3. La construcción mediática de la realidad El documental
3.3. Paradigma historiográfico
Apodemus sylvaticus in North Yorkshire
Nicole Dodd, Denise Thomasson, Elizabeth Wright, Jacqueline Hughes, and Geoff Hide, Centre for Parasitology and Disease, School of Environment and Life Sciences, University of Salford
Abstract
The coccidian parasite Toxoplasma gondii is ubiquitous and affects many mammals including humans. Wild and domestic felids are the definitive host, however Toxoplasma can infect all warm-blooded animals. Toxoplasmosis is a significant cause of abortion, stillbirth and disease in both humans and livestock. Three routes of transmission occur; ingestion of tissue cysts in the intermediate hosts, ingestion of oocysts shed by the definitive host into the environment and the transplacental crossing of tachyzoites from mother to foetus. The relative importance of each of these transmission routes in the epidemiology of the parasite has been long debated, however it is widely accepted that the definitive host is the main source of infection. The wood mouse (Apodemus sylvaticus) was sampled as part of a continuous study of parasites in the area over a 10 year period from North Yorkshire in an area free from cats. The presence of Toxoplasma was detected using PCR amplification of the SAG-1 gene. Over the 10 year study 81/206 mice tested positive for Toxoplasma gondii; the mean prevalence was 39.3% (± 6.2%). As the area is free from cats, this high level of prevalence suggests that other mechanisms of parasite transmission are likely to be important in this population of Apodemus sylvaticus.
Introduction
The obligate intracellular parasite Toxoplasma gondii is ubiquitous and uses an unusually diverse range of hosts. It is a member of the phylum Apicomplexa characterised by possessing an ‘apical complex’ located in the anterior end of the organism used for host cell penetration. The phylum is an ancient group comprising of around 5000 parasitic species including significant pathogens of humans and animals. These include the causative agent of malaria Plasmodium spp and the common poultry disease coccidiosis caused by Eimeria spp. Both wild and domestic felids are the definitive host where the parasite completes its sexual cycle. However Toxoplasma can potentially infect all warm-blooded animals.
The parasite is of medical and veterinary importance as it can cause congenital disease and abortion in intermediate hosts (Dubey and Jones, 2008). In humans infection is usually afebrile and self-limiting although immunocompromised hosts can suffer lymphadenopathy or more seriously encephalitis. Toxoplasmic encephalitis is the most common presentation of the disease in AIDS patients and is usually due to the reactivation of latent tissue cysts (Howe and Sibley, 1995).
Three routes of transmission occur: the horizontal transmission of infective oocysts shed by the cat, the ingestion of tachyzoites from tissue cysts and vertically through the transplacental crossing of tachyzoites from mother to foetus (Rosai, 2004). The relative importance of each of these routes of transmission is still unclear. There are many strains of Toxoplasma however the vast majority (>95%) fall into three distinct lineages (reviewed in Sibley, 2003), of which the genotypes within each lineage differ by 1% or less (Su et al., 2003). It is unusual that, despite the ubiquity of the parasite, the population structure of T. gondii is extremely clonal and highly conserved. This points towards a relatively recent common ancestor followed by predominantly asexual propagation (Dubey and Jones, 2008; Su et al., 2003).
Cats are thought to be the major source of infection although only 1% of cats are estimated to be shedding viable oocysts at any one time (Dubey and Beattie, 1988). Infective meat is also considered important although this does not explain the high prevalences found in strict vegetarians (Hall et al., 1999). Vertical transmission is traditionally considered less important epidemiologically, however it has been observed at high levels in natural populations and experimental infections in numerous species (Duncanson et al., 2001; Flori et al., 2002;
experimentally infected (Owen and Trees, 1998) and also in natural urban populations (Marshall et al., 2004; Murphy et al., 2008).
The objective of the current study was to investigate the prevalence of Toxoplasma gondii in a wild population of wood mouse (Apodemus sylvaticus) in North Yorkshire using molecular techniques. Furthermore, we aim to consider the importance of transmission routes that bypass the cat by investigating the prevalence of Toxoplasma in an area free of cats.
Materials and methods
The wood mouse (Apodemus sylvaticus) n = 206 was sampled from the surrounding area of Malham Tarn, North Yorkshire over a 10 year period as part of a continuous study of parasites in the area. Brains were removed in sterile conditions and stored frozen in 400µl of lysis buffer and then taken back to Salford University. DNA was extracted from brain tissue using phenol/chloroform standard procedure as described by Williams et al. (2005), and the presence of Toxoplasma was detected using nested PCR amplification of the Surface Antigen Gene 1 (SAG-1) (Savva et al., 1990). The PCR reaction was conducted as follows: each 25µl of PCR consisted of 2.5µl Bioline (without MgCl2), 2.5µl β-mercaptoethanol (50mM), 1µl MgCl2
(50 mM), 0.25 µl of deoxynucleotide triphosphate mix (25 mM each), 2.5 µl of each oligonucleotide primer 10 pM/µl, 12.25 µl of water, 0.5 µl of Taq DNA polymerase (5 units/µl) and 1 µl of DNA template. In the first PCR amplification was carried out at 95°C for 5 min, then 40 cycles of (i) 95°C for 40 sec (ii) 63°C for 40 sec and (iii) 72°C for 1 min 10 sec, and lastly 72°C for 10 min with primers 5’ TTGCCGCGCCCACACTGATG 3’ and 5’ CGCGACACAAGCTGCGATAG 3’. Following the first round of PCR, 2µl the first round product was used in the second round with the second round primer pairs 5’ CGACAGCCGCGGTCATTCTC 3’ and 5’ GCAACCAGTCAGCGTCGTCC 3’, using the same number of cycles and thermal profile as the first round.
Prior to the SAG-1 assay DNA was tested using primers for mammalian tubulin to ensure that the quality of the DNA was suitable for PCR in order to reduce the chances of accepting a false negative. Concentrations of DNA were also increased and decreased to ensure true negativity. All mice collected in 2008 tested positive for tubulin and therefore were able to successfully undergo PCR. In previous years, mice samples that tested negative for tubulin were omitted from the study. PCR products were visualised on 1.5% gels which were trans-illuminated with UV light. Molecular grade water was used in the reactions as a negative control.
Results
DNA extracted from Apodemus sylvaticus was amplified using the SAG1 PCR and analyses by gel electrophoresis. An example is shown in Figure 1. A 522bp band indicates a positive amplification. A total of 206 mice were tested for Toxoplasma over a 10 year period. The prevalence infection determined by PCR can be seen from Table 1. An overall prevalence of 39.3% (± 6.2%) of T. gondii was detected over the 10 years of study. Prevalences ranged between 10.5% (2007) to 69% (2003).
Figure 1. SAG-1 PCR gel electrophoresis Malham mice 2008. Lane 1, mouse 280, lane 2, mouse 281, lane 3, mouse 282, lane 4, mouse 283, lane 5, mouse 284, lane 6, mouse 285, lane 7, mouse 286, lane 6, mouse 287, lane 7, mouse 288, lane 8, mouse 289, lane 9, mouse 290, lane 10 mouse, 291, lane 11, mouse 292, -ve negative control, +ve positive control, M 1Kb Invitrogen marker. 1 µl DNA was used per reaction.
Table 1. Prevalence of T. gondii infection at Malham Tarn, Yorkshire Year 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 Mean Total mice 37 24 19 16 29 8 24 9 19 21 206 Infected 17 4 6 10 20 3 13 4 2 2 81 Prevalence (%) 46 17 32 62.5 69 37.5 54 44 10.5 9.5 39.3 Discussion
In this study we investigated the prevalence of Toxoplasma gondii in a wild population of Apodemus sylvaticus in North Yorkshire using a PCR based detection assay. We found 81 of the 206 mice sampled positive for Toxoplasma; the mean prevalence over the last 10 years in the area was 39.3%. As the area is free from cats, this suggests that other mechanisms of parasite transmission may be important in this population of Apodemus sylvaticus. This raises important questions about the routes of transmission of this parasite. The cat is the only known definitive host however the importance of its role in the epidemiology of Toxoplasma has recently been questioned (e.g. Hide et al., 2009). This is largely due to the fact that oocysts are only shed from the feline host for around 14 days as a kitten (Hill and Dubey, 2002). Further to this, certain groups of humans and mammals found to have high prevalence of Toxoplasma should, theoretically, have low prevalences due to either their customs or environment restricting them to oocyst exposure. An example of this is the religious group ‘Jains’ who are strict vegetarians and do not eat root vegetables. Coincidently the Jain’s religious practices follow recommendations similar to those given to pregnant women for prevention of Toxoplasma infection (Hall et al, 1999). High levels of Toxoplasma have also been found in marine mammals (Mikaelian et al., 2000; Oksanen et al., 1998); approximately 16% of sea otter deaths off the coast of California have been linked to Toxoplasma infection (Miller et al., 2004). What is more, the population structure of Toxoplasma is clonal and highly conserved, suggesting limited genetic exchange. This would point towards the asexual routes being the significant method of propagation for this parasite, and as the parasite has been detected in strict herbivores, it would seem that vertical transmission may be a grossly underestimated contributor in the parasite’s wide distribution and high prevalence.
The high levels of vertical transmission recorded in various mammalian species (Duncanson et al., 2001; Flori et al., 2002; Marshall et al., 2004; Morley et al., 2008; Murphy et al., 2008; Owen and Trees, 1998; Roberts et al., 1994) raises the issue of the possibility that congenital transmission occurs more frequently than currently thought. Further to this, the mechanism by which this happens may actually be the reactivation of latent infections caused by the immunosuppressed state in which is induced by pregnancy, rather than the result of the host being infected for the first time during gestation. The genetic population structure of Toxoplasma gondii also suggests limited genetic exchange since a recent event. This would point towards the asexual routes being the significant method of propagation for this parasite. Further research is necessary to elucidate the relative importance of transmission routes in this important pathogen.
Acknowledgments
References
Couper, K.N., Nielsen, H.V., Petersen, E., Roberts, F., Roberts, C.W. and Alexander, J. (2003) DNA vaccination with the immunodominant tachyzoite surface antigen (SAG-1) protects against adult acquired Toxoplasma gondii infection but does not prevent maternofoetal transmission. Vaccine. 21, 2813-2820
Dubey, J.P. and Beattie, C.P. (1988) Toxoplasmosis of animals and man. Boca Raton (FL): CRC Press
Dubey, J.P. and Jones, J.L. (2008) Toxoplasma gondii infection in humans and animals in the United States. International Journal for Parasitology. 38, 1257-1278
Duncanson, P., Terry, R.S., Smith, J.E. and Hide, G. (2001) High levels of congenital transmission of Toxoplasma gondii in a commercial sheep flock. International Journal of Parasitology. 31, 1699-1703
Flori, P., Hafid, J. Bourlet, T., Raberin, H., Genin, C. and Tran Manh Sung, R. (2002) Experimental model of congenital toxoplasmosis in guinea-pigs: use of quantitative and qualitative PCR for the study of maternofoetal transmission. Journal of Medical Microbiology. 51, 871-878
Hall, S.M., Pandit, A., Golwilkar, A., Williams, T.S. (1999) How do Jains get toxoplasma infection? Lancet. 354, 486-487
Hide, G., Morley, E.K., Hughes, J.M., Gerwash, O., Elmahaishi, M.S., Elmahaishi, K.H., Thomasson, D., Wright, E.A., Williams, R.H., Murphy, R.G. and Smith, J.E. (2009) Evidence for high levels of vertical transmission in Toxoplamsa gondii. Parasitology, in press. 139
Hill, D. and Dubey, J.P. (2002) Toxoplasma gondii: transmission, diagnosis and prevention. Clinical Microbiology and Infectious Disease. 8, 634-640
Howe, D.K. and Sibley, D.L. (1995) Toxoplasma gondii comprises three clonal lineages: correlation of parasite genotype with human disease. The Journal of Infectious Disease. 172, 1561-1566
Marshall, P.A., Hughes, J.M., Williams, R.H., Smith, J.E., Murphy, R.G and Hide, G. (2004) Detection of high levels of congenital transmission of Toxoplasma gondii in natural urban populations of Mus domesticus. Parasitology. 128, 39-42
Mikaelian, I., Boisclair, J., Dubey, J.P., Kennedy, S. and Martineau, D. (2000) Toxoplasmosis in beluga whales (Delphinapterus leucas) from the St Lawrence estuary: two case reports and a serological survey. Journal of Comparative Pathology. 122, 1, 73-76
Miller, M.A., Grigg, M.E., Kreuder, C., James, E.R., Melli., A.C., Crosbie, P.R., Jessup, D.A., Boothroyd, J.C., Brownstein, D. and Conrad, P.A. (2004) An unusual genotype of Toxoplasma gondii is common in California sea otters (Enhydra lutris nereis) and is a cause of mortality. International Journal for Parasitology. 34, 3, 275-284
Morley, E.K., Williams, R.H., Hughes, J.M., Terry, R.S., Duncanson, P., Smith, J.E. and Hide, G. (2005) Significant familial differences in the frequency of abortion and Toxoplasma gondii infection within a flock of Charollais sheep. Parasitology, 131 181-185
Morley, E.K., Williams, R.H., Hughes, J.M., Thomasson, D., Terry, R.S., Duncanson, P., Smith, J.E. and Hide, G. (2008) Evidence that primary infection of Charollais sheep with Toxoplasma gondii may not prevent foetal infection and abortion in subsequent lambings. Parasitology. 135, 169-173
Murphy, R.G., Williams, R.H., Hughes, J.M., Hide, G., Ford, N.J. and Oldbury, D.J. (2008) The urban house mouse (Mus domesticus) as a reservoir of infection for the human parasite Toxoplasma gondii: an unrecognised public health issue? International Journal of Environmental Health Research. 18, 3, 177-185
Oksanen, A., Tryland, M., Johnsen, K. and Dubey, J.P. (1998) Serosurvey of Toxoplasma gondii in North Atlantic marine mammals by use of agglutination test employing whole tachyzoites and dithiothreitol. Comparative immunology, Microbiology and Infectious Disease. 21, 107-114
Roberts, C.W., Brewer, J.M. and Alexander, J. (1994) congenital toxoplasmosis in the Balb/c mouse: prevention of vertical disease transmission and foetal death by vaccination. Vaccine. 12, 15, 1389-1394
Rosai, J. (2004) Rosai and Ackerman’s Surgical Pathology. Elsevier. 1, 9th Edition. London, UK Savva, D., Morris, J.C., Johnson, J.D., and Holliman, R.E. (1990) Polymerase chain reaction for
the detection of Toxoplasma gondii. Journal of Medical Microbiology. 32, 25–31
Sibley, L. D. (2003) Recent origins among ancient parasites. Veterinary Parasitology. 115, 185-198
Su, C., Evans, D., Cole, R.H., Kissinger, J.C., Ajioka, J.W. and Sibley, L.D. (2003) Recent expansion of Toxoplasma through enhanced oral transmission. Science. 299, 414-416 Tenter, A.M., Heckeroth, A.R. and Weiss, L.M. (2000) Toxoplasma gondii: from animals to
humans. International Journal of Parasitology. 30, 1217-1258
Williams, R.H., Morley, E.K., Hughes, J.M., Duncanson, P., Terry, R.S., Smith, J.E., Hide, G., (2005) High levels of congenital transmission of Toxoplasma gondii in longitudinal and cross-sectional studies on sheep farms provides evidence of vertical transmission in ovine hosts. Parasitology. 130, 301–307