[PDF] Top 20 La Sentencia de la Audiencia Nacional de 31 de enero de 2013
Has 10000 "La Sentencia de la Audiencia Nacional de 31 de enero de 2013" found on our website. Below are the top 20 most common "La Sentencia de la Audiencia Nacional de 31 de enero de 2013".
The Association of MTHFR C677T and A1298C Polymorphisms with Methotrexate Response and Toxicity in Psoriasis
... forward primer. Therefore, in a single PCR reaction, the possible PCR products included the 433-bp of the first primer pair which served as a control and either the 200-bp of the C allele or the 292-bp of the T allele. ... See full document
26
Association of methylenetetrahytrofolate reductase (MTHFR) C677T and A1298C polymorphisms with the susceptibility of childhood acute lymphoblastic leukaemia (ALL) in Chinese population
... the MTHFR A1298C but not the C677T polymorphism is a potential biomarker for childhood ALL risk in the Chinese population, which is inconsistent with the results of Yan et ...between MTHFR ... See full document
8
A Study on the Clinical Profile and Pharmacogenetics of Methotrexate Treatment in Patients with Rheumatoid Arthritis.
... both C677T & A1298C polymorphisms in this gene and found A1298C polymorphism rendered the patients sensitive to MTX treatment, whereas C677T rendered the patients prone for ...two ... See full document
2
Use of MTHFR C677T polymorphism and plasma pharmacokinetics to predict methotrexate toxicity in patients with acute lymphoblastic leukemia
... In the present study, we analyzed the relation between MTX pharmacokinetics and MTX-related toxicities during HD-MTX courses. In multiple linear regression analysis, we found that plasma MTX levels at 48 h were signifi- ... See full document
172
Original Article Association of MTHFR C677T and A1298C polymorphisms with the development of type 2 diabetic nephropathy and their interaction with environmental factors
... the MTHFR C677T and A1298C were genetic risk factors for type 2 diabetic nephropathy in patients with type 2 diabetes ...that MTHFR C677T mutation was associated with increased blood ... See full document
41
Are Methylenetetrahydrofolate Reductase (MTHFR) Gene Polymorphisms C677T and A1298C Associated with Higher Risk of Pediatric Migraine in Boys and Girls?
... encodes MTHFR enzyme that converts 5,10-methylenetetrahydrofolate into 5-methylenetetrahy- drofolate, which is the circulating form of folate in ...heterozygous C677T or A1298C variants of the ... See full document
12
Methylenetetrahydrofolate Reductase C677T and A1298C Polymorphisms in Male Partners of Recurrent Miscarriage Couples
... on MTHFR polymorphism variants and RM have been performed in both male and female ...Leiden, MTHFR C677T and pro- thrombin G20210A SNPs in males and females of RM couples and compared their results ... See full document
27
Original Article MTHFR C677T and A1298C polymorphisms and oral cancer risk: an updated meta-analysis
... in MTHFR gene were involved in the eti- ology of ...of MTHFR gene in oral carcinogenesis, we performed an update analysis on all eligible case-control studies [8- 16] or only case studies involving tumor ... See full document
256
Original Article Association of MTHFR NFKB1 NFKBIA DAZL and CYP1A1 gene polymorphisms with risk of idiopathic male infertility in a Han Chinese population
... the association between six genetic polymorphisms (MTHFR C677T and A1298C, NFKB1 -94ins/del ATTG, NFKBIA 3’UTR A>G, DAZL A386G (T54A) and CYP1A1 T3801C) and the risk of idiopathic ... See full document
62
Original Article MTHFR C677T and A1298C polymorphisms are not related to ventricular or atrial septal defect: a meta-analysis of 1272 cases and 1386 controls
... the MTHFR gene, a polymorphism mutation in exon 4 (C677T) results in a substitution of alanine with valine, and the mutation in exon 7 (A1298C) results in the substitution of glutamic acid with ... See full document
144
Inherited Genetic Markers for Thrombophilia in Northeastern Iran (a Clinical-Based Report)
... Background: Thrombophilia is a main predisposition to thrombosis due to a procoagulant state. Several point mutations play key roles in blood-clotting disorders, which are grouped under the term thrombophilia. These ... See full document
53
Association between SOD2 T-9C and MTHFR C677T polymorphisms and longevity: a study in Jordanian population
... of MTHFR might decrease life ...and MTHFR pol- ymorphisms (Table ...that MTHFR C677T allele is not a strong risk factor for premature death in Ire- land (sample size: 1388, age criterion > ... See full document
26
Polymorphisms in the <em>MTHFR</em> gene are associated with recurrence risk in lymph node-positive breast cancer patients
... with MTHFR gene ...that MTHFR genotypes were not associated with all-cause mortality in patients who received 5-FU and methotrexate- based chemotherapy consistent with our ... See full document
17
Association of Homozygous Thrombophilia Polymorphisms and Venous Thromboembolism in Shahrekord,Iran
... (MTHFR) C677T polymorphisms are the main risk factors for ...(5). MTHFR plays an important role in maintaining homocysteine ...The C677T polymorphism of MTHFR molecule makes the ... See full document
87
Genetic risk factors in patients with deep venous thrombosis, a retrospective case control study on Iranian population
... significant association between FV Leiden mutation and DVT (OR ...the association between MTHFRC677T and DVT were statistically significant (OR ...The association between MTHFRA1298C and DVT were ... See full document
85
Nicotinamide-N-Methyltransferase gene rs694539 variant and migraine risk
... In the case control studies, a number of polymorphisms have been shown to be associated with migraine. Plasma urotensin-2 level and thr21met variant have been reported to be associated with migraine [29]. It has ... See full document
6
Epilepsy control with carbamazepine monotherapy from a genetic perspective
... that polymorphisms in the MTHFR gene lead to altered MTHFR activity may affect the individual metabolome either in shape of vitamin B6 deficiency that may be one cause for weak- ness of inhibitory ... See full document
16
The rs4846049 polymorphism in the 3’UTR region of the <em>MTHFR</em> gene increases the migraine susceptibility in an Iranian population
... The C677T variant was determined by PCR-restriction frag- ment length polymorphism (RFLP) using the following prim- ers: 677-forward 5 ′ AGCTTTGAGGCTGACCTGAAG3 ′ and 677-reverse 5 ′ AGGACGGTGCGGTGAGAGTG3 ′ ... See full document
5
Association between Methylenetetrahydrofolate Reductase (MTHFR) Gene Polymorphisms and Susceptibility to Childhood Acute Lymphoblastic Leukemia in an Iranian Population
... P=0.005). MTHFR rs1801131 (A1298C) polymorphism showed that the AC heterozygous genotype decreased the risk of ALL in comparison with AA homozygous genotype ...significant association between ... See full document
12
Association of <em>MTHFR</em> C677T and A1298C polymorphisms with oral cancer susceptibility: evidence from a meta-analysis
... between MTHFR C677T and A1298C polymorphisms with oral cancer susceptibility; however, the results are ...the C677T polymorphism, as well as five studies with 973 cases and 1024 ... See full document
10
Related subjects