37
Pharmacogenetics of rheumatoid arthritis: Potential targets from susceptibility genes and present therapies
... (eg, rheumatoid factor, ACPA status) as they afford greater predictive power, drastically reduce the need for repeated biochemical testing and are less affected by environmen- tal factors like ... See full document
14
Disease activity score 28 is a good predictor of cardiovascular disorders in egyptian patients with rheumatoid arthritis
... Rheumatoid arthritis is a chronic inflammatory disease of the joints with extra-articular ...with associated CVD 12 ...study population, and carotid plaques were found in 34% of ... See full document
5
Effects of Tocilizumab Therapy on Serum Interleukin-33 and Interleukin-6 Levels in Patients With Rheumatoid Arthritis
... Serum interleukin-33 and interleukin-6 concentrations in American College of Rheumatology 20 responders and non-responders before and after 24 weeks of tocilizumab ...Serum interleukin-33 levels in ... See full document
6
Genetic bias in immune responses to a cassette shared by different microorganisms in patients with rheumatoid arthritis
... specifically associated with rheumatoid disease, whereas the immune response genes influence magnitude and specificity of the antibody response to the ... See full document
46
Parental history of lupus and rheumatoid arthritis and risk in offspring in a nationwide cohort study: does sex matter?
... Results Among 3 513 817 parent–offspring triads, there were 1258 SLE cases among offspring (1095 female, 163 male) and 9118 cases of RA/JRA (6086 female, 3032 male). Among female offspring, SLE risk was nearly the same ... See full document
50
Ethnic variation in Interleukin 6 –174 (g/c) Polymorphism in the Malaysian population
... In contrast, the C allele frequency was signifi- cantly higher (19.0%) in the Indians in this study compared with the other two ethnic groups. The IL-6 –174 (G/C) polymorphism was relatively more evenly ... See full document
7
Original Article Interleukin-16 gene polymorphism is associated with acute coronary syndrome in the Chinese Han population
... are associated with risk of ACS. Findings indicated C in rs1131445 and G/G genotype in rs38- 48180 showed a higher risk of CAS than G/G and C double wild-type ... See full document
12
Lack of association of matrix metalloproteinase 3 gene polymorphism with susceptibility to rheumatoid arthritis: a meta analysis
... Second, our meta-analysis included data from Caucasian and Asian, thus our study should be optimized by larger scale of populations. Third, lack of the original data of available studies limited our further evaluation of ... See full document
74
Association of interleukin-6 gene polymorphisms and circulating levels with keloid scars in a Chinese Han population.
... IL-6 gene, located on chromosome 7p21-24, has three single nucleotide polymorphisms (SNPs) within its promoter region (Terry et ...is associated with IL-6 gene transcription, which subsequently ... See full document
5
TLR4 rs41426344 increases susceptibility of rheumatoid arthritis (RA) and juvenile idiopathic arthritis (JIA) in a central south Chinese Han population
... TLR4 gene consisting of three exons is located on chromosome 9q32–33 ...are associated with a blunted receptor activity and a subsequently diminished inflammatory response in humans ...be associated ... See full document
6
Principal component based population structure adjustment in the North American Rheumatoid Arthritis Consortium data: impact of single nucleotide polymorphism set and analysis method
... highly associated SNPs (Figure 2), suggesting that the structure that exists in this sample does result in some ...for population structure at the cross-continent level, rather than the more subtle ... See full document
63
Related subjects